PowerPoint Presentation - UCLA IPAM

Document Sample
PowerPoint Presentation - UCLA IPAM Powered By Docstoc
					Cell signaling, endothelial migration, and zebrafish: a simplified
                     model for angiogenesis

         Khalid Boushaba, Jeffrey Essner, and Howard Levine
                       Iowa State University

  I.       Utility and use of zebrafish as model for understanding
           angiogenesis.

  II.      VEGF signaling in zebrafish during angiogenesis.

  III.     Mathematical modeling of angiogenesis
Cell signaling, endothelial migration, and zebrafish: a simplified
                     model for angiogenesis
     Zebrafish as a High-throughput Model for Angiogenesis
            Research and Therapeutic Development
                           Large number of offspring
                           Optically clear embryos
                           Short generation time        Reverse Genetics:
Forward Genetics:          Small Size                   Transgenic fish
ENU mutagenesis
                                                        Tilling with ENU
Insertional mutagenesis
                                                        Morpholino injection




                                                       Genomics:
Small Molecule                                         Sequenced Genome
Screens:                                               cDNA projects
Predictive of higher       Carcinogenesis:
                                                       Microarrays
vertebrates                Aqueous delivery
Delivery by injection or   Similar to human tumors
soaking
              Zebrafish embryos are optically clear
                      and develop rapidly




                                          QuickTime™ an d a
                                     Photo - JPEG decompressor
                                    are need ed to see this p icture .




From Karlstrom and Kane, 1996
Model of Tumor Angiogenesis




                        From Yancopoulos et al., 2000


                  Novel
                Angiogenic
                 Factors       Candidate
                               Anti-Tumor
                                Agents
Advantages of Studying Angiogenesis in Zebrafish
 Angiogenesis is a conserved vertebrate-specific function

 Analysis in living embryos




                            QuickTime™ an d a
                           H.264 de compressor
                      are need ed to see this p icture .




                        2.7 dpf
Transgenic zebrafish allow analysis of endothelial cells in living embryos




                   fli1-egfp transgenic embryo at 2 dpf

Dorsal Longitudinal Anastomotic Vessel
                                       Intersegmental Vessels
               (DLAV)
                                                (Se)




                                           Posterior Cardinal Vein
                                   Dorsal Aorta    (PCV)             Caudal Vein
                                      (DA)                           Capillary Plexus
Advantages of Studying Angiogenesis in Zebrafish


  Microangiography: analysis of blood flow in living
  embryos
The intersegmental vessels form by sprouting angiogenesis




         QuickTime™ an d a
    Photo - JPEG decompressor
   are need ed to see this p icture .
ve-cadherin expression identifies primitive endothelial
        cells in the early zebrafish embryo
Primary angiogenesis in the trunk and tail are apparent at 24 hpf


ve-cadherin in situ hybridization
Each intersomitic vessel is composed of three endothelial cells




             fli1-egfp transgenic embryo at 2 dpf
fli1/gfp embryos allow the behavior of individual cells to be followed
during primary angiogenesis




                  QuickTime™ and a
               Cinepak decompressor
           are neede d to see this picture.

                                                          QuickTime™ and a
                                                        Cinepak decompressor
                                                    are need ed to see this picture.




                       Movies from Brant Weinstein’s lab at the NIH
Discovery Genomics, Inc.   University of Minnesota
Karl J. Clark              Eleanor Chen
Jon Larson                 Stephen C. Ekker
Aidas Nasevicius
Shannon Wadman             Max-Planck Institute -
Perry B. Hackett           Freiburg
Iowa State University      Matthias Hammerschmidt
Hsin-Kai Liao              Angiogenetics, AB
Ying Wang
Danhua Zhang               Mats Hellstrom
Katie Lutz
    Mechanism of Morpholino Phosphoramidate Inhibition

        O    O        BASEn                             Antisense oligonucleotides
                      N
                          CH3                           Designed as 25 mers
             N            CH3
                  P                                     Bind tightly
              O       O         O       BASEn+1
                                                        Resistant to digestion
                                          CH3           Low toxicity
                                        N CH3
                                N
                                    P                   Not RNAseH mediated
                                O




Inhibition of Translation

                                                  Encoded Protein
                                                                    60S
                          60S   60S                                    40S
      40S                       40S
                          AUGACCGGUAUUAGUCCGGACCUAG•••••••AAAAA


                 40S
                    MPO
       40S                AUGACCGGUAUUAGUCCGGACCUAG•••••••AAAAA
                     Microinjection : An Efficient Morpholio
                                Delivery System

                          Injection
                             Site



                                      1.5 hrs      4 hrs

     0 hr
    Easy to perform:
  can inject thousands
   of embryos per day
   Nasevicius and                     28 hrs
Ekker (2000, 2001)
     Microarray Pre-selection vs. Random Selection


Random Screens      Selected    Random ENU Mutagenesis
                   Candidates   screens:
                     0.5%       Genes are mutated randomly with a
                                chemical mutagen in a forward genetic
                                screen (Habeck et al., 2002).
                                Subsequent gene identification is difficult.

                                0.5% of genes (approximately
                                1/200) are estimated to affect
                                angiogenesis.
                    Selected
DGI/AG Screen      Candidates   Discovery Genomics, Inc.
                     16%        /AngioGenetics AB Pilot Screen:
                                Targets were pre-selected based
                                on microarray data.
                                16% of genes (8/50) were identified
                                as angiogenesis candidates.
erm1 may associate with Syndecan-2 during vascular
      formation to transmit VEGF-signaling


          Syndecan-2      VEGF/VEGFR1&2



                                ?




                ?

              erm1
                            ?

                F-actin
Hypothesis I: endothelial migration is dependent on the concentration of VEGF


                      Migration




                                     VEGF




                                    VEGFR2 (flk1)
The embryonic midline influences vasculogenesis and
     angiogenesis by inducing VEGF expression




        Lawson et al., 2001
VEGF is required for the correct number of endothelial cells

                  ve-cadherin expression
Vasculogenesis is dependent on VEGF in zebrafish embryos


    Wt                                            VEGF MO




           QuickTime™ an d a
          H.264 de compressor
     are need ed to see this p icture .




                                          3 dpf
   VEGF-A is required for vasculogenesis in zebrafish




                                            Nasevicius et al., 2000

Microangiography allows high resolution mapping of mature vessels.
Migration of the intersegmental vessels is severely affected in VEGF-A
knockdown embryos at 2 dpf



              Wt                              VEGF-A
Endothelial migration is dependent on the concentration of VEGF

                 Wt                         VEGF MO

         Migration
                     VEGF                      VEGF




                            VEGFR2 (flk1)             VEGFR2 (flk1)
Formation of the intersegmental vessels by sprouting
           angiogenesis requires VEGF

         Zebrafish ve-cadherin expression at 48 hpf
Gradients can be set up and interpreted in many different ways




                                           Planar transcytosis

                                           Argosomes

                                           Cytonemes

                                           Restricted diffusion
             Endothelial migration is dependent on the concentration of VEGF

        Wt                             VEGF MO                  VEGF MO + hVEGF

Migration                                                       Migration
            VEGF                       VEGF                                 VEGF




                   VEGFR2 (flk1)                VEGFR2 (flk1)                      VEGFR2 (flk1)
      VEGF signaling is conserved during zebrafish
                vascular development
VEGF and VEGFR2/flk1




                         In zebrafish there are two flk1
                         genes: flk1a and flk1b.

                         Simultaneous knockdown of both
                         flk1a and flk1b resembles VEGF-A
                         knockdown embryos.
             Endothelial migration is dependent on the concentration
                             of VEGF and VEGFR2

       wt                                       flk1a and flk1b MO
Migration
            VEGF                                     VEGF




                   VEGFR2 (flk1)                            VEGFR2 (flk1)
Syndecan-2, a heparan sulfate-containing proteoglycan, is
   essential for angiogenic sprouting of blood vessels




         WT fli-1                 Syn2 MO, fli-1

                                                   Chen et al., 2004


              Syndecan-2      VEGF/VEGFR1&2


                              ?
    Vascular Endothelial Growth Factor A (VEGF-A)

VEGF 121

VEGF 145

VEGF 165

VEGF 183

VEGF 189


VEGF 206




                                    Heparan Sulfate Binding Region


                                           Robinson & Stringer, 2001
             Endothelial migration is dependent on the concentration
                      of VEGF, VEGFR2, and Syndecan-2

Migration
            VEGF    Syndecan2                    VEGF
                    presenting cells




                   VEGFR2 (flk1)                        VEGFR2 (flk1)
Syndecan-2 may function in multiple ways
                                                       Syndecan-2

A Cell-autonomous            B Cell-autonomous
  Presentation model          Complex model




                                                       Phosphoserine




C Cell-nonautonomous, inside-outside signaling model




                                                       Growth Factor
                                                       and Receptor
             Endothelial migration is dependent on the concentration of VEGF

        wt                             VEGF +Syn2 MO         VEGF MO + hVEGF

Migration                                                          Migration
            VEGF    Syndecan2               VEGF                               VEGF
                    presenting cells




                   VEGFR2 (flk1)                   VEGFR2 (flk1)                      VEGFR2 (flk1)
A Ectodomain
                               HS Chains



           Ezrin         Phosphorylation sites
                         Serines and Tyrosines
                     Synectin

          F-actin

B C-terminal cytoplasmic domains
          C1                   V  C2
  YRMRKKDEGSY DLGERKPSSAAYQKAPTK EFYA

                    EphB2   PKCg
  Ezrin                                    Synbindin
                                           Synectin
                                           Syntenin
                                           CASK
    Endothelial migration is dependent on the concentration of VEGF and VEGF requires Syndecan2
    for signaling


Migration
            VEGF    Syndecan2
                    presenting cells




                   VEGFR2 (flk1)
Mass action law
Biochemical equations
Role of cell cycle and cell movement equations
Cell movement
Full model equations

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:0
posted:12/1/2011
language:English
pages:44