MULTIPLE CHOICE

Document Sample
MULTIPLE CHOICE Powered By Docstoc
					BioSc 231                       General Genetics                Exam 5               Name __________________________________

Multiple Choice. (3 points each)

1) ______ A population is reproductively isolated. Which of the following is primarily responsible for the introduction of new alleles
at genetic loci into the population?

    A.   Independent assortment during meiosis
    B.   Germ line mutations
    C.   Assortive mating
    D.   Inbreeding
    E.   Somatic cell mutations

2) ______ Which of the following is primarily responsible for the frequency with which an allele is present in the population?

    A.   The DNA sequence near the allele
    B.   Germ line mutations
    C.   Natural selection
    D.   Its starting frequency
    E.   Whether or not it is in genic or nongenic DNA

3) ______ Mutations:

    A.   Happen more frequently if they confer a selective advantage
    B.   Are, by definition, heritable changes in DNA in germ line cells only
    C.   Are always neutral or a detriment to reproductive fitness
    D.   Are best discussed in terms of heritable changes to the DNA of cells or organisms
    E.   Are best discussed in terms of allele frequencies in a population

4) ______ A given allele that results in a disease state in humans may nevertheless be propagated in the population because:

    A.   The disease has a late onset, typically after affected individuals have already reproduced.
    B.   An individual heterozygous for the disease allele and a wild-type allele has a reproductively selective advantage.
    C.   It impairs reproductive fitness but not individual fitness.
    D.   A and b
    E.   All of the above

5) ______ Four percent of mice had a recessive disorder. What percentage of the population are homozygous dominant?

    A.   16%
    B.   32%
    C.   64%
    D.   80%

6) ______ You wish to probe a human cDNA library to find out which insert has the β-globin gene. Which of the following would be
a good choice as your probe (assume in all cases your probe is labeled)?

    A.   A 30 nucleotide oligo corresponding to intron 1
    B.   A 30 nucleotide oligo corresponding to exon 1
    C.   A 30 nucleotide oligo corresponding to a β-globin gene enhancer
    D.   All of the above
    E.   None of the above

7) ______ Which of the following DNA duplexes is most stable?

    A. 5’ AATTAATTAATTAATTAATT               3’
       3’ TTAATTAATTAATTAATTAA               5’
    B. 5’ GGCCGGCCGGCCGGCCGGCC               3’
       3’ CCGGCCGGCCGGCCGGCCGG               5’
    C. 5’ GGCCGGCCGGCCGGCCGGCC               3’
       3’ CCGGCCGGAAGGCCGGCCGG               5’
    D. All are equally stable.
8) ______ A single nucleotide polymorphism is:

    A.   Always found in genic DNA that is noncoding
    B.   Variable in length, depending on the polymorphism
    C.   Detectable by DNA sequencing only
    D.   A point mutation
    E.   Most often caused by “slippage” during replication

9) ______ You have a 3 kb piece of DNA corresponding to a portion of the human dystrophin gene. You also have a 3 kb plasmid
vector (for cloning in E. coli). Which of the following is likely common to both of these DNA fragments?

    A.   Restriction enzyme sites
    B.   A polylinker
    C.   A selectable marker
    D.   An origin of replication
    E.   None of the above

10) ______ A population is reproductively isolated. Which of the following is primarily responsible for the introduction of new
alleles at genetic loci into the population?

    A.   Independent assortment during meiosis
    B.   Germ line mutations
    C.   Assortive mating
    D.   Inbreeding
    E.   Somatic cell mutations

11) _____ The total collection of genes in a population is called the ____.

    A.   gene pool
    B.   gene library
    C.   equilibrium
    D.   cDNA

12) ______ Why is it necessary to have a selectable marker on a plasmid vector when transforming a host cell such as E. coli?

    A.   Only plasmids containing a selectable marker can be taken up by an E. coli cell.
    B.   The selectable marker is necessary to circularize the plasmid, and without that, no transformation occurs.
    C.   Transformation is so efficient that without a selectable marker, each E. coli cell would take up several plasmids.
    D.   Transformation is so inefficient that the majority of E. coli cells will not have taken up the plasmid.
    E.   None of the above

13) ______ In order to “read” the 5’ to 3’ sequence of a segment of DNA after analyzing the products of a Sanger DNA sequencing
reaction by polyacrylamide gel electrophoresis, you should:

    A.   Read the fragments on the gel from top to bottom, in order of increasing size.
    B.   Read the fragments on the gel from bottom to top, in order of increasing size.
    C.   Read each lane individually from top to bottom and pool the results.
    D.   All of the above are legitimate approaches.
    E.   None of the above

14) _____ Enzyme that cleaves DNA at sequence-specific sites is called

    A.   DNA polymerase
    B.   ligase
    C.   restriction endonuclease
    D.   sticky ends
    E.   cDNA
15) _____ DNA termini with overhangs produced by endonuclease digestion are called

    A.   sticky ends
    B.   blunt ends
    C.   oligonucleotides
    D.   none of the above

16) _____Which enzyme functions to polymerize DNA from an RNA template?

    A.   DNA polymerase
    B.   RNA polymerase
    C.   Reverse transcriptase
    D.   Ligase
    E.   Endonuclease

17) _____ Differing sizes of restriction fragments produced from the alleles of a gene constitute

    A.   a southern blot
    B.   an allozyme
    C.   identification of a gene
    D.   a restriction fragment length polymorphism

18) _____Which of the following is NOT a typical component of a polymerase chain reaction (PCR) reaction

    A.   Primer
    B.   Ligase
    C.   Template
    D.   Taq DNA polymerase
    E.   Buffer

19) _____Plasmids used in vitro to clone foreign DNA fragments are called

    A.   Transgenic
    B.   cDNA
    C.   Clones
    D.   Vectors
    E.   Conjugants

20) _____ A restriction fragment containing a specific gene of interest can be identified by gel electrophoresis followed by
transferring the DNA to a membrane as a solid support matrix using a procedure called

    A.   a Southern blot
    B.   an allozyme
    C.   identification of a gene
    D.   a restriction fragment length polymorphism

21) _____ cDNA is

    A.   chromosomal DNA which has been isolated from a donor organism.
    B.   complementary DNA that is generated by using reverse transcriptase to make DNA from mRNA.
    C.   cloned DNA that has been introduced into a cloning vector.
    D.   cut DNA that has been digested with a restriction endonuclease for use in a cloning experiment.

22) _____ The truth is that everyone has at least a handful of "problem" genes. Which of the following factors would result in your
genes never causing you trouble

    A.   if you only have some, but not all, of the genes that come into play to cause a particular disease.
    B.   if your genes for disorders don't express themselves strongly
    C.   if our genes for disorders are recessive and you inherit only one copy
    D.   all of the above
    E.   none of the above
Short Answer (variable points)

 (2 pts) The restriction endonuclease HindIII (which cuts at the sequence AAGCTT) cuts the genome of the bacteriophage lambda
(approximately 50 kilobases in size) into 7 fragments. The enzyme RsaI (which cuts at the sequence GTAC) cuts the lambda genome
into 113 fragments. Explain the reason for the difference in the number of cleavage sites for these two enxymes.




(2 pts) List two conditions that need to be met for Hardy Weinberg equilibrium to be accurate.




(2 pts) What is the purpose of using dideoxynucleotides in sequencing?




(2 pt) Oligonucleotide probes used in hybridization experiments such as Southern blots or for screening gene libraries are typically at
least 20 nucleotides in length. Briefly explain the reason why they need to be so long.




(2 points) Briefly explain why different populations have different frequencies of alleles. For example, 91% of the MN blood type
alleles in Eskimos are M and 9% are N whereas in Germans it is 55% M and 45% n




(2 points) Endangered species are at risk not only because of their low populations but also due to limited heterozygocity. What
impact does low levels of heterozygocity have on a population?




(6 poitns) Albert is married to Annabelle, who was previously married to Angus, now deceased. Angus and Annabelle conceived one
child together and adopted one child. Albert and Annabelle have also conceived one child. Identify which fingerprint in each lane (in
lanes 5, 6, and 7) correspond to each child.




Albert and Annabelle’s conceived child. Child ____

Angus and Annabelle’s conceived child. Child ____

Angus and Annabelle’s adopted child.      Child ____
 (4 points) You want to design a 21 nucleotide long oligonucleotide probe to identify a clone containing a new enzyme that you
purified. You determine that the amino acid sequence of part of your enzyme is:

WHATISLIFE

What should be the sequence of the oligonucleotide probe? Indicate redundancy by putting all possible nucleotides for a particular
position above or below the location of the redundancy.

i.e GCU
      C
      A
      G
(5 points) To the right is a hypothetical autoradiogram of a dideoxy sequencing gel. What is the sequence of the gene fragment? Be
sure to label the 5' and 3' ends.
(5 points) Briefly comment on either of the following scenarios.

A. Do people have the right to choose not to know about their genes? Do mothers have the right to choose not to have their fetuses
tested?

B. Once it becomes possible to test quickly and reliably for thousands of genetic conditions, will physicians be expected to perform
such tests? Will the physician be liable for failing to test or for failing to inform parents of every detail of the test results?
(4 points) Select one of the following potential applications of genetic engineering and briefly discuss the pros and cons of genetic
engineering these properties.

Improved forms of crops.
Super-sized and super-fast-growing animals.
Livestock that produce more young.
More healthful foods.
Vegetables that stay ripe longer.
Plants and farm animals that can survive under harsh conditions.
Bacteria that eat up oil spills and toxic wastes.
Animals that can serve as organ donors for humans.




Bonus Questions (5 points)

When you go home for winter break, someone in your family is bound to ask you what you learned in school this semester. Describe
something you learned in this class that you think would be worthy of using as a response to this question.

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:20
posted:11/29/2011
language:English
pages:8