Insect Immunity

W
Shared by: liaoqinmei
Categories
Tags
-
Stats
views:
6
posted:
12/2/2011
language:
English
pages:
5
Document Sample
scope of work template
							THEJOURNAL OF BIOLOGICAL
                       CHEMISTRY                                                                              Vol. 269, No. 52, Issue of December 30, pp. 33159-33163, 1994
0 1994 by The American Society for Biochemistry and Molecular Biology, Inc.                                                                                Printed in U.S.A.



Insect Immunity
SEPTIC INJURY OFDROSOPHILA INDUCES THE SYNTHESIS OF POTENT ANTIFUNGAL PEPTIDE WITH
                                                  A
SEQUENCE HOMOLOGY TO PLANT ANTIFUNGAL PEPTIDES*

                                                                                                                (Received for publication, September 2, 1994)


                Pascale FehlbaumS, Philippe BuletS, Lydia MichautS, Marie LagueuxS, Willem F. BroekaertO,
                Charles HetruS, andJules A. Hoffmannh
                                                                                                       la
                From the vnstitut deBiologie Moliculaire et Cellulaire, UPR 9022 Centre National de Recherche Scientifique “Riponse
                Immunitaire et De‘veloppement chez les Znsectes,” 15, rue Rene‘ Descartes, 67084 Strasbourg Cedex, France and the§F: A.
                Janssens Laboratory of Genetics, Catholic University of Leuuen, Willem De Croylaan 42, B-3001Heuerlee, Belgium



   In response to a septic injury (pricking with a bacte-                                                                  a
                                                            coccus luteus and Escherichiacoli 1106. The insects were kept t 25 “C
ria-soaked needle) larvae and adults     of Drosophila pro- for 24 h and frozen in liquid nitrogen until extraction.
duce considerable amounts of a 44-residue peptide con-         Extraction and Purification-Abdomens and thoraces were ground to
                                                            a finepowder in a mortar in the   continuous presenceof liquid nitrogen.
taining 8 cysteines engaged in intramolecular disulfide
                                                            The powder was taken up in 10 volumes (w/v) of 25 m ammonium
                                                                                                                     M
bridges. The peptide is synthesized in the fat body, a acetate buffer, pH 5.2, containing 10pg/ml aprotinin, for 20 min in an
functional homologue of the mammalian liver, and se- ice-cold water bath. After centrifugation        (3,000x g, 30 min, 4 “C), the
creted into the blood of the insect. It exhibits potent     supernatant was loaded onto two linked Sep-PakC,, cartridges previ-
                        is
antifungal activity but inactive against bacteria. This                                                               M
                                                            ously washed with methanol and equilibrated with25 m ammonium
novelinduciblepeptide,whichweproposetoname                  acetate bufferat pH 5.2. Elution wasperformed stepwise with various
                    a
drosomycin, shows significant homology with a family        solutions of acetonitrile in the same buffer (10, 30, and 80% acetoni-
of5-kDa cysteine-richplantantifungalpeptidesre-             trile). Fractions were concentrated under vacuum, reconstituted in  Mil-
cently isolatedfrom seeds of Brassicaceae. This finding liQ water, and applied on an Aquapore OD300 C,, column (250 x 4.6
underlines that plants and insects can rely on similar                                           the
                                                            mm, BrownleeTM) equilibrated with samebuffer. Elutions were per-
                                                            formed with a linear gradientof 7-57% acetonitrile in the same    buffer
molecules in their innate host defense.                     over 90 min at a flow rate of 1 mumin. The fraction containing the
                                                                                                  strongly induced peptide (see below) was desalted by reversed-phase
                                                                                                  HPLC’ on an Aquapore RP300 C, column (30 x 2.1 mm, BrownleeTM)
                                                                                                                          of
     Drosophila, like o t h e r i n s e c t s , r e s p o n d s t o s e p t i c injury by with a linear gradient 10-90% acetonitrile inacidified water (0.05%
the r a p i d and transient synthesis of a battery of p o t e n t anti- trifluoroacetic acid) at a flow rate of 1mumin over 20 min. All HPLC
                                                                                                  purificationswereperformedwithaBeckman             Gold HPLC system
bacterial peptides (reviewed in Refs. 1and 2). The principal site
                                                                                                  equipped with a photodiode array detector Beckman 168. The column
of synthesis of these peptides is the fat body, a functional ho- effluent was monitored by absorbance at 225 nm.
mologue ofthe mammalian liver. The i n s e c t h o s tdefense lacks                                  Microorganisms-Filamentous fungi were grown on a five-cereal me-
specificity and memory, and it has been argued that it is ho- dium. Spores were harvested described previously (7). Thefollowing as
mologous to the mammalian a c u t e phase response (1,3).                                         fungal strains were used: Alternaria brassicola(MUCL 20297), Alter-
     To date, a limited number of immune-induced peptideshave naria longipes (CBS 620-831, Ascochytu pisi (MUCL 301641, Botrytis
                                                                                                  cinerea (MUCL 30158), Fusarium culmorum (IMI 1804201, Fusarium
been i s o l a t e d f r o m D r o s o p h i l aand their s t r u c t u r e s c h a r a c t e r - oxysporum (MUCL 9091, Nectria haematococca (Collection Van Etten
ized (4,5). The isolation studies were based so f a r o nthe use of                               160-2-2), Neurospora   crassa(CBS      327-541, Dichodermahamatum
growth inhibition assays to detect antibacterial activities. We (MUCL 297361, and Dichoderma uiride (MUCL 19724).
have taken here a n o v e l a p p r o a c h based on differential pro-                               Bacteria were precultured in appropriate conditions (4). The   follow-
                                                  untreated and immune-chal- ing are the bacterial strains used with their source (gifts
t e i n o g r a m s between e x t r a c t s f r o m                                                                                                              from col-
lenged insects. Under o u r w o r k i n g c o n d i t i o n s , w h iused mild leagues): Bacillus megaterium from J. Millet and A. Klier (Pasteur
                                                                                ch
                                                                                                  Institute, Paris); M. luteus A270 from the Pasteur Institut Collection,
acidic extraction techniques, we observed massive appear-     the
                                                                                                  Paris; Staphylococcus aureus, Streptococcus sanguis, Streptococcus
a n c e a f t e r c h a l l e n g e oa small sized, slightly cationic peptide. agalatae, and Pseudomonas cepacia
                                     f                                                                                                  from H. Monteil (Institute of Bac-
We r e p o r t the a m i n o a c i d s e q u e n c e of this peptide and the teriologie, University of Strasbourg); Enterobacter cloacae p12 and E.
cloning of the corresponding cDNA. This peptide exhibits po-                                      coli D31 from H. G. Boman (Department of Microbiology, University
tent a n t i f u n g a l activity and s h o w s sequence homology tosmall of Stockholm), and E. coli D22 from P. L. Boquet (Centre #Etudes
sized   cationic    cysteine-rich              antifungal molecules           recently            Nuclbaires, Saclay).
i s o l a t e df r o m seeds ofBrassicaceae,includingArabidopsis                                     Antifungal, Antimicrobial Assays-Fungal spores (final concentra-
                                                                                                  tion: lo4 sporedml) were suspended in a growth medium containing
thaliana (6).                                                                                     Potato Dextrose Broth (DIFCO, in half-strength, supplemented with
                                                                                                  tetracycline (10 pg/mV and cefotaxim (100 pg/ml)), dispensed by ali-
                              MATERIALANDMETHODS                                                  quots of 80 pl intowells of a microplate containing20 pl of either water
    Immune Challenge of Insects-1-day-old adult males of Drosophila                                                    be
                                                                                                  or of the fractions to analyzed, and incubatedfor 48 ha t 25 “C in the
Oregon R were individually pricked, under CO,, with a needle dipped dark. Growth of fungi was evaluated by measuring the culture absorb-
into a combined bacterial pellet of 37 “C overnight cultures of Micro- ance a t 595 nm using a microplate reader.
                                                                                                     Antibacterial activity was measured by a liquid growth inhibition
    * The costsof publication of this article were defrayed in part by theassay as described previously (4). red blood cells were washed sev-
payment of page charges. This article must therefore be hereby markedHemolytic Activity Assay-Bovine
“advertisement” in accordance with 18 U.S.C. Section 1734 solely to eral times with phosphate-buffered saline. A 0.5% suspension of red
indicate this fact.                                                                               blood cells was made in phosphate-buffered saline. Hemolytic activity
    The nucleotide sequence(s) reported in this paper has submitted      been
to the GenBankmIEMBL Data Bank with                   accession number(s) X75595.        ’            The abbreviations used are: HPLC, high performance liquid chro-
        o
    1 T whom correspondence should be addressed:Tel.: 33-88-41-7077; matography; AFP, anti-fungal peptide; MOPS, I-morpholinepropane-
Fax: 33-88-60-69-22.                                                                              sulfonic acid.

                                                                                33159
33160                                                Peptide
                                                    Drosophila Antifungal
was measured as follows. 10 pl of the pure peptide (10 pg) were incu-
bated in a microtiter plate with 100 pl of the 0.5% red blood cells. As a
positive control (100% lysis), a solution of 1% detergent (Triton X-100)
was used instead of the molecule for analysis. After 1h of incubation at                                                                  A
37 "C, the plate was centrifuged (288 x g, at 10 "C, for 5 min), and the
absorbance of 50 pl of the supernatant was measured at 405 nm.
   Proteolysis-Purified peptide was treated with S. aureus V8 protease
(Takara, Kyoto), trypsin, chymotrypsin, elastase, and thermolysin (all
from Boehringer Mannheim), in the conditions recommended by the
supplier with an enzymdprotein ratio of 25% (w/w),except for endopro-
teinase Glu-C (S. aureus V8 protease) where the ratio was 1%.           For
pepsin (Boehringer Mannheim) we used 0.1 M Tris-HC1buffer at pH 3.5,
and incubation was performed over 16 h at 37 "C. All reactions were
stopped directly by injection on reversed-phase HPLC.
   Reduction and Alkylation-An aliquot of the purified peptide (2
                                                        M
nmol) was dissolved in 40 pl of 0.5 M Tris-HC1, 2 m EDTA, pH 7.5,                              10          20               30      4a
containing 6 M guanidine hydrochloride to which 2 pl of 2.2 M dithio-                                          Time (min)
threitol were added. The sample was flushed with nitrogen and incu-
bated for 1h a t 45 "C in the dark. Freshly distilled 4-vinylpyridine (2 pl)
was added, and the sample was incubated for 10 min at 45 "C in the
dark. The pyridylethylated peptide was separated by reversed-phase             2
                                                                                                                             PIxl
                                                                                                                               I
HPLC prior to sequencing.
   Microsequence Analysis-Automated Edman degradation of the na-
tive and of the pyridylethylated peptide and detection of phenylthiohy-
dantoin derivatives were performed on a pulse liquid automatic se-
quenator (Applied Biosystems, model 473A).
   Mass Spectrometry-The purified peptide was dissolved in water/
methanol (50:50, v/v) containing 1%     acetic acid and analyzed on a VG
BioTech BioQ mass spectrometer (Manchester). This instrument con-
sists of an electrostatic ion spray source operating at atmospheric pres-
sure, followedby a quadruple mass analyzer with a mass range of
                                                           .
14,000. The extraction cone voltage value was 55 V Scanning was
performed from mlz 1,500 in 10 s with the resolution adjusted so that
the mlz 998 peak from horse heart myoglobin was 1.5-1.7 Da at its
                                                                                r        -
base. The data system was operated as a multichannel analyzer, and                           10          20               30      40
several scans were summed to obtain the final spectrum. Each molec-                                           Time (min)
ular species produced a seriesof multiply charged protonated molecular
ions from a separate introduction of horse heart myoglobin (16,951.4           FIG. Reversed-phaseHPLC separation of extracts of naive
                                                                                    1.
Da). Molecular masses are given as average values based on the atomic (A) and challenged adult males Drosophila ( B ) .The
                                                                                                                    of                     material
                                                                             contained in fraction F-30% (see "Results") was loaded on an Aquapore
weights of the elements (C = 12.011, H = 1.00794, N = 14.0067, 0 = OD300C1, column and eluted with a linear gradient (dotted line) of
15.9994, and S = 32.06); only average masses were measured.                                       M
                                                                             acetonitrile in 25 m ammonium acetate buffer pH 5.2. Absorbance was
                                                                             monitored at 225 nm (solid line). Note the appearance of an absorption
                                 RESULTS
                                                                             peak P-30 in the extract of challenged insects.
   Isolation of a 44-Residue Peptide from Bacteria-challenged
1nsects-2,000 1-day-old adult males of Drosophila were chal-
                                                                                I          10             20           30           40     44
lenged as described under "Material and Methods." They were                    DCLSGRYKGP CAVWDNETCR RVCKEEGRSS GHCSFSLKCW CEGC
kept for 24 hat room temperature before extraction undermild
acidic conditions (pH 5.2). In parallel, 2,000 untreated adult               FIG.2. Amino acid sequence of the bacteria-induced 44-resi-
                                                                           due peptide.
males were subjected to extraction. The supernatants of the
two crude extracts were prepurified by solid phase extraction
on Sep-Pak C,, cartridges. The elution was successively per-               could correspond to cysteine residues, 2 nmol of P-30 were
formed with a 10, 30, and 80% solution of acetonitrile in am-              submitted to reduction and alkylation with 4-vinylpyridine,
monium acetate buffer at pH 5.2, yielding three fractions (re-             followed by Edman degradation. A sequence of 44 residues was
ferred to as F-lo%,   F-30%, and F-80%) which were separately              obtained comprising 8 cysteine residues (Fig. 2). One of these
analyzed by reversed-phase HPLC using various gradients of                 cysteine corresponds to the C-terminal residue. This residue
acetonitrile in ammonium acetate buffer. When the HPLC chro-               could not be detected in the absence of derivatization, thus
matograms of fraction F-10% from extracts of bacteria-chal-                explaining that we initially obtained a sequence of only 43
lenged and untreated Drosophila were compared, no clear-cut                residues.
difference could be observed, neither for the numberof absorp-                We next submitted 250 pmol of P-30 to electrospray mass
tion peaks nor for their relative intensities (data shown). A
                                                   not                     spectrometry in theconditions described in Bulet et al. (4) and
similar result was  obtained for fraction F-80%. In markedcon-             obtained a molecular mass of 4889.1 Da. The mass calculated
trast, the analysis of fraction F-30% showed the presence of a             for the 44 residues presented in 2 is 4897.5, i.e. in excess of
                                                                                                             Fig.
strong absorption peak in bacteria-challenged insects which                8 Da t o that measured mass spectrometry. This difference of
                                                                                                     by
could not be detected in control insects (Fig. 1,peak P-30). This                                                     of
                                                                           8 Da is attributable to the arrangement the 8 cysteine resi-
experiment was repeated five times with similar results. No                dues into  four intramolecular disulfide bridges, a process which
other obvious difference was noted in the HPLC chromato-                   eliminates 8 hydrogen atoms.
grams obtained from extracts of bacteria-challenged or un-                    We repeatedly analyzed extracts from unchallenged larvae
treated insects. Peak P-30 was purified to homogeneity by re-              and adults and                       44-residue peptide. In adult
                                                                                             failed to detect the
versed-phase HPLC on a C, column with a linear gradient of                 males, which we investigated in more detail, the 44-residue
acetonitrile in acidified water, which also served as a desalting          peptide was clearly evidenced as early as 1 h after bacterial
step. Two nanomoles of pure compound P-30 were then sub-                   challenge. The amounts recovered from challenged insects in-
jected t o automated Edmandegradation and gave a sequence of               creased for a period of up t o 16 h after which they reached a
43 residues withseven blanks. To check whether these blanks                plateau. Inone experiment we collected the hemolymph of 100
                                        Drosophila
                        Peptide Antifungal                                                                                       33161
                          GATAATTCAAACAGAAATCATTTACCAAGCTCCGTGAGAACCTTTTCCAAT          ATG ATG CAG ATC      i?
                                                                                        M   M     Q    I
                                                                                        1
                          > - X TAC TTG TTC GCC CTC TTC GCT GTC CTG ATG CTG GTG GTC CTG GGA GCC
                                                                                              114
                            X    Y   L  F   A   L   F  A   V   L   M  L   V   V  L   G   A
                                                   10                                             20
                          M C GAG GCC GAT GCC GAC TGC CTG TCC GGA AGA TAC AAG GGT CCC TGT GCC
                                                                                           165
                            K   K    A    D   A    D    C   L    S   G   R    Y    K    G    P    C    A
                                                                30
                          GTC TGG GAC AAC GAGA CC TGT CGT CGT GTG TGC AAG GAG GAG GGA CGC TCC 2 1 6
                            V   W    D    N   E    T    C   R   R    V   C     K   E    E   G     R    S
                                40                                            50
                                                                                 TAA ATCC
                           AGT GGC CAC TGC AGC CCC AGT CTG AAG TGC TGG TGC GAA GGA TGC                     268
                            S   G    H   C    S    P    S   L   K    C   W    C    E    G   C
                                              60                                             70
                           CATGAGCAATTAGCATGAACGTTCTGAAAAGCGCGTTTAGCTCTCCACTACTTACGACATATTCTATG            335
                           CTSCAATATTGAAAATCTAATAAACAAAATGTACATT(A)38                                      313

  FIG. Nucleotide sequence of a cDNA clone and deduced amino acid sequence correspondingto the precursor of the "residue
     3.
peptide. A size-selected                                  a                             et                    probe pool (5'-GT(Cm)TC(A/
                        cDNA library was screened using standard protocol (as in Bulet al.(4) with a degenerate




                                                                             -"
GjTT(A/G)TCCCA(C/G!AC-3')     complementary to residues 13-18 of the newly characterized peptide. The polyadenylation consensus signal is
                                                                                               et
underlined. The construction of the size-selected hgt22 cDNA and all conditions were as in Bulet al. (4).

bacteria-treated adults 24 h after challenge and observed the            MaleLarvae
                                                                     adultsPupae
presence of the 44-residue peptide (data not shown). We ascer-
tained its identity by partial peptide sequencing and electro-                0    4         0     7        0 1.5 7 24
spray mass spectrometry. The peptide was absent from the
hemolymph of untreated adults.
   Isolation of cDNA Clones Encoding a 70-Residue Precursor
Peptide-From the peptide sequence established above, we de-
vised a degenerate oligonucleotide probe pool corresponding to
residues 13-18. The probe pool was used to screen a size-se-
lected cDNA library preparedfrom bacteria-challenged larvae.
10,000 plaque-forming units were plated out and 120 hybrid-
ization-positive clones wereobtained,4        of which werese-
quenced. They were all 373 nucleotides long and contained an
open reading frame of 70 codons starting with two Met codons
                   a
and ending with stop codon (Fig. 3). Therewere no sequence            FIG. Northern blot analysis of the precursor of the 44-resi-
                                                                         4.
variations between these four cDNA clones. The amino acid due peptide. 20 pg of total RNAfrom naive ( 0 )and bacteria-challenged
sequence deduced from the cDNA clones obviously corresponds third instar larvae, young pupae, and adults (times after pricking in-
                                                                                                      by
to a precursor peptide containing the 44-residue sequence of dicated in hours) were fractionateddenaturing electrophoresis in          1%
the newly isolated peptide. The deduced sequence of the pep- agarose-formaldehyde gels with MOPS buffer. Transfer to nylon a s de-
                                                                   branes (HybondT", Amersham Corp.) was performed essentially
                                                                                                                                   mem-
tide is in perfect agreement with that obtained by Edman deg- scribed in Thomas (18).The membrane was hybridized overnight a t
radation. The 44-residue peptide is N-terminally flanked by a 42 "C with nick-translated"P-labeled cDNAprobe ([a-"'PldCTP, [U-'~PI
putative strongly apolar signal peptide up to residue Ala-21, dATP, 3000 Ci/mmol). Hybridization was performed under high strin-
which is a good candidate cleavage site for signal peptidase.      gency conditions. The membrane was first hybridized with the cDNA
                                                                   encoding the precursor of the 44-residue peptide (A), then with a ribo-
Alternatively, residues Ala-24 or Ala-26 could serve as cleavage somal protein (rp49) cDNA probe as a control ( B ) .
sites. If the signal peptidase acts at the level of Ala-21, a n
additional cleavage by dipeptidylaminopeptidases would be
necessary to yield the 44-residue peptide, as is the case for erythrocytes. In marked contrast,          however, in antifungal tests,
other bacteria-induced peptides in insects (8-10).                 the peptide showed a strong activity againsteight fungal
   Analysis of Dunscripts Encoding the 70-Residue Precursor strains tested (Fig. 6): N. crassa (IC5o0.6 PM),B. cinerea (IC5o
Peptide-One of the cDNA clones was used after nick transla- 1.2 PM),I? culmorum (IC5o1.0 PM), A. brassicola (IC5o PM),A.      0.9
tion to detectby Northern blotting experiments the                                           N.
                                                      presence of longipes (IC5o 1.4 p ~ ) , haematococca (IC5o1.8 PM),l? oxy-
transcripts in untreated and bacteria-challenged Drosophila.       sporum (IC5o4.2 PM), and A. pisi (IC5o3.2 PM).No or minimal
As shown in Fig. 4, a faint signalis present in naive insects and activity was found against two Dichoderma species (I: viride,
is noticeably increased in bacteria-challenged larvae, pupae,      I: hamatum). Fungal growthinhibitionwas also monitored
and adults.                                                        microscopically. High concentrations of the 44-residue peptide
   In situ hybridization was performed on paraffin-embedded (10 J ~ M      and above) completely inhibited spore germination and
naive and bacteria-challenged larvae and adults using    a digoxi- no hyphae were observed.
genin-labeled cDNA probe. A marked reaction was observed in           Lower concentrations of the peptide caused delayed growth
the fat body cells of challenged insects, as shown in Fig. 5. A of hyphae with abnormal morphology. More than 50% of the
 fainter, but distinct,reaction was also seen in the fat body in observed hyphae of B.cinerea treated with the 44-residue pep-
 absence of challenge (data not shown).                            tide at a concentrationof 1.2 PM,extruded cytoplasmic material
   Antifungal Activity of the 44-Residue Peptide-The purified along the hyphae (Fig. 7), indicating that the protein causes
 peptide was tested in variety of biological assays for antibac- partial lysis.
                        a
 terial, antifungal, or hemolytic activities. No antibacterial ac-    The antifungal activity was shown in similar tests to be
                                                                                             of
 tivity against a large variety of Gram-positive and Gram-neg- resistant to variations pH from 2 to 10 and toa 30-min heat
 ative bacteria(B. megaterium, M.luteus, S. aureus, S. sanguis, treatment at 100 "C (data not shown).
 S. agalatae, I? cepacia, E. cloacae, E. coli) was detected in        Finally, spores of the highly sensitive N. crassa were cultured
 standard conditions at concentrations ranging from 1to 20 p ~ . in the   presence of concentrations of 0.1-10 PMof the 44-residue
 The peptide did not exhibit hemolytic activity against bovine peptide. After 48 h, the medium containing the peptide was
33 162                                            Drosophila Antifungal Peptide




                        -         -~        "~
                                             ~




   FIG. Detection of transcripts encoding the 44-residue pep-
      5.
tide in 6-h bacteria-challenged third instar larvae by in situ
hybridization. Insects were fixed, embedded, sectioned, and hybrid-
ized with a digoxigenin-labeled cDNA probe encoding the precursor of
the 44-residue peptide, using a DIG-DNA labeling and detection kit
(Boehringer Mannheim). The protocol of Tautz and Pfeiflle (19)was            FIG. Inhibition of fungal growth bythe 44-residue peptide.
                                                                                 7.
modified a s follows. Fixation was in Carnoy's fix; prehybridation and    Photomicrographs were taken after 24 h of incubation of a B. cinerea
hybridization were carried out at 48"C in 50% formamide. cu, cuticle;     spore suspension in half-strength potato dextrose broth supplemented
fa, fat body.As a control, the same experiment was performed after        with 1m CaCI, and 20 m KC1 in the
                                                                                  M                M           absence of the 44-residue peptide
RNase treatment of slices, and they showed no staining (data not          (control, Panel A), or in the presence of 1.25 PM peptide (Panel B ) .
shown).                                                                   Arrowheads indicate sitesof hyphal lysis.

                                                                                                                         the
                                                                          by fresh medium. This result demonstrates that 44-residue
                                                                          peptide is fungicidal on N. crassa.

                                                                                                     DISCUSSION
                                                                                                   is
                                                                              The present study the first report on an inducible antifun-
                                                                           gal peptide in aninsect. As stated in the Introduction, insects
                                                                          have been shown to produce a variety of potent antibacterial
                                                                           peptides within hours following septic injury or a bacterial
                                                                           challenge. However, it had not been documented so far that this
                                                                                                                the           of
                                                                           type of challenge can also induce synthesis an antifungal
                                                                           peptide. Natori's group (11)    has recently isolated from larvae of
                                                                           the dipteran species Sarcophaga peregrina a 67-residue histi-
                                                                           dine-rich antifungal protein devoid of cysteines. This protein is
                                                                           constitutively present in the hemolymph, in contrast to the
                                                                           inducible peptidewhich we have now characterized in Drosoph-
                        1                   10          100 pM             ila. I n situ hybridization points to the fat as the major site
                                                                                                                        body
                            Concentration                                  of synthesis of this novel peptide in larvae and adultsof Dro-
                                                                          sophila. The Northern blot and in situ hybridization experi-
                                                                           ments indicate that transcripts encoding the antifungal pep-
                                                                           tide are constitutively present in larvae and adults and that
                                                                           their level is significantly enhanced upon septic injury. This
                                                      A/. brassicola       constrasts with our chemical isolation studies which failed to
                                                      AI. lmgipes          detect the presence of the antifungal peptide prior to immune
                                                      T. viride
                                                      T. hamatum
                                                                           challenge. A few hours after challenge, however, a dramatic
                                                      AS. pis;            induction of the peptide can be detected. This high level of
                                                                           production is illustratedby the fact that we could extract up to
                                                                           10 pmol of the peptide from one insect (this corresponds of an
                                                                           overall concentrations of 50 pg/g and could account for a blood
                                                                           concentration of up to 0.1 mM; note that theIC,, values are in
                                                                           the low micromolar range). Our presentworking hypothesis is
                                                                           that theexpression of the antifungal peptide is subjected both
                                                                           to transcriptional and translational    control mechanisms in con-
                                                                           trast to the   majority of the inducible antibacterial peptides, the
                                                                           expression of which is primarily controlled at the transcrip-
                            Concentration                                  tional level.
  FIG. Dose-response curves for different fungal strains.
     6.                                                                       Our cDNA cloning studies show that the44-residue peptide
Growth inhibition was measured at various concentrations of the 44-        is processed from a 70-residue precursor molecule. The exact
                                                              (IC5o,
residue peptide. Percent growth inhibition was recorded after 48         h
                                                                           mechanism of the processing remains to be elucidated.
peptide concentration giving50% of growth inhibition).
                                                                              The inducible antifungal peptide of Drosophila is a small
                                                                           sized, slightly cationic molecule (calculated PI = 7.81, which is
removed and replaced with fresh medium. Forty-eight hours                                                                     action
                                                                           particularly resistant to heat treatment, to the of various
later the cultureswere examined spectrometrically and micro-               proteases, and to pH variations. It has        four intramolecular
scopically. No growth recovery had occurred after replacement              disulfide bridges, and we may assume that it adopts a very
                           Peptide                Drosophila
                                         Antifungal                                                                                               33163
                                                                     most of the fungi tested, theIC,, values were in thelow micro-
                                                                     molar ranges and even below (0.6 p ~ in thecase of N. crassa.
                                                                                                                             )
                                                                     Experiments with the highly sensitive N. crassa point to a
   FIG.8. Sequencecomparison of the "residue antifungal fungicidal activity.
peptide from Drosophila with an antifungal peptide       (Rs-AFP2)      In conclusion, we show that Drosophila larvae and adults
isolate from the seeds of R. satiuus. Identical amino acids and con-
servative replacements are boxed. Bars indicate gaps to optimize se- can be induced by a septic injury, such as pricking with a
quence alignments.                                                   bacteria-soaked needle,t o produce remarkably high amounts of
                                                                     a potent antifungal peptide. Thestructuraland                           functional
compact tridimensional arrangement. Of major interest is the characteristics indicate that this peptide is a homologue of a
fact that the Drosophila peptide has a significant sequence          family of antifungal peptides recently isolated                 from the seeds of
homology with plant antifungal    peptides recently isolatedfrom Brassicaceae,where theyparticipate t o theplant defense
seeds of Brassicaceae which play a role in plant defense (6). against microorganisms. To our knowledge, this is the first
Indeed, apart from the already well known plant antifungal           report showing that insects and plants can rely on similar
proteins (chitinases, glucanases, thionins, chitin-binding lec- molecules in their             host defense. We proposed the name droso-       of
tins, ribosome-inactivating  proteins)     (12-14) anincreasing      mycin for this new antifungal peptide from Drosophila.
number of new plant proteins capable of inhibiting fungal
growth in vitro is emerging (see Refs. 6, 15, and 16).In par-                                           REFERENCES
ticular, several 5-kDa cationic antifungal peptides which con-        1. Hoffmann,J. A,, Hetru, C., and Reiehhart, J-M.(1993) FEBS Lett. 3 2 5 , 6 3 4 6
tain disulfide bridges were isolated     from seeds (AFPs, anti-      2. Cocianeich, S., Bulet, P., Hetru, C., and Hoffmann, J . A. (1994a) Parasitol.
                                                                           Today 10, 132-139
fungal peptides). Fig. 8 compares the peptide sequence of the         3. Hultmark, D. (1993) Dends Genet. 9, 178-183
Drosophila antifungal peptide with Rs-AFP2 (from seeds of             4. Bulet, P., Dimarcq, J.-L., Hetm, C., Laguew, M., Charlet, M., Hegy, G., Van
radish Raphanus satiuus) (17). Both peptideshave 8 cysteines               Dorsselaer, A., and H o h a n n , J. A. (1993) J. Biol. Chem. 268,14893-14897
                                                                      5. Dimareq, J.-L., Hoffmann, D., Meister, M., Bulet, P., Lanot, R., Reichhart,
which are engaged in intramoleculardisulfide bridges. One of               J.-M., and Hoffmann, J.A. (1994) Eul: J. Biochem. 221,201-209
these cysteines is positioned C-terminally inboth molecules.          6. Terras, F. R. G., Torrekens, S., Van Leuven, F., Osborn, R. W., Vanderleyden, J.,
                                                                           Cammue, B. P. A,, and Broekaert, W. F. (1993) FEBS Lett. 316,233-240
   Allowing for several minor gaps in both sequences, is it ap-       7. Broekaert, W. F., Terras, F. R. G., Cammue, B. P. A,, and Vanderleyden, J.
parent that the eightcysteines are arranged in a similar pat-              (1990) FEMS Microbiol. Lett. 69, 5 5 4 0
tern. The  overall homology between the Drosophila peptide and        8. Kreil G., (1990) l k n d s Biochem. Sci. 15,23-25
                                                                      9. Wicker, C., Reichhart, J.-M.,  Hoffmann, D., Hultmark, D., Samakovlis, C., and
Rs-AFP2 is 38%, takinginto accountconservative replace-                    H o h a n n , J. A. (1990)J. B i d . Chem. 265,22493-22498
ments. It will be of great interest t o work out the tridimen- 10. Boman, H. G., Faye, I., Gudmundsson, G. H., Lee, J. Y.,and Lidholm, D. A.
sional structure of the Drosophila peptide and compare it t o the 11. Ijima, R., E m J. Biochem.Natori, S. (1993) J. Biol. Chem. 268, 12055-12061
                                                                           (1991)
                                                                                    Kurata, S., and
                                                                                                       201,23-31
structure of the plant antifungal peptides in the future. It is 12. Roberts, W. K., and Selitrennikoff, C. P. (1986) Biochim. Biophys. Acta 880,
also interesting tonote that theproduction of Rs-AFP2 and its              161-170
                                                                     13. Bowles, D. J. (1990) Annn. Reu. Biochem. 59,873-907
                      is                             also
homologue in radish not restricted to seeds but occurs in 14. Raikhel, N.V., Lee, H. I., and Broekaert,W. F. (1993)Annu. Reu. Plant Physiol.
leaves after challenge with fungal pathogens.'                             Plant Mol. Biol. 44, 5 9 1 4 1 5
                                                                                            Marien, W., Terras, F. R. G . ,De                      P., Van
   As is the case for Rs-AF'P2, the Drosophila peptide is active 15. Broekaert, W. E ,Dillen, L., Claeys, M., Rees, SBolle, M. F. C., Proost,J.,and
                                                                           Damme, J.,                                         . B., Vanderleyden,
against a relatively broad spectrum of filamentous fungi. It               Cammue, B. P. A. (1992) Biochemistry 31,43084314
inhibits spore germination at high concentrations and, at lower 16. Cammue, B. P. A,, De Bolle, M. F. C., Terras, F. R. G., Proost, P., Van Damme,
                                                                           J., Rees, S. B., Vanderleyden, J., and Broekaert, W. F. (1992) J. Biol. Chem.
concentrations, delays growth of hyphae which subsequently                 267,2228-2233
exhibit abnormal morphology. The IC,, values indicate an ex- 17. Terras, F. R. G . , Schoofs, H. M. E., De Bolle, M. F. C., Van Leuven, F., Rees, S .
                                                                           B., Vanderleyden, J., Cammue, B. P. A,, and Broekaert, W. F. (1992) J. Biol.
ceptionally high potency of the Drosophila peptide. Indeed, for            Chem. 267, 15301-15309
                                                                              18. Thomas, P. (1980)Proc. Natl. Acad. Sci. U.S. A. 77,5201-5205
    F. R. G . Terras and W. F. Broekaert, unpublished results.                19. Tautz, D., and Pfeifle, C. (1989) Chromosoma (Berl.)98, 80-85

						
Related docs
Other docs by liaoqinmei
WSSB Learning to Self Medicate
Views: 0  |  Downloads: 0
Out of School Club
Views: 0  |  Downloads: 0
Statements
Views: 146  |  Downloads: 0
the survey presentation
Views: 0  |  Downloads: 0
Individual Differences
Views: 77  |  Downloads: 0