Docstoc

GS0007005-OMA CpG list - SNP Center

Document Sample
GS0007005-OMA CpG list - SNP Center Powered By Docstoc
					Probe_ID    Gid         Accession Symbol                   RefSeq
                                          Gene_ID Chromosome                     Dist_to_TSS
                                                                       CpG_Coordinate
AATK_E63_R 89041906               AATK
                        XM_927215.1           9625      17      36.1   76709831          63
AATK_P519_R 89041906              AATK
                        XM_927215.1           9625      17      36.1   76710413        -519
AATK_P709_R 89041906              AATK
                        XM_927215.1           9625      17      36.1   76710603        -709
ABCA1_E120_R 21536375             ABCA1
                        NM_005502.2             19       9      36.1    1.07E+08        120
ABCA1_P45_F 21536375              ABCA1
                        NM_005502.2             19       9      36.1    1.07E+08        -45
ABCB4_E429_F 9961251              ABCB4
                        NM_018850.1           5244       7      36.1   86947255         429
ABCB4_P51_F 9961251               ABCB4
                        NM_018850.1           5244       7      36.1   86947735         -51
ABCB4_P892_F 9961251              ABCB4
                        NM_018850.1           5244       7      36.1   86948576        -892
ABCC2_E16_R 4557480               ABCC2
                        NM_000392.1           1244      10      36.1    1.02E+08         16
ABCC2_P88_F 4557480               ABCC2
                        NM_000392.1           1244      10      36.1    1.02E+08        -88
ABCC5_P444_F 66529004             ABCC5
                        NM_005688.2          10057       3      36.1    1.85E+08       -444
ABCG2_P178_R62526032              ABCG2
                        NM_004827.2           9429       4      36.1   89299213        -178
ABCG2_P310_R62526032              ABCG2
                        NM_004827.2           9429       4      36.1   89299345        -310
ABL1_P53_F   62362413             ABL1
                        NM_005157.3             25       9      36.1    1.33E+08        -53
ABL2_P459_R   6382061             ABL2
                        NM_007314.1             27       1      36.1    1.77E+08       -459
ABO_E110_F 58331215               ABO
                        NM_020469.2             28       9      36.1    1.35E+08        110
ABO_P312_F 58331215               ABO
                        NM_020469.2             28       9      36.1    1.35E+08       -312
ACTG2_E98_R 63054873              ACTG2
                        NM_001615.3             72       2      36.1   73973699          98
ACTG2_P346_F 63054873             ACTG2
                        NM_001615.3             72       2      36.1   73973255        -346
ACTG2_P455_R 63054873             ACTG2
                        NM_001615.3             72       2      36.1   73973146        -455
ACVR1_E328_R 10862690             ACVR1
                        NM_001105.2             90       2      36.1    1.58E+08        328
ACVR1_P983_F 10862690             ACVR1
                        NM_001105.2             90       2      36.1    1.58E+08       -983
ACVR1B_E497_R33598913             ACVR1B
                        NM_004302.3             91      12      36.1   50632250         497
ACVR1B_P572_R33598913             ACVR1B
                        NM_004302.3             91      12      36.1   50631181        -572
ACVR1C_P115_R21687097             ACVR1C
                        NM_145259.1         130399       2      36.1    1.58E+08       -115
ACVR1C_P363_F21687097             ACVR1C
                        NM_145259.1         130399       2      36.1    1.58E+08       -363
ACVR2B_E27_R10862697              ACVR2B
                        NM_001106.2             93       3      36.1   38470841          27
ACVR2B_P676_F10862697             ACVR2B
                        NM_001106.2             93       3      36.1   38470138        -676
             51558723
ADAMTS12_E52_R                    ADAMTS12
                        NM_030955.2          81792       5      36.1   33927829          52
             51558723
ADAMTS12_P250_R                   ADAMTS12
                        NM_030955.2          81792       5      36.1   33928131        -250
             10947062
ADCYAP1_E163_R                    ADCYAP1
                        NM_001117.2            116      18      36.1      895550        163
             10947062
ADCYAP1_P398_F                    ADCYAP1
                        NM_001117.2            116      18      36.1      894989       -398
             10947062
ADCYAP1_P455_R                    ADCYAP1
                        NM_001117.2            116      18      36.1      894932       -455
AFF3_P122_F 68348715              AFF3
                        NM_001025108.1        3899       2      36.1       1E+08       -122
AFF3_P808_F 68348715              AFF3
                        NM_001025108.1        3899       2      36.1       1E+08       -808
AFP_P824_F    4501988             AFP
                        NM_001134.1            174       4      36.1   74519973        -824
AGTR1_P154_F 14043060             AGTR1
                        NM_000685.3            185       3      36.1     1.5E+08       -154
AGTR1_P41_F 14043060              AGTR1
                        NM_000685.3            185       3      36.1     1.5E+08        -41
AGXT_E115_R 4557288               AGXT
                        NM_000030.1            189       2      36.1    2.41E+08        115
AGXT_P180_F 4557288               AGXT
                        NM_000030.1            189       2      36.1    2.41E+08       -180
AHR_E103_F    5016091             AHR
                        NM_001621.2            196       7      36.1   17304874         103
AHR_P166_R    5016091             AHR
                        NM_001621.2            196       7      36.1   17304605        -166
AIM2_E208_F   4757733             AIM2
                        NM_004833.1           9447       1      36.1    1.57E+08        208
AIM2_P624_F   4757733             AIM2
                        NM_004833.1           9447       1      36.1    1.57E+08       -624
AKT1_P310_R 62241014              AKT1
                        NM_001014432.1         207      14      36.1    1.04E+08       -310
ALK_E183_R   29029631             ALK
                        NM_004304.3            238       2      36.1   29997753         183
ALK_P28_F    29029631             ALK
                        NM_004304.3            238       2      36.1   29997964         -28
ALOX12_E85_R 4502050              ALOX12
                        NM_000697.1            239      17      36.1     6840213         85
ALOX12_P223_R 4502050             ALOX12
                        NM_000697.1            239      17      36.1     6839905       -223
ALPL_P278_F 13787192              ALPL
                        NM_000478.2            249       1      36.1   21708178        -278
ALPL_P433_F 13787192              ALPL
                        NM_000478.2            249       1      36.1   21708023        -433
AOC3_P890_R 6806883             AOC3
                        NM_003734.2        8639       17   36.1   38255837      -890
APBA1_E99_R 22035547            APBA1
                        NM_001163.2         320        9   36.1   71476943        99
APBA1_P644_F 22035547           APBA1
                        NM_001163.2         320        9   36.1   71477686      -644
APBA2_P227_F 22035549           APBA2
                        NM_005503.2         321       15   36.1   27000918      -227
APBA2_P305_R 22035549           APBA2
                        NM_005503.2         321       15   36.1   27000840      -305
APC_E117_R 53759121             APC
                        NM_000038.3         324        5   36.1   1.12E+08       117
APC_P14_F    53759121           APC
                        NM_000038.3         324        5   36.1   1.12E+08       -14
APC_P280_R 53759121             APC
                        NM_000038.3         324        5   36.1   1.12E+08      -280
APOA1_P261_F 4557320            APOA1
                        NM_000039.1         335       11   36.1   1.16E+08      -261
APOA1_P75_F 4557320             APOA1
                        NM_000039.1         335       11   36.1   1.16E+08       -75
APOC1_P406_R51944963            APOC1
                        NM_001645.3         341       19   36.1   50109355      -406
APOC2_P377_F 32130517           APOC2
                        NM_000483.3         344       19   36.1   50140706      -377
APP_E8_F     41406054           APP
                        NM_201413.1         351       21   36.1   26464995         8
APP_P179_R 41406054             APP
                        NM_201413.1         351       21   36.1   26465182      -179
AR_P189_R    58535454           AR
                        NM_001011645.1      367   X        36.1   66680410      -189
AR_P54_R     58535454           AR
                        NM_001011645.1      367   X        36.1   66680545       -54
ARAF_E38_F    4502192           ARAF
                        NM_001654.1         369   X        36.1   47305489        38
ARAF_P63_R    4502192           ARAF
                        NM_001654.1         369   X        36.1   47305388       -63
AREG_E25_F 22035683             AREG
                        NM_001657.2         374        4   36.1   75529742        25
AREG_P217_R 22035683            AREG
                        NM_001657.2         374        4   36.1   75529500      -217
             14210509
ARHGAP9_P260_F                  ARHGAP9
                        NM_032496.1       64333       12   36.1   56169124      -260
             14210509
ARHGAP9_P518_R                  ARHGAP9
                        NM_032496.1       64333       12   36.1   56169382      -518
             56676392
ARHGDIB_P148_R                  ARHGDIB
                        NM_001175.4         397       12   36.1   15005977      -148
ARNT_P238_R 30795239            ARNT
                        NM_178426.1         405        1   36.1   1.49E+08      -238
ASB4_E89_F    7706378           ASB4
                        NM_016116.1       51666        7   36.1   94953309        89
ASB4_P391_F   7706378           ASB4
                        NM_016116.1       51666        7   36.1   94952829      -391
ASB4_P52_R    7706378           ASB4
                        NM_016116.1       51666        7   36.1   94953168       -52
ASCL1_E24_F 55743093            ASCL1
                        NM_004316.2         429       12   36.1   1.02E+08        24
ASCL1_P747_F 55743093           ASCL1
                        NM_004316.2         429       12   36.1   1.02E+08      -747
ASCL2_E76_R 42716308            ASCL2
                        NM_005170.2         430       11   36.1    2248682        76
ASCL2_P360_F 42716308           ASCL2
                        NM_005170.2         430       11   36.1    2249118      -360
ASCL2_P609_R 42716308           ASCL2
                        NM_005170.2         430       11   36.1    2249367      -609
ATP10A_P147_F21361906           ATP10A
                        NM_024490.2       57194       15   36.1   23660110      -147
ATP10A_P524_R21361906           ATP10A
                        NM_024490.2       57194       15   36.1   23660487      -524
AXIN1_P995_R 31083149           AXIN1
                        NM_003502.2        8312       16   36.1     343460      -995
AXL_E61_F    21536465           AXL
                        NM_021913.2         558       19   36.1   46416724        61
AXL_P223_R   21536465           AXL
                        NM_021913.2         558       19   36.1   46416440      -223
             15451880
B3GALT5_E246_R                  B3GALT5
                        NM_033170.1       10317       21   36.1   39951370       246
             15451880
B3GALT5_P330_F                  B3GALT5
                        NM_033170.1       10317       21   36.1   39950794      -330
BAX_E281_R 34335125             BAX
                        NM_138765.2         581       19   36.1   54150210       281
BCAM_E100_R 61742796            BCAM
                        NM_001013257.1     4059       19   36.1   50004278       100
BCAM_P205_F 61742796            BCAM
                        NM_001013257.1     4059       19   36.1   50003973      -205
             49472837
BCAP31_P1072_F                  BCAP31
                        NM_005745.6       10134   X        36.1   1.53E+08 .
             49472837
BCAP31_P1131_F                  BCAP31
                        NM_005745.6       10134   X        36.1   1.53E+08 .
             14574570
BCL2A1_P1127_R                  BCL2A1
                        NM_004049.2         597       15   36.1   78051825     -1127
BCL2L2_E172_F14574571           BCL2L2
                        NM_004050.2         599       14   36.1   22846038       172
BCL2L2_P280_F14574571           BCL2L2
                        NM_004050.2         599       14   36.1   22845586      -280
BCL3_E71_F   20336471           BCL3
                        NM_005178.2         602       19   36.1   49943942        71
BCL3_P1038_R 20336471           BCL3
                        NM_005178.2         602       19   36.1   49942833     -1038
BCL6_P248_R 21040335            BCL6
                        NM_138931.1         604        3   36.1   1.89E+08      -248
BCR_P346_F 11038640             BCR
                        NM_021574.1         613       22   36.1   21852206      -346
BCR_P422_F 11038640             BCR
                        NM_021574.1         613       22   36.1   21852130      -422
BDNF_E19_R 34106708              BDNF
                         NM_170733.2        627       11   36.1   27699853      19
BDNF_P259_R 34106708             BDNF
                         NM_170733.2        627       11   36.1   27700131    -259
BGN_E282_R 34304351              BGN
                         NM_001711.3        633   X        36.1   1.52E+08     282
BGN_P333_R 34304351              BGN
                         NM_001711.3        633   X        36.1   1.52E+08    -333
BIRC4_P122_R 32528298            BIRC4
                         NM_001167.2        331   X        36.1   1.23E+08    -122
BIRC4_P500_F 32528298            BIRC4
                         NM_001167.2        331   X        36.1   1.23E+08    -500
BIRC5_E89_F 59859877             BIRC5
                         NM_001168.2        332       17   36.1   73721961      89
BLK_P14_F     33469981           BLK
                         NM_001715.2        640        8   36.1   11388916     -14
BLK_P668_R    33469981           BLK
                         NM_001715.2        640        8   36.1   11388262    -668
BMP2_E48_R     4557368           BMP2
                         NM_001200.1        650       20   36.1    6697255      48
BMP2_P1201_F 4557368             BMP2
                         NM_001200.1        650       20   36.1    6696006   -1201
BMP3_E147_F 4557370              BMP3
                         NM_001201.1        651        4   36.1   82171290     147
BMP3_P56_R     4557370           BMP3
                         NM_001201.1        651        4   36.1   82171087     -56
BMP4_P123_R 19528651             BMP4
                         NM_130851.1        652       14   36.1   53493485    -123
BMP4_P199_R 19528651             BMP4
                         NM_130851.1        652       14   36.1   53493561    -199
BMP6_P163_F 4809281              BMP6
                         NM_001718.2        654        6   36.1    7671846    -163
BMP6_P398_F 4809281              BMP6
                         NM_001718.2        654        6   36.1    7671611    -398
BMPR1A_E88_F41349436             BMPR1A
                         NM_004329.2        657       10   36.1   88506464      88
              4
BMPR1A_P956_F1349436             BMPR1A
                         NM_004329.2        657       10   36.1   88505420    -956
BMPR2_E435_F 72376969            BMPR2
                         NM_001204.5        659        2   36.1   2.03E+08     435
BMPR2_P1271_F 72376969           BMPR2
                         NM_001204.5        659        2   36.1   2.03E+08   -1271
BRCA1_P835_R 63252875            BRCA1
                         NM_007298.2        672       17   36.1   38531829    -835
BSG_P211_R 38372918              BSG
                         NM_001728.2        682       19   36.1     522114    -211
BTK_E64_R      4557376           BTK
                         NM_000061.1        695   X        36.1   1.01E+08      64
BTK_P105_F     4557376           BTK
                         NM_000061.1        695   X        36.1   1.01E+08    -105
              3
C20orf47_P225_R8327613           ERGIC3
                         NM_015966.2      51614       20   36.1   33592967    -225
C4B_E171_F    67782350           C4B
                         NM_000592.4        721        6   36.1   32057984     171
C4B_P191_F    67782350           C4B
                         NM_000592.4        721        6   36.1   32057622    -191
CALCA_E174_R 76880483            CALCA
                         NM_001033952.1     796       11   36.1   14950234     174
CALCA_P171_F 76880483            CALCA
                         NM_001033952.1     796       11   36.1   14950579    -171
CALCA_P75_F 76880483             CALCA
                         NM_001033952.1     796       11   36.1   14950483     -75
CAPG_E228_F 63252912             CAPG
                         NM_001747.2        822        2   36.1   85490959     228
CARD15_P302_R 11545911           CARD15
                         NM_022162.1      64127       16   36.1   49288249    -302
CARD15_P665_F 11545911           CARD15
                         NM_022162.1      64127       16   36.1   49287886    -665
CASP10_E139_F 47078266           CASP10
                         NM_001230.3        843        2   36.1   2.02E+08     139
CASP10_P186_F 47078266           CASP10
                         NM_001230.3        843        2   36.1   2.02E+08    -186
CASP10_P334_F 47078266           CASP10
                         NM_001230.3        843        2   36.1   2.02E+08    -334
CASP2_P192_F 39995058            CASP2
                         NM_032982.2        835        7   36.1   1.43E+08    -192
CASP3_P420_R 73622121            CASP3
                         NM_004346.3        836        4   36.1   1.86E+08     147
CASP6_P201_F 73622128            CASP6
                         NM_001226.3        839        4   36.1   1.11E+08    -201
CASP6_P230_R 73622128            CASP6
                         NM_001226.3        839        4   36.1   1.11E+08    -230
CASP8_E474_F 73623018            CASP8
                         NM_001228.3        841        2   36.1   2.02E+08     474
CAV1_P130_R 15451855             CAV1
                         NM_001753.3        857        7   36.1   1.16E+08    -130
CAV1_P169_F 15451855             CAV1
                         NM_001753.3        857        7   36.1   1.16E+08    -169
CAV2_E33_R 38176291              CAV2
                         NM_198212.1        858        7   36.1   1.16E+08      33
CCKAR_E79_F 63054823             CCKAR
                         NM_000730.2        886        4   36.1   26101061      79
CCKAR_P270_F63054823             CCKAR
                         NM_000730.2        886        4   36.1   26101410    -270
CCKBR_P361_R33356159             CCKBR
                         NM_176875.2        887       11   36.1    6237181    -361
CCKBR_P480_F33356159             CCKBR
                         NM_176875.2        887       11   36.1    6237062    -480
CCL3_E53_R     4506842           CCL3
                         NM_002983.1       6348       17   36.1   31441547      53
CCL3_P543_R 4506842              CCL3
                         NM_002983.1       6348       17   36.1   31442143    -543
CCNA1_E7_F 16306528              CCNA1
                         NM_003914.2       8900       13   36.1   35904640       7
CCNA1_P216_F 16306528           CCNA1
                        NM_003914.2      8900   13   36.1   35904417    -216
CCNC_P132_R 61676092            CCNC
                        NM_001013399.1    892    6   36.1      1E+08    -132
CCND1_E280_R16950654            CCND1
                        NM_053056.1       595   11   36.1   69165334     280
CCND1_P343_R16950654            CCND1
                        NM_053056.1       595   11   36.1   69164711    -343
CCND2_P887_F 16950656           CCND2
                        NM_001759.2       894   12   36.1    4252312    -887
CCND2_P898_R16950656            CCND2
                        NM_001759.2       894   12   36.1    4252301    -898
CCND3_P435_F 16950657           CCND3
                        NM_001760.2       896    6   36.1   42017965    -435
CCNE1_P683_F 17318560           CCNE1
                        NM_057182.1       898   19   36.1   34994058    -683
CCR5_P630_R 4502638             CCR5
                        NM_000579.1      1234    3   36.1      58097    -630
CD1A_P414_R 27764864            CD1A
                        NM_001763.1       909    1   36.1   1.56E+08    -414
CD1A_P6_F    27764864           CD1A
                        NM_001763.1       909    1   36.1   1.56E+08      -6
CD2_P68_F    31542293           CD2
                        NM_001767.2       914    1   36.1   1.17E+08     -68
CD34_E20_R 68342037             CD34
                        NM_001025109.1    947    1   36.1   2.06E+08      20
CD34_P339_R 68342037            CD34
                        NM_001025109.1    947    1   36.1   2.06E+08    -339
CD34_P780_R 68342037            CD34
                        NM_001025109.1    947    1   36.1   2.06E+08    -780
CD40_E58_R 23312370             CD40
                        NM_152854.1       958   20   36.1   44180371      58
CD40_P372_R 23312370            CD40
                        NM_152854.1       958   20   36.1   44179941    -372
CD44_E26_F   48255936           CD44
                        NM_001001389.1    960   11   36.1   35117019      26
CD44_P87_F   48255936           CD44
                        NM_001001389.1    960   11   36.1   35116906     -87
CD81_P211_F 62240999            CD81
                        NM_004356.3       975   11   36.1    2354912    -211
CD81_P272_R 62240999            CD81
                        NM_004356.3       975   11   36.1    2354851    -272
CD82_P557_R 67782352            CD82
                        NM_002231.3      3732   11   36.1   44543160    -557
CD86_P3_F    29029570           CD86
                        NM_006889.2       942    3   36.1   1.23E+08      -3
CD9_E14_R    21237762           CD9
                        NM_001769.2       928   12   36.1    6179830      14
CD9_P504_F   21237762           CD9
                        NM_001769.2       928   12   36.1    6179312    -504
CD9_P585_R 21237762             CD9
                        NM_001769.2       928   12   36.1    6179231    -585
CDC25B_E83_F 47078250           CDC25B
                        NM_004358.3       994   20   36.1    3724469      83
CDC25B_P11_R47078250            CDC25B
                        NM_004358.3       994   20   36.1    3724375     -11
CDH1_P45_F 14589887             CDH1
                        NM_004360.2       999   16   36.1   67328651     -45
CDH1_P52_R 14589887             CDH1
                        NM_004360.2       999   16   36.1   67328644     -52
CDH11_E102_R 16306531           CDH11
                        NM_001797.2      1009   16   36.1   63713318     102
CDH11_P203_R 16306531           CDH11
                        NM_001797.2      1009   16   36.1   63713623    -203
CDH11_P354_R 16306531           CDH11
                        NM_001797.2      1009   16   36.1   63713774    -354
CDH13_E102_F 61676095           CDH13
                        NM_001257.3      1012   16   36.1   81218181     102
CDH13_P88_F 61676095            CDH13
                        NM_001257.3      1012   16   36.1   81217991     -88
CDH17_E31_F 16507959            CDH17
                        NM_004063.2      1015    8   36.1   95289955      31
CDH17_P376_F 16507959           CDH17
                        NM_004063.2      1015    8   36.1   95290362    -376
CDH17_P532_F 16507959           CDH17
                        NM_004063.2      1015    8   36.1   95290518    -532
CDH3_E100_R 45269142            CDH3
                        NM_001793.3      1001   16   36.1   67236377     100
CDH3_P87_R 45269142             CDH3
                        NM_001793.3      1001   16   36.1   67236190     -87
CDK10_E74_F 32528264            CDK10
                        NM_052987.2      8558   16   36.1   88280653      74
CDK10_P199_R 32528264           CDK10
                        NM_052987.2      8558   16   36.1   88280380    -199
CDK2_P330_R 16936529            CDK2
                        NM_052827.1      1017   12   36.1   54646496    -330
CDK6_E256_F 45827787            CDK6
                        NM_001259.5      1021    7   36.1   92300892     256
CDK6_P291_R 45827787            CDK6
                        NM_001259.5      1021    7   36.1   92301439   -1465
CDKN1A_E101_F17978496           CDKN1A
                        NM_000389.2      1026    6   36.1   36754566     101
CDKN1A_P242_F17978496           CDKN1A
                        NM_000389.2      1026    6   36.1   36754223    -242
             17978497
CDKN1B_P1161_F                  CDKN1B
                        NM_004064.2      1027   12   36.1   12760415   -1161
CDKN1C_P6_R 4557440             CDKN1C
                        NM_000076.1      1028   11   36.1    2863557      -6
CDKN1C_P626_F4557440            CDKN1C
                        NM_000076.1      1028   11   36.1    2864177    -626
CDKN2A_E121_R47132605           CDKN2A
                        NM_058195.2      1029    9   36.1   21984369     121
CDKN2B_E220_F47132608           CDKN2B
                        NM_004936.3      1030    9   36.1   21999092     220
              47132608
CDKN2B_seq_50_S294_F             CDKN2B
                         NM_004936.3        1030     9    36.1   21999010      302
              49472837
CDM_seq_21_S260_R                BCAP31
                         NM_005745.6       10134 X        36.1   1.53E+08 .
CEACAM1_E57_R 68161539           CEACAM1
                         NM_001712.3         634     19   36.1   47724422        57
CEACAM1_P44_R 68161539           CEACAM1
                         NM_001712.3         634     19   36.1   47724523       -44
CEBPA_P1163_R 28872793           CEBPA
                         NM_004364.2        1050     19   36.1   38486323 .
CEBPA_P706_F 28872793            CEBPA
                         NM_004364.2        1050     19   36.1   38485866       293
CFTR_P115_F 6995995              CFTR
                         NM_000492.2        1080      7   36.1   1.17E+08      -115
CFTR_P372_R 6995995              CFTR
                         NM_000492.2        1080      7   36.1   1.17E+08      -372
CHD2_P451_F 4557448              CHD2
                         NM_001271.1        1106     15   36.1   91243972      -451
CHD2_P667_F 4557448              CHD2
                         NM_001271.1        1106     15   36.1   91243756      -667
CHFR_P501_F 8922674              CHFR
                         NM_018223.1       55743     12   36.1   1.32E+08      -501
CHFR_P635_R 8922674              CHFR
                         NM_018223.1       55743     12   36.1   1.32E+08      -635
CHGA_E52_F 10800418              CHGA
                         NM_001275.2        1113     14   36.1   92459297        52
CHGA_P243_F 10800418             CHGA
                         NM_001275.2        1113     14   36.1   92459002      -243
CHI3L2_E10_F 68533259            CHI3L2
                         NM_001025199.1     1117      1   36.1   1.12E+08        10
CHI3L2_P226_F 68533259           CHI3L2
                         NM_001025199.1     1117      1   36.1   1.12E+08      -226
CLDN4_P1120_R 34335232           CLDN4
                         NM_001305.3        1364      7   36.1   72882009     -1120
CLK1_P538_F 67551260             CLK1
                         NM_004071.2        1195      2   36.1   2.01E+08      -538
COL18A1_P365_R18765745           COL18A1
                         NM_130444.1       80781     21   36.1   45649160      -365
COL18A1_P494_R18765745           COL18A1
                         NM_130444.1       80781     21   36.1   45649031      -494
COL1A1_P117_R 14719826           COL1A1
                         NM_000088.2        1277     17   36.1   45634109      -117
COL1A1_P5_F 14719826             COL1A1
                         NM_000088.2        1277     17   36.1   45633997        -5
COL1A2_E299_F 48762933           COL1A2
                         NM_000089.3        1278      7   36.1   93862108       299
COL1A2_P407_R 48762933           COL1A2
                         NM_000089.3        1278      7   36.1   93861402      -407
COL1A2_P48_R 48762933            COL1A2
                         NM_000089.3        1278      7   36.1   93861761       -48
COL4A3_E205_R 14165449           COL4A3
                         NM_031366.1        1285      2   36.1   2.28E+08       205
COL4A3_P545_F 14165449           COL4A3
                         NM_031366.1        1285      2   36.1   2.28E+08      -545
COL6A1_P283_F 15011912           COL6A1
                         NM_001848.1        1291     21   36.1   46225813      -283
COL6A1_P425_F 15011912           COL6A1
                         NM_001848.1        1291     21   36.1   46225671      -425
COMT_E401_F 6466449              COMT
                         NM_007310.1        1312     22   36.1   18309710      -195
COPG2_P298_F66348036             COPG2
                         NM_012133.2       26958      7   36.1    1.3E+08      -298
CPA4_E20_F    61743915           CPA4
                         NM_016352.2       51200      7   36.1    1.3E+08        20
CPA4_P1265_R 61743915            CPA4
                         NM_016352.2       51200      7   36.1    1.3E+08     -1265
CPA4_P961_R 61743915             CPA4
                         NM_016352.2       51200      7   36.1    1.3E+08      -961
CPNE1_P138_F 23397699            CPNE1
                         NM_152927.1        8904     20   36.1   33716400      -138
CREB1_P819_F 22219460            CREB1
                         NM_134442.2        1385      2   36.1   2.08E+08      -819
CREBBP_P712_R4758055             CREBBP
                         NM_004380.1        1387     16   36.1    3871424      -712
CRIP1_P274_F 39725694            CRIP1
                         NM_001311.3        1396     14   36.1   1.05E+08      -274
CRIP1_P874_R 39725694            CRIP1
                         NM_001311.3        1396     14   36.1   1.05E+08      -874
CRK_P721_F 41327709              CRK
                         NM_005206.3        1398     17   36.1    1307015      -721
CSF1_P217_F 27262662             CSF1
                         NM_172210.1        1435      1   36.1    1.1E+08      -217
CSF1_P339_F 27262662             CSF1
                         NM_172210.1        1435      1   36.1    1.1E+08      -339
CSF1R_E26_F 27262658             CSF1R
                         NM_005211.2        1436      5   36.1   1.49E+08        26
CSF1R_P73_F 27262658             CSF1R
                         NM_005211.2        1436      5   36.1   1.49E+08       -73
CSF2_E248_R 27437029             CSF2
                         NM_000758.2        1437      5   36.1   1.31E+08       248
CSF2_P605_F 27437029             CSF2
                         NM_000758.2        1437      5   36.1   1.31E+08      -605
CSF3_E242_R 27437050             CSF3
                         NM_172220.1        1440     17   36.1   35425456       242
CSF3_P309_R 27437050             CSF3
                         NM_172220.1        1440     17   36.1   35424905      -309
CSF3R_P472_F 27437044            CSF3R
                         NM_172313.1        1441      1   36.1   36721568      -472
CSF3R_P8_F 27437044              CSF3R
                         NM_172313.1        1441      1   36.1   36721104        -8
CSK_P740_R     4758077           CSK
                         NM_004383.1        1445     15   36.1   72861028      -740
CSPG2_E38_F 21361115             CSPG2
                         NM_004385.2        1462      5   36.1   82803377        38
CSPG2_P82_R 21361115            CSPG2
                        NM_004385.2        1462      5   36.1   82803257     -82
CSTB_E410_F 20357564            CSTB
                        NM_000100.2        1476     21   36.1   44020277     410
CTAG1B_P4_R 4503118             CTAG1B
                        NM_001327.1        1485 X        36.1   1.54E+08      -4
CTAG1B_P77_F 4503118            CTAG1B
                        NM_001327.1        1485 X        36.1   1.54E+08     -77
CTAG2_P1426_F50428920           CTAG2
                        NM_172377.2       30848 X        36.1   1.54E+08   -1426
CTGF_E156_F 4503122             CTGF
                        NM_001901.1        1490      6   36.1   1.32E+08     156
CTGF_P693_R 4503122             CTGF
                        NM_001901.1        1490      6   36.1   1.32E+08    -693
CTLA4_E176_R 21361211           CTLA4
                        NM_005214.2        1493      2   36.1   2.04E+08     176
CTLA4_P1128_F21361211           CTLA4
                        NM_005214.2        1493      2   36.1   2.04E+08   -1128
CTNNA1_P185_R55770843           CTNNA1
                        NM_001903.2        1495      5   36.1   1.38E+08    -185
CTNNA1_P382_R55770843           CTNNA1
                        NM_001903.2        1495      5   36.1   1.38E+08    -382
CTNNB1_P757_F88968769           CTNNB1
                        XM_945657.1        1499      3   36.1   41215247    -757
CTSD_P726_F 23110949            CTSD
                        NM_001909.3        1509     11   36.1    1742524    -726
CTSH_E157_R 23110956            CTSH
                        NM_148979.1        1512     15   36.1   77024318     157
CTSH_P238_F 23110956            CTSH
                        NM_148979.1        1512     15   36.1   77024713    -238
CTSL_P264_R 22202617            CTSL
                        NM_001912.2        1514      9   36.1   89530536    -264
CTSL_P81_F   22202617           CTSL
                        NM_001912.2        1514      9   36.1   89530719     -81
CTTN_E29_R 20357551             CTTN
                        NM_005231.2        2017     11   36.1   69922321      29
CXCL9_E268_R 4505186            CXCL9
                        NM_002416.1        4283      4   36.1   77147397     268
CYP1A1_P382_F13325053           CYP1A1
                        NM_000499.2        1543     15   36.1   72805312    -382
CYP1B1_E83_R 13325059           CYP1B1
                        NM_000104.2        1545      2   36.1   38156713      83
CYP1B1_P212_F13325059           CYP1B1
                        NM_000104.2        1545      2   36.1   38157008    -212
CYP2E1_E53_R 75709190           CYP2E1
                        NM_000773.3        1571     10   36.1   1.35E+08      53
CYP2E1_P416_F75709190           CYP2E1
                        NM_000773.3        1571     10   36.1   1.35E+08    -416
DAB2_P35_F    4503250           DAB2
                        NM_001343.1        1601      5   36.1   39460738     -35
DAB2_P468_F   4503250           DAB2
                        NM_001343.1        1601      5   36.1   39461171    -468
DAB2IP_E18_R 20070108           DAB2IP
                        NM_032552.1      153090      9   36.1   1.24E+08      18
DAB2IP_P671_F20070108           DAB2IP
                        NM_032552.1      153090      9   36.1   1.24E+08    -671
DAB2IP_P9_F 20070108            DAB2IP
                        NM_032552.1      153090      9   36.1   1.24E+08      -9
DAPK1_E46_R 4826683             DAPK1
                        NM_004938.1        1612      9   36.1   89302662      46
DAPK1_P10_F 4826683             DAPK1
                        NM_004938.1        1612      9   36.1   89302606     -10
DAPK1_P345_R 4826683            DAPK1
                        NM_004938.1        1612      9   36.1   89302271    -345
DBC1_E204_F 7657008             DBC1
                        NM_014618.1        1620      9   36.1   1.21E+08     204
DBC1_P351_R 7657008             DBC1
                        NM_014618.1        1620      9   36.1   1.21E+08    -351
DCC_E53_R     4885174           DCC
                        NM_005215.1        1630     18   36.1   48121209      53
DCC_P177_F    4885174           DCC
                        NM_005215.1        1630     18   36.1   48120979    -177
DCC_P471_R    4885174           DCC
                        NM_005215.1        1630     18   36.1   48120685    -471
DCN_P1320_R 47419923            DCN
                        NM_133505.2        1634     12   36.1   90102257   -1320
DDB2_P407_F 4557514             DDB2
                        NM_000107.1        1643     11   36.1   47192682    -407
DDB2_P613_R 4557514             DDB2
                        NM_000107.1        1643     11   36.1   47192476    -613
DDIT3_P1313_R50345277           DDIT3
                        NM_004083.4        1649     12   36.1   56201880   -1046
DDR1_E23_R 38327631             DDR1
                        NM_001954.3         780      6   36.1   30959863      23
DDR1_P332_R 38327631            DDR1
                        NM_001954.3         780      6   36.1   30959508    -332
DDR2_E331_F 62420885            DDR2
                        NM_001014796.1     4921      1   36.1   1.61E+08     331
DDR2_P743_R 62420885            DDR2
                        NM_001014796.1     4921      1   36.1   1.61E+08    -743
DES_E228_R 55749931             DES
                        NM_001927.3        1674      2   36.1    2.2E+08     228
DES_P1006_R 55749931            DES
                        NM_001927.3        1674      2   36.1    2.2E+08   -1006
DHCR24_P406_R56790943           DHCR24
                        NM_014762.2        1718      1   36.1   55125899    -406
DHCR24_P652_R56790943           DHCR24
                        NM_014762.2        1718      1   36.1   55126145    -652
DIO3_E230_R 55750010            DIO3
                        NM_001362.2        1735     14   36.1   1.01E+08     230
DIO3_P674_F 55750010            DIO3
                        NM_001362.2        1735     14   36.1   1.01E+08    -674
DIO3_P90_F   55750010           DIO3
                        NM_001362.2        1735     14   36.1   1.01E+08     -90
DIRAS3_E55_R 58530880           DIRAS3
                        NM_004675.2         9077        1    36.1   68288993     55
DIRAS3_P745_F58530880           DIRAS3
                        NM_004675.2         9077        1    36.1   68289793   -745
DKC1_E101_F 15011921            DKC1
                        NM_001363.2         1736    X        36.1   1.54E+08    101
DKC1_P276_F 15011921            DKC1
                        NM_001363.2         1736    X        36.1   1.54E+08   -276
             54400757
DKFZP564O0823_E45_F     NM_015393.2
                                DKFZP564O0823
                                           25849        4    36.1   76077367     45
             54400757
DKFZP564O0823_P386_F    NM_015393.2
                                DKFZP564O0823
                                           25849        4    36.1   76076936   -386
DLC1_E276_F 33188432            DLC1
                        NM_182643.1        10395        8    36.1   13416490    276
DLC1_P695_F 33188432            DLC1
                        NM_182643.1        10395        8    36.1   13417461   -695
DLC1_P88_R 33188432             DLC1
                        NM_182643.1        10395        8    36.1   13416854    -88
DLG3_E340_F 10863920            DLG3
                        NM_021120.1         1741    X        36.1   69581884    340
DLG3_P62_R 10863920             DLG3
                        NM_021120.1         1741    X        36.1   69581482    -62
DLK1_E227_R 74136022            DLK1
                        NM_003836.4         8788        14   36.1      1E+08    227
DLL1_P386_F 10518496            DLL1
                        NM_005618.2        28514         6   36.1    1.7E+08   -386
DLL1_P832_F 10518496            DLL1
                        NM_005618.2        28514         6   36.1    1.7E+08   -832
DMP1_E194_F 4758171             DMP1
                        NM_004407.1         1758         4   36.1   88790677    194
DMP1_P134_F 4758171             DMP1
                        NM_004407.1         1758         4   36.1   88790349   -134
DNAJC15_E26_R66472919           DNAJC15
                        NM_013238.2        29103        13   36.1   42495388     26
DNAJC15_P65_F66472919           DNAJC15
                        NM_013238.2        29103        13   36.1   42495297    -65
             58430945
DNASE1L1_E178_R                 DNASE1L1
                        NM_001009934.1      1774    X        36.1   1.53E+08    178
             58430945
DNASE1L1_P108_F                 DNASE1L1
                        NM_001009934.1      1774    X        36.1   1.53E+08   -108
             58430945
DNASE1L1_P39_R                  DNASE1L1
                        NM_001009934.1      1774    X        36.1   1.53E+08    -39
DNMT1_P100_R 4503350            DNMT1
                        NM_001379.1         1786        19   36.1   10166911   -100
DNMT2_P199_F 28872766           DNMT2
                        NM_004412.3         1787        10   36.1   17283886   -199
             2
DNMT3B_P352_R8559060            DNMT3B
                        NM_175848.1         1789        20   36.1   30813500   -352
DSC2_E90_F 40806177             DSC2
                        NM_024422.2         1824        18   36.1   26936285     90
DSC2_P407_R 40806177            DSC2
                        NM_024422.2         1824        18   36.1   26936782   -407
DSG1_E292_F 4503400             DSG1
                        NM_001942.1         1828        18   36.1   27152342    292
DSG1_P159_R 4503400             DSG1
                        NM_001942.1         1828        18   36.1   27151891   -159
DSP_P36_F    58530839           DSP
                        NM_004415.2         1832         6   36.1    7486833    -36
DSP_P440_R 58530839             DSP
                        NM_004415.2         1832         6   36.1    7486429   -440
DST_E31_F    20357503           DST
                        NM_020388.2           667        6   36.1   56816391     31
DST_P262_R 20357503             DST
                        NM_020388.2           667        6   36.1   56816684   -262
DUSP4_E61_F 58331238            DUSP4
                        NM_001394.5         1846         8   36.1   29264043     61
DUSP4_P925_R 58331238           DUSP4
                        NM_001394.5         1846         8   36.1   29265029   -925
E2F3_P840_R 12669913            E2F3
                        NM_001949.2         1871         6   36.1   20509537   -840
E2F5_P516_R 12669916            E2F5
                        NM_001951.2         1875         8   36.1   86276358   -516
EDN1_E50_R 21359861             EDN1
                        NM_001955.2         1906         6   36.1   12398695     50
EDN1_P39_R 21359861             EDN1
                        NM_001955.2         1906         6   36.1   12398606    -39
EDNRB_P148_R 4557546            EDNRB
                        NM_000115.1         1910        13   36.1   77447813   -148
EDNRB_P709_R 4557546            EDNRB
                        NM_000115.1         1910        13   36.1   77448374   -709
EFNA1_P591_R 33359679           EFNA1
                        NM_182685.1         1942         1   36.1   1.53E+08   -591
EFNA1_P7_F 33359679             EFNA1
                        NM_182685.1         1942         1   36.1   1.53E+08     -7
EFNB1_E69_F 31317225            EFNB1
                        NM_004429.3         1947    X        36.1   67965625     69
EFNB1_P136_R 31317225           EFNB1
                        NM_004429.3         1947    X        36.1   67965420   -136
EFNB1_P17_F 31317225            EFNB1
                        NM_004429.3         1947    X        36.1   67965539    -17
EFNB3_E17_R 38201712            EFNB3
                        NM_001406.3         1949        17   36.1    7549262     17
EFNB3_P442_R 38201712           EFNB3
                        NM_001406.3         1949        17   36.1    7548803   -442
EGF_E339_F    6031163           EGF
                        NM_001963.2         1950         4   36.1   1.11E+08    339
EGF_P242_R    6031163           EGF
                        NM_001963.2         1950         4   36.1   1.11E+08   -242
EGF_P413_F    6031163           EGF
                        NM_001963.2         1950         4   36.1   1.11E+08   -413
EGFR_E295_R 41327737            EGFR
                        NM_005228.3         1956         7   36.1   55054514    295
EGFR_P260_R 41327737            EGFR
                        NM_005228.3         1956         7   36.1   55053959   -260
EGR4_E70_F     4503494           EGR4
                         NM_001965.1        1961       2    36.1   73374048      70
EGR4_P479_F 4503494              EGR4
                         NM_001965.1        1961       2    36.1   73374597    -479
EIF2AK2_E103_R4506102            EIF2AK2
                         NM_002759.1        5610       2    36.1   37237469     103
EIF2AK2_P313_F 4506102           EIF2AK2
                         NM_002759.1        5610       2    36.1   37237885    -313
ELK1_E156_F 11496880             ELK1
                         NM_005229.2        2002   X        36.1   47394808     156
ELK1_E53_F   11496880            ELK1
                         NM_005229.2        2002   X        36.1   47394911      53
ELK1_P195_R 11496880             ELK1
                         NM_005229.2        2002   X        36.1   47395159    -195
ELK1_P569_R 11496880             ELK1
                         NM_005229.2        2002   X        36.1   47395533    -569
ELK1_P6_R    11496880            ELK1
                         NM_005229.2        2002   X        36.1   47394970      -6
ELK3_P514_F 44955920             ELK3
                         NM_005230.2        2004       12   36.1   95111824    -514
ELL_P693_F   47078265            ELL
                         NM_006532.2        8178       19   36.1   18494611    -693
EMR3_E61_F 23397638              EMR3
                         NM_152939.1       84658       19   36.1   14646749      61
EMR3_P1297_R 23397638            EMR3
                         NM_152939.1       84658       19   36.1   14648107   -1297
EMR3_P39_R 23397638              EMR3
                         NM_152939.1       84658       19   36.1   14646849     -39
ENC1_P484_R 4505460              ENC1
                         NM_003633.1        8507        5   36.1   73972757    -484
EPHA1_E46_R 56119206             EPHA1
                         NM_005232.3        2041        7   36.1   1.43E+08      46
EPHA1_P119_R 56119206            EPHA1
                         NM_005232.3        2041        7   36.1   1.43E+08    -119
EPHA2_P203_F 32967310            EPHA2
                         NM_004431.2        1969        1   36.1   16355354    -203
EPHA2_P340_R 32967310            EPHA2
                         NM_004431.2        1969        1   36.1   16355491    -340
EPHA3_E156_R 32967312            EPHA3
                         NM_005233.3        2042        3   36.1   89239520     156
EPHA3_P106_R 32967312            EPHA3
                         NM_005233.3        2042        3   36.1   89239258    -106
EPHA5_E158_R 32967318            EPHA5
                         NM_182472.1        2044        4   36.1   66217946     158
EPHA5_P66_F 32967318             EPHA5
                         NM_182472.1        2044        4   36.1   66218170     -66
EPHA7_E6_F 32967320              EPHA7
                         NM_004440.2        2045        6   36.1   94185987       6
EPHA7_P205_R 32967320            EPHA7
                         NM_004440.2        2045        6   36.1   94186198    -205
EPHA8_P256_F 55774976            EPHA8
                         NM_020526.3        2046        1   36.1   22762335    -256
EPHA8_P456_R 55774976            EPHA8
                         NM_020526.3        2046        1   36.1   22762135    -456
EPHB1_E202_R 55770893            EPHB1
                         NM_004441.3        2047        3   36.1   1.36E+08     202
EPHB1_P503_F 55770893            EPHB1
                         NM_004441.3        2047        3   36.1   1.36E+08    -503
EPHB2_E297_F 55774977            EPHB2
                         NM_004442.5        2048        1   36.1   22910342     297
EPHB2_P165_R 55774977            EPHB2
                         NM_004442.5        2048        1   36.1   22909880    -165
EPHB3_E0_F 33598961              EPHB3
                         NM_004443.3        2049        3   36.1   1.86E+08       0
EPHB3_P569_R 33598961            EPHB3
                         NM_004443.3        2049        3   36.1   1.86E+08    -569
EPHB4_E476_R 55774978            EPHB4
                         NM_004444.4        2050        7   36.1      1E+08     476
EPHB4_P313_R 55774978            EPHB4
                         NM_004444.4        2050        7   36.1      1E+08    -313
EPHB6_E342_F 56119211            EPHB6
                         NM_004445.2        2051        7   36.1   1.42E+08     342
EPHB6_P827_R 56119211            EPHB6
                         NM_004445.2        2051        7   36.1   1.42E+08    -827
EPHX1_E152_F 4557560             EPHX1
                         NM_000120.2        2052        1   36.1   2.24E+08     152
EPHX1_P1358_R 4557560            EPHX1
                         NM_000120.2        2052        1   36.1   2.24E+08   -1358
EPHX1_P22_F 4557560              EPHX1
                         NM_000120.2        2052        1   36.1   2.24E+08     -22
EPM2A_P113_F 66346727            EPM2A
                         NM_001018041.1     7957        6   36.1   1.46E+08    -113
EPM2A_P64_R 66346727             EPM2A
                         NM_001018041.1     7957        6   36.1   1.46E+08     -64
EPO_E244_R 62240996              EPO
                         NM_000799.2        2056        7   36.1      1E+08     244
EPO_P162_R 62240996              EPO
                         NM_000799.2        2056        7   36.1      1E+08    -162
EPS8_E231_F 56682952             EPS8
                         NM_004447.4        2059       12   36.1   15833370     231
EPS8_P437_F 56682952             EPS8
                         NM_004447.4        2059       12   36.1   15834038    -437
             62821793
ER_seq_a1_S60_F                  ESR1
                         NM_000125.2        2099        6   36.1   1.52E+08     481
ERBB2_P59_R 54792097             ERBB2
                         NM_001005862.1     2064       17   36.1   35097860     -59
ERBB3_E331_F 54792099            ERBB3
                         NM_001982.2        2065       12   36.1   54760490     331
ERBB3_P870_R 54792099            ERBB3
                         NM_001982.2        2065       12   36.1   54759289    -870
ERBB4_P255_F 4885214             ERBB4
                         NM_005235.1        2066        2   36.1   2.13E+08    -255
ERBB4_P541_F 4885214             ERBB4
                         NM_005235.1        2066        2   36.1   2.13E+08    -541
ERCC1_P354_F 42544170           ERCC1
                        NM_001983.2       2067   19   36.1   50619371    -354
ERCC1_P440_R42544170            ERCC1
                        NM_001983.2       2067   19   36.1   50619457    -440
ERCC3_P1210_R4557562            ERCC3
                        NM_000122.1       2071    2   36.1   1.28E+08   -1210
ERCC6_P698_R 4557564            ERCC6
                        NM_000124.1       2074   10   36.1   50417776    -698
ERG_E28_F    46255021           ERG
                        NM_004449.3       2078   21   36.1   38955460      28
ERN1_P809_R 50346000            ERN1
                        NM_001433.2       2081   17   36.1   59562017    -809
ESR1_E298_R 62821793            ESR1
                        NM_000125.2       2099    6   36.1   1.52E+08     298
ESR1_P151_R 62821793            ESR1
                        NM_000125.2       2099    6   36.1   1.52E+08    -151
ESR2_E66_F   10835012           ESR2
                        NM_001437.1       2100   14   36.1   63830765      66
ESR2_P162_F 10835012            ESR2
                        NM_001437.1       2100   14   36.1   63830993    -162
ETS1_E253_R 41393580            ETS1
                        NM_005238.2       2113   11   36.1   1.28E+08     253
ETS1_P559_R 41393580            ETS1
                        NM_005238.2       2113   11   36.1   1.28E+08    -559
ETS2_P684_F 56119171            ETS2
                        NM_005239.4       2114   21   36.1   39099035    -684
ETS2_P835_F 56119171            ETS2
                        NM_005239.4       2114   21   36.1   39098884    -835
ETV1_P235_F 64368770            ETV1
                        NM_004956.3       2115    7   36.1   13995524    -235
ETV1_P515_F 64368770            ETV1
                        NM_004956.3       2115    7   36.1   13995804    -515
ETV6_E430_F 41872473            ETV6
                        NM_001987.3       2120   12   36.1   11694485     430
EVI1_E47_R   29789001           EVI1
                        NM_005241.1       2122    3   36.1    1.7E+08      47
EVI1_P30_R   29789001           EVI1
                        NM_005241.1       2122    3   36.1    1.7E+08     -30
EVI2A_E420_F 51511748           EVI2A
                        NM_001003927.1    2123   17   36.1   26672423     420
EVI2A_P94_R 51511748            EVI2A
                        NM_001003927.1    2123   17   36.1   26672937     -94
EXT1_E197_F 46370065            EXT1
                        NM_000127.2       2131    8   36.1   1.19E+08     197
EYA4_E277_F 26667248            EYA4
                        NM_004100.2       2070    6   36.1   1.34E+08     277
EYA4_P508_F 26667248            EYA4
                        NM_004100.2       2070    6   36.1   1.34E+08    -508
EYA4_P794_F 26667248            EYA4
                        NM_004100.2       2070    6   36.1   1.34E+08    -794
F2R_P839_F    6031164           F2R
                        NM_001992.2       2149    5   36.1   76046703    -839
F2R_P88_F     6031164           F2R
                        NM_001992.2       2149    5   36.1   76047454     -88
FABP3_E113_F 62865867           FABP3
                        NM_004102.3       2170    1   36.1   31618397     113
FABP3_P598_F 62865867           FABP3
                        NM_004102.3       2170    1   36.1   31619108    -598
FANCA_P1006_R66879665           FANCA
                        NM_001018112.1    2175   16   36.1   88411572   -1006
FANCE_P356_R66879667            FANCE
                        NM_021922.2       2178    6   36.1   35527760    -356
FANCF_P13_F 42716285            FANCF
                        NM_022725.2       2188   11   36.1   22603976     -13
FANCG_E207_R 4759335            FANCG
                        NM_004629.1       2189    9   36.1   35069806     207
FAS_P322_R   23510419           FAS
                        NM_000043.3        355   10   36.1   90739946    -322
FAS_P65_F    23510419           FAS
                        NM_000043.3        355   10   36.1   90740203     -65
FASTK_P257_F 39995106           FASTK
                        NM_033015.2      10922    7   36.1    1.5E+08    -257
FASTK_P598_R 39995106           FASTK
                        NM_033015.2      10922    7   36.1    1.5E+08    -598
FAT_P279_R   75813622           FAT
                        NM_005245.3       2195    4   36.1   1.88E+08    -279
FAT_P973_R   75813622           FAT
                        NM_005245.3       2195    4   36.1   1.88E+08    -973
FER_E119_F    4885230           FER
                        NM_005246.1       2241    5   36.1   1.08E+08     119
FER_P581_F    4885230           FER
                        NM_005246.1       2241    5   36.1   1.08E+08    -581
FES_E34_R    13376997           FES
                        NM_002005.2       2242   15   36.1   89228747      34
FES_P223_R   13376997           FES
                        NM_002005.2       2242   15   36.1   89228490    -223
FGF1_E5_F    15055540           FGF1
                        NM_033136.1       2246    5   36.1   1.42E+08       5
FGF1_P357_R 15055540            FGF1
                        NM_033136.1       2246    5   36.1   1.42E+08    -357
FGF12_E61_R 21614509            FGF12
                        NM_021032.2       2257    3   36.1   1.94E+08      61
FGF12_P210_R 21614509           FGF12
                        NM_021032.2       2257    3   36.1   1.94E+08    -210
FGF2_P153_F 41352694            FGF2
                        NM_002006.3       2247    4   36.1   1.24E+08    -153
FGF2_P229_F 41352694            FGF2
                        NM_002006.3       2247    4   36.1   1.24E+08    -229
FGF3_E198_R 15451899            FGF3
                        NM_005247.2       2248   11   36.1   69342931     198
FGF3_P171_R 15451899            FGF3
                        NM_005247.2       2248   11   36.1   69343300    -171
FGF5_E16_F   73486654           FGF5
                        NM_004464.3       2250    4   36.1   81406782      16
FGF5_P238_R 73486654             FGF5
                         NM_004464.3         2250        4   36.1   81406528    -238
FGF6_E294_F 10337586             FGF6
                         NM_020996.1         2251       12   36.1    4424747     294
FGF6_P139_R 10337586             FGF6
                         NM_020996.1         2251       12   36.1    4425180    -139
FGF7_P44_F    15147344           FGF7
                         NM_002009.2         2252       15   36.1   47502707     -44
FGF7_P610_F 15147344             FGF7
                         NM_002009.2         2252       15   36.1   47502141    -610
FGF8_E183_F 15147351             FGF8
                         NM_006119.2         2253       10   36.1   1.04E+08     183
FGF8_P473_F 15147351             FGF8
                         NM_006119.2         2253       10   36.1   1.04E+08    -473
FGF9_P1404_F 4503706             FGF9
                         NM_002010.1         2254       13   36.1   21142471   -1404
FGF9_P862_R 4503706              FGF9
                         NM_002010.1         2254       13   36.1   21143013    -862
FGFR1_E317_F 13186232            FGFR1
                         NM_000604.2         2260        8   36.1   38444976     317
FGFR1_P204_F 13186232            FGFR1
                         NM_000604.2         2260        8   36.1   38445497    -204
FGFR2_P266_R 13186270            FGFR2
                         NM_023030.1         2263       10   36.1   1.23E+08    -266
FGFR2_P460_R 13186270            FGFR2
                         NM_023030.1         2263       10   36.1   1.23E+08    -460
FGFR3_E297_R 13112047            FGFR3
                         NM_022965.1         2261        4   36.1    1765718     297
FGFR3_P1152_R 13112047           FGFR3
                         NM_022965.1         2261        4   36.1    1764269   -1152
FGFR4_P610_F 47524174            FGFR4
                         NM_213647.1         2264        5   36.1   1.76E+08    -610
FGR_P39_F      4885234           FGR
                         NM_005248.1         2268        1   36.1   27823199     -39
FHIT_E19_R     4503718           FHIT
                         NM_002012.1         2272        3   36.1   61212145      19
FHIT_P93_R     4503718           FHIT
                         NM_002012.1         2272        3   36.1   61212257     -93
FHL1_E229_R 34147646             FHL1
                         NM_001449.3         2273   X        36.1   1.35E+08     229
FHL1_P768_F 34147646             FHL1
                         NM_001449.3         2273   X        36.1   1.35E+08    -768
FLI1_E29_F     7110592           FLI1
                         NM_002017.2         2313       11   36.1   1.28E+08      29
FLI1_P620_R    7110592           FLI1
                         NM_002017.2         2313       11   36.1   1.28E+08    -620
              89025854
FLJ20712_P984_R                  FLJ20712
                         XM_940022.1        55025        7   36.1   33731140    -984
FLT1_E444_F 32306519             FLT1
                         NM_002019.2         2321       13   36.1   27966788     444
FLT1_P302_F 32306519             FLT1
                         NM_002019.2         2321       13   36.1   27967534    -302
FLT1_P615_R 32306519             FLT1
                         NM_002019.2         2321       13   36.1   27967847    -615
FLT3_E326_R    4758395           FLT3
                         NM_004119.1         2322       13   36.1   27572379     326
FLT3_P302_F    4758395           FLT3
                         NM_004119.1         2322       13   36.1   27573007    -302
FLT4_E206_F    4503752           FLT4
                         NM_002020.1         2324        5   36.1    1.8E+08     206
FLT4_P180_R    4503752           FLT4
                         NM_002020.1         2324        5   36.1    1.8E+08    -180
FMR1_P484_R 50053960             FMR1
                         NM_002024.3         2332   X        36.1   1.47E+08    -484
FMR1_P62_R 50053960              FMR1
                         NM_002024.3         2332   X        36.1   1.47E+08     -62
FN1_E469_F    47132546           FN1
                         NM_054034.2         2335        2   36.1   2.16E+08     469
FN1_P229_R    47132546           FN1
                         NM_054034.2         2335        2   36.1   2.16E+08    -229
FOLR1_E368_R 12056965            FOLR1
                         NM_000802.2         2348       11   36.1   71578618     368
FOSL2_E384_R 44680151            FOSL2
                         NM_005253.3         2355        2   36.1   28469667     384
FRK_P258_F    31657133           FRK
                         NM_002031.2         2444        6   36.1   1.16E+08    -258
FRK_P36_F     31657133           FRK
                         NM_002031.2         2444        6   36.1   1.16E+08     -36
FRZB_E186_R 38455387             FRZB
                         NM_001463.2         2487        2   36.1   1.83E+08     186
FRZB_P406_F 38455387             FRZB
                         NM_001463.2         2487        2   36.1   1.83E+08    -406
FVT1_P225_F    4503816           FVT1
                         NM_002035.1         2531       18   36.1   59185663    -225
FYN_P352_R 23510363              FYN
                         NM_153048.1         2534        6   36.1   1.12E+08    -352
FZD7_E296_F    4503832           FZD7
                         NM_003507.1         8324        2   36.1   2.03E+08     296
FZD9_E458_F 62865872             FZD9
                         NM_003508.2         8326        7   36.1   72486503     458
FZD9_P15_R    62865872           FZD9
                         NM_003508.2         8326        7   36.1   72486030     -15
FZD9_P175_F 62865872             FZD9
                         NM_003508.2         8326        7   36.1   72485870    -175
G6PD_E190_F 21614519             G6PD
                         NM_000402.2         2539   X        36.1   1.53E+08    -783
G6PD_P1065_R 21614519            G6PD
                         NM_000402.2         2539   X        36.1   1.53E+08     472
G6PD_P196_F 21614519             G6PD
                         NM_000402.2         2539   X        36.1   1.53E+08    -397
G6PD_P597_F 21614519             G6PD
                         NM_000402.2         2539   X        36.1   1.53E+08       4
GABRA5_E44_R 6031207             GABRA5
                         NM_000810.2         2558       15   36.1   24742740      44
GABRA5_P1016_F6031207           GABRA5
                        NM_000810.2         2558       15   36.1   24741680   -1016
GABRA5_P862_R6031207            GABRA5
                        NM_000810.2         2558       15   36.1   24741834    -862
GABRB3_E42_F30061561            GABRB3
                        NM_021912.2         2562       15   36.1   24569978      42
GABRB3_P92_F30061561            GABRB3
                        NM_021912.2         2562       15   36.1   24570112     -92
             1
GABRG3_E123_R5193297            GABRG3
                        NM_033223.1         2567       15   36.1   25343888     123
GABRG3_P75_F15193297            GABRG3
                        NM_033223.1         2567       15   36.1   25343690     -75
              9
GADD45A_P737_R790904            GADD45A
                        NM_001924.2         1647        1   36.1   67922734    -737
GALR1_E52_F 6031165             GALR1
                        NM_001480.2         2587       18   36.1   73090773      52
GALR1_P80_F 6031165             GALR1
                        NM_001480.2         2587       18   36.1   73090641     -80
GAS1_E22_F    4503918           GAS1
                        NM_002048.1         2619        9   36.1   88751902      22
GAS1_P754_R 4503918             GAS1
                        NM_002048.1         2619        9   36.1   88752678    -754
GAS7_E148_F 41406075            GAS7
                        NM_003644.2         8522       17   36.1   10042445     148
GAS7_P622_R 41406075            GAS7
                        NM_003644.2         8522       17   36.1   10043215    -622
GATA6_P21_R 40288196            GATA6
                        NM_005257.3         2627       18   36.1   18003393     -21
GATA6_P726_F 40288196           GATA6
                        NM_005257.3         2627       18   36.1   18002688    -726
GDF10_E39_F 11641417            GDF10
                        NM_004962.2         2662       10   36.1   48059133      39
GDF10_P95_R 11641417            GDF10
                        NM_004962.2         2662       10   36.1   48059267     -95
GFAP_P1214_F 24430142           GFAP
                        NM_002055.2         2670       17   36.1   40349608   -1214
GFAP_P56_R 24430142             GFAP
                        NM_002055.2         2670       17   36.1   40348450     -56
GFI1_E136_F 71037376            GFI1
                        NM_005263.2         2672        1   36.1   92724885     136
GFI1_P208_R 71037376            GFI1
                        NM_005263.2         2672        1   36.1   92725229    -208
GFI1_P45_R   71037376           GFI1
                        NM_005263.2         2672        1   36.1   92725066     -45
GJB2_E43_F   42558282           GJB2
                        NM_004004.3         2706       13   36.1   19664994      43
GJB2_P791_R 42558282            GJB2
                        NM_004004.3         2706       13   36.1   19665828    -791
GJB2_P931_R 42558282            GJB2
                        NM_004004.3         2706       13   36.1   19665968    -931
GLA_E98_R     4504008           GLA
                        NM_000169.1         2717   X        36.1   1.01E+08      98
GLA_P112_F    4504008           GLA
                        NM_000169.1         2717   X        36.1   1.01E+08    -112
GLA_P343_R    4504008           GLA
                        NM_000169.1         2717   X        36.1   1.01E+08    -343
GLI2_E90_F   13518230           GLI2
                        NM_030379.1         2736        2   36.1   1.21E+08      90
GLI2_P295_F 13518230            GLI2
                        NM_030379.1         2736        2   36.1   1.21E+08    -295
GLI3_E148_R 13518031            GLI3
                        NM_000168.2         2737        7   36.1   42241564     148
GLI3_P453_R 13518031            GLI3
                        NM_000168.2         2737        7   36.1   42242165    -453
GML_E144_F    4504032           GML
                        NM_002066.1         2765        8   36.1   1.44E+08     144
GML_P281_R    4504032           GML
                        NM_002066.1         2765        8   36.1   1.44E+08    -281
GNAS_E58_F    7706588           GNAS
                        NM_016592.1         2778       20   36.1   56848248      58
GNAS_P86_F    7706588           GNAS
                        NM_016592.1         2778       20   36.1   56848104     -86
GNG7_E310_R 32698768            GNG7
                        NM_052847.1         2788       19   36.1    2603280     310
GNG7_P903_F 32698768            GNG7
                        NM_052847.1         2788       19   36.1    2604493    -903
GNMT_E126_F 54792737            GNMT
                        NM_018960.4        27232        6   36.1   43036604     126
GNMT_P197_F 54792737            GNMT
                        NM_018960.4        27232        6   36.1   43036281    -197
GP1BB_E23_F 9945387             GP1BB
                        NM_000407.3         2812       22   36.1   18091089      23
GP1BB_P278_R 9945387            GP1BB
                        NM_000407.3         2812       22   36.1   18090788    -278
GPATC3_P410_R11545792           GPATC3
                        NM_022078.1        63906        1   36.1   27099954    -410
GPC3_E72_F    5360213           GPC3
                        NM_004484.2         2719   X        36.1   1.33E+08      72
GPC3_P235_R 5360213             GPC3
                        NM_004484.2         2719   X        36.1   1.33E+08    -235
GPR116_E328_R44771172           GPR116
                        NM_015234.3       221395       6    36.1   46990497     328
GPR116_P850_F44771172           GPR116
                        NM_015234.3       221395       6    36.1   46991675    -850
GPX1_E46_R 41406083             GPX1
                        NM_000581.2         2876       3    36.1   49370749      46
GPX1_P194_F 41406083            GPX1
                        NM_000581.2         2876       3    36.1   49370989    -194
GPX3_E178_F 6006000             GPX3
                        NM_002084.2         2878       5    36.1    1.5E+08     178
GRB10_E85_R 48762696            GRB10
                        NM_001001555.1      2887       7    36.1   50828567      85
GRB10_P260_F 48762696           GRB10
                        NM_001001555.1      2887       7    36.1   50828912    -260
GRB10_P496_R 48762696              GRB10
                          NM_001001555.1        2887        7   36.1   50829148      -496
GRB7_E71_R 71979666                GRB7
                          NM_001030002.1        2886       17   36.1   35147784        71
GRB7_P160_R 71979666               GRB7
                          NM_001030002.1        2886       17   36.1   35147553      -160
GRPR_P200_R 61677286               GRPR
                          NM_005314.2           2925   X        36.1   16051145      -200
GSTM1_P266_F 23065546              GSTM1
                          NM_146421.1           2944        1   36.1    1.1E+08      -266
GSTM1_P363_F 23065546              GSTM1
                          NM_146421.1           2944        1   36.1    1.1E+08      -363
GSTM2_E153_F 23065549              GSTM2
                          NM_000848.2           2946        1   36.1    1.1E+08       153
GSTM2_P109_R23065549               GSTM2
                          NM_000848.2           2946        1   36.1    1.1E+08      -109
GSTM2_P453_R23065549               GSTM2
                          NM_000848.2           2946        1   36.1    1.1E+08      -453
GSTP1_E322_R 6552334               GSTP1
                          NM_000852.2           2950       11   36.1   67108184       322
GSTP1_P74_F 6552334                GSTP1
                          NM_000852.2           2950       11   36.1   67107788       -74
                6552334
GSTP1_seq_38_S153_R                GSTP1
                          NM_000852.2           2950       11   36.1   67107814       -48
GUCY2D_E419_R4504216               GUCY2D
                          NM_000180.1           3000       17   36.1    7847132       419
GUCY2D_P48_R 4504216               GUCY2D
                          NM_000180.1           3000       17   36.1    7846665       -48
GUCY2F_P255_F4504218               GUCY2F
                          NM_001522.1           2986   X        36.1   1.09E+08      -255
H19_P1411_R 57862814               H19
                          NR_002196.1         283120       11   36.1    1977052     -1411
H19_P541_F     57862814            H19
                          NR_002196.1         283120       11   36.1    1976182      -541
HBEGF_P32_R 4503412                HBEGF
                          NM_001945.1           1839        5   36.1    1.4E+08       -32
HBII-13_E48_F 30089682             HBII-13
                          NR_001294.1         347686       15   36.1   22781388        48
HBII-13_P991_R30089682             HBII-13
                          NR_001294.1         347686       15   36.1   22780349      -991
HBII-52_E142_F 29171307            HBII-52
                          NR_001291.1         338433       15   36.1   22967111       142
HBII-52_P563_F 29171307            HBII-52
                          NR_001291.1         338433       15   36.1   22966406      -563
HBII-52_P659_F 29171307            HBII-52
                          NR_001291.1         338433       15   36.1   22966310      -659
HCK_P46_R      30795228            HCK
                          NM_002110.2           3055       20   36.1   30103672       -46
HCK_P858_F 30795228                HCK
                          NM_002110.2           3055       20   36.1   30102860      -858
HDAC1_P414_R13128859               HDAC1
                          NM_004964.2           3065        1   36.1   32529881      -414
HDAC11_P556_F  13376227            HDAC11
                          NM_024827.1          79885        3   36.1   13496268      -556
HDAC5_E298_F 62750346              HDAC5
                          NM_005474.4          10014       17   36.1   39556242       298
HDAC6_E102_F 13128863              HDAC6
                          NM_006044.2          10013   X        36.1   48545533       102
HDAC6_P153_F 13128863              HDAC6
                          NM_006044.2          10013   X        36.1   48545278      -153
HDAC7A_P344_F  13259521            HDAC7A
                          NM_015401.1          51564       12   36.1   46479534      -344
HDAC9_E38_F 7662279                HDAC9
                          NM_014707.1           9734        7   36.1   18501932        38
HDAC9_P137_R 7662279               HDAC9
                          NM_014707.1           9734        7   36.1   18501757      -137
HFE_E273_R 21040354                HFE
                          NM_139010.1           3077        6   36.1   26195700       273
HGF_E102_R 58533164                HGF
                          NM_001010933.1        3082        7   36.1   81237286       102
HGF_P1293_R 58533164               HGF
                          NM_001010933.1        3082        7   36.1   81238681     -1293
HHIP_E94_F     20143972            HHIP
                          NM_022475.1          64399        4   36.1   1.46E+08       323
HHIP_P307_R 20143972               HHIP
                          NM_022475.1          64399        4   36.1   1.46E+08      -307
HHIP_P578_R 20143972               HHIP
                          NM_022475.1          64399        4   36.1   1.46E+08      -578
HIC1_E151_F 61676185               HIC1
                          NM_006497.2           3090       17   36.1    1905164       151
HIC1_P565_R 61676185               HIC1
                          NM_006497.2           3090       17   36.1    1904448      -565
               61676185
HIC-1_seq_48_S103_R                HIC1
                          NM_006497.2           3090       17   36.1    1907679 .
HIC2_P498_F 31657120               HIC2
                          NM_015094.1          23119       22   36.1   20101195      -498
HIC2_P528_R 31657120               HIC2
                          NM_015094.1          23119       22   36.1   20101165      -528
HIF1A_P488_F 31077212              HIF1A
                          NM_001530.2           3091       14   36.1   61231504      -488
HLA-DOA_P191_R 62912477            HLA-DOA
                          NM_002119.3           3111        6   36.1   33085558      -191
HLA-DOA_P594_F 62912477            HLA-DOA
                          NM_002119.3           3111        6   36.1   33085961      -594
HLA-DOB_E432_R 18641377            HLA-DOB
                          NM_002120.2           3112        6   36.1   32892330       432
HLA-DOB_P1114_R18641377            HLA-DOB
                          NM_002120.2           3112        6   36.1   32893876     -1114
HLA-DOB_P357_R 18641377            HLA-DOB
                          NM_002120.2           3112        6   36.1   32893119      -357
HLA-DPA1_E35_R 24797073            HLA-DPA1
                          NM_033554.2           3113        6   36.1   33149321        35
HLA-DPA1_P205_R24797073            HLA-DPA1
                          NM_033554.2           3113        6   36.1   33149561      -205
             24797073
HLA-DPA1_P28_R                  HLA-DPA1
                        NM_033554.2         3113    6   36.1   33149384     -28
HLA-DPB1_E2_R24797075           HLA-DPB1
                        NM_002121.4         3115    6   36.1   33151740       2
             24797075
HLA-DPB1_P540_F                 HLA-DPB1
                        NM_002121.4         3115    6   36.1   33151198    -540
             56710315
HLA-DQA2_E93_F                  HLA-DQA2
                        NM_020056.2         3118    6   36.1   32817234      93
             56710315
HLA-DQA2_P282_R                 HLA-DQA2
                        NM_020056.2         3118    6   36.1   32816859    -282
             52426773
HLA-DRA_P132_R                  HLA-DRA
                        NM_019111.3         3122    6   36.1   32515493    -132
HLA-DRA_P77_R52426773           HLA-DRA
                        NM_019111.3         3122    6   36.1   32515548     -77
HLA-F_E402_F 9665231            HLA-F
                        NM_018950.1         3134    6   36.1   29799622     402
HLF_E192_F   31542934           HLF
                        NM_002126.3         3131   17   36.1   50697562     192
HOXA11_E35_F 24497552           HOXA11
                        NM_005523.4         3207    7   36.1   27191320      35
HOXA11_P698_F24497552           HOXA11
                        NM_005523.4         3207    7   36.1   27192053    -698
HOXA11_P92_R24497552            HOXA11
                        NM_005523.4         3207    7   36.1   27191447     -92
HOXA5_E187_F 24497516           HOXA5
                        NM_019102.2         3202    7   36.1   27149625     187
HOXA5_P1324_F24497516           HOXA5
                        NM_019102.2         3202    7   36.1   27151136   -1324
HOXA5_P479_F 24497516           HOXA5
                        NM_019102.2         3202    7   36.1   27150291    -479
HOXA9_E252_R24497558            HOXA9
                        NM_002142.3         3205    7   36.1   27171422     252
HOXA9_P1141_R24497558           HOXA9
                        NM_002142.3         3205    7   36.1   27172815   -1141
HOXA9_P303_F 24497558           HOXA9
                        NM_002142.3         3205    7   36.1   27171977    -303
HOXB13_E21_F 70167332           HOXB13
                        NM_006361.4        10481   17   36.1   44161066      21
HOXB13_P17_R70167332            HOXB13
                        NM_006361.4        10481   17   36.1   44161104     -17
HOXB2_P488_R24497527            HOXB2
                        NM_002145.2         3212   17   36.1   43977879    -488
HOXB2_P99_F 24497527            HOXB2
                        NM_002145.2         3212   17   36.1   43977490     -99
HOXC6_P456_R24497543            HOXC6
                        NM_153693.1         3223   12   36.1   52696647    -293
HOXC6_P585_R24497543            HOXC6
                        NM_153693.1         3223   12   36.1   52696518    -422
HPN_P374_R 33695154             HPN
                        NM_182983.1         3249   19   36.1   40222876    -374
HPN_P823_F 33695154             HPN
                        NM_182983.1         3249   19   36.1   40222427    -823
HPSE_P29_F 19923365             HPSE
                        NM_006665.2        10855    4   36.1   84475358     -29
HPSE_P93_F 19923365             HPSE
                        NM_006665.2        10855    4   36.1   84475422     -93
HRASLS_E72_R38455407            HRASLS
                        NM_020386.2        57110    3   36.1   1.94E+08      72
HRASLS_P353_R38455407           HRASLS
                        NM_020386.2        57110    3   36.1   1.94E+08    -353
HS3ST2_E145_R 5174462           HS3ST2
                        NM_006043.1         9956   16   36.1   22733506     145
HS3ST2_P171_F 5174462           HS3ST2
                        NM_006043.1         9956   16   36.1   22733190    -171
HS3ST2_P546_F 5174462           HS3ST2
                        NM_006043.1         9956   16   36.1   22732815    -546
              7705854
HSD17B12_E145_R                 HSD17B12
                        NM_016142.1        51144   11   36.1   43659026     145
HSD17B12_P97_F7705854           HSD17B12
                        NM_016142.1        51144   11   36.1   43658784     -97
HSPA2_P162_R 13676856           HSPA2
                        NM_021979.2         3306   14   36.1   64072214    -162
HTR1B_E232_R 4504532            HTR1B
                        NM_000863.1         3351    6   36.1   78229607     232
HTR1B_P107_F 4504532            HTR1B
                        NM_000863.1         3351    6   36.1   78229946    -107
HTR1B_P222_F 4504532            HTR1B
                        NM_000863.1         3351    6   36.1   78230061    -222
HTR2A_E10_R 60302916            HTR2A
                        NM_000621.2         3356   13   36.1   46368166      10
HTR2A_P853_F 60302916           HTR2A
                        NM_000621.2         3356   13   36.1   46369029    -853
IAPP_E280_F   4557654           IAPP
                        NM_000415.1         3375   12   36.1   21417365     280
ICA1_P61_F    4826767           ICA1
                        NM_004968.1         3382    7   36.1    8268743     -61
ICA1_P72_R    4826767           ICA1
                        NM_004968.1         3382    7   36.1    8268754     -72
ICAM1_E242_F 4557877            ICAM1
                        NM_000201.1         3383   19   36.1   10243021     242
ICAM1_P119_R 4557877            ICAM1
                        NM_000201.1         3383   19   36.1   10242660    -119
ICAM1_P386_R 4557877            ICAM1
                        NM_000201.1         3383   19   36.1   10242393    -386
ID1_P659_R   31317298           ID1
                        NM_002165.2         3397   20   36.1   29656094    -659
ID1_P880_F   31317298           ID1
                        NM_002165.2         3397   20   36.1   29655873    -880
IFNG_E293_F 56786137            IFNG
                        NM_000619.2         3458   12   36.1   66839495     293
IFNG_P188_F 56786137            IFNG
                        NM_000619.2         3458   12   36.1   66839976    -188
IFNG_P459_R 56786137            IFNG
                        NM_000619.2         3458   12   36.1   66840247    -459
IFNGR1_P307_F 4557879            IFNGR1
                         NM_000416.1        3459    6   36.1   1.38E+08    -307
IFNGR2_E164_F47419933            IFNGR2
                         NM_005534.2        3460   21   36.1   33697236     164
IFNGR2_P377_R 47419933           IFNGR2
                         NM_005534.2        3460   21   36.1   33696695    -377
IGF1_E394_F 19923111             IGF1
                         NM_000618.2        3479   12   36.1   1.01E+08     394
IGF1_P933_F 19923111             IGF1
                         NM_000618.2        3479   12   36.1   1.01E+08    -933
IGF1R_E186_R 11068002            IGF1R
                         NM_000875.2        3480   15   36.1   97010474     186
IGF1R_P325_R 11068002            IGF1R
                         NM_000875.2        3480   15   36.1   97009963    -325
IGF2_E134_R    6453816           IGF2
                         NM_000612.2        3481   11   36.1    2116444     134
IGF2_P1036_R 6453816             IGF2
                         NM_000612.2        3481   11   36.1    2117614    -709
IGF2_P36_R     6453816           IGF2
                         NM_000612.2        3481   11   36.1    2116614     -36
IGF2AS_E4_F    7705972           IGF2AS
                         NM_016412.1       51214   11   36.1    2118327       4
IGF2AS_P203_F 7705972            IGF2AS
                         NM_016412.1       51214   11   36.1    2118120    -203
IGF2R_P396_R 4504610             IGF2R
                         NM_000876.1        3482    6   36.1    1.6E+08    -396
IGFBP1_E48_R 61744448            IGFBP1
                         NM_001013029.1     3484    7   36.1   45894532      48
IGFBP1_P12_R 61744448            IGFBP1
                         NM_001013029.1     3484    7   36.1   45894472     -12
IGFBP2_P306_F55925575            IGFBP2
                         NM_000597.2        3485    2   36.1   2.17E+08    -306
IGFBP2_P353_R55925575            IGFBP2
                         NM_000597.2        3485    2   36.1   2.17E+08    -353
IGFBP3_E65_R 62243067            IGFBP3
                         NM_000598.4        3486    7   36.1   45927331      65
              6
IGFBP3_P1035_F2243067            IGFBP3
                         NM_000598.4        3486    7   36.1   45928431   -1035
IGFBP3_P423_R62243067            IGFBP3
                         NM_000598.4        3486    7   36.1   45927819    -423
IGFBP5_E144_F46094066            IGFBP5
                         NM_000599.2        3488    2   36.1   2.17E+08     144
IGFBP5_P9_R 46094066             IGFBP5
                         NM_000599.2        3488    2   36.1   2.17E+08      -9
IGFBP6_E47_F 49574524            IGFBP6
                         NM_002178.2        3489   12   36.1   51777750   -1083
IGFBP6_P328_R49574524            IGFBP6
                         NM_002178.2        3489   12   36.1   51777375    -328
IGFBP7_P297_F 4504618            IGFBP7
                         NM_001553.1        3490    4   36.1   57671593    -297
IGFBP7_P371_F 4504618            IGFBP7
                         NM_001553.1        3490    4   36.1   57671667    -371
IGSF4_P454_F 22095346            IGSF4
                         NM_014333.2       23705   11   36.1   1.15E+08    -454
IGSF4_P86_R 22095346             IGSF4
                         NM_014333.2       23705   11   36.1   1.15E+08     -86
IGSF4C_E65_F 21686976            IGSF4C
                         NM_145296.1      199731   19   36.1   48835766      65
IGSF4C_P533_R21686976            IGSF4C
                         NM_145296.1      199731   19   36.1   48836364    -533
IHH_E186_F    51467740           IHH
                         NM_002181.1        3549    2   36.1    2.2E+08     186
IHH_P246_R    51467740           IHH
                         NM_002181.1        3549    2   36.1    2.2E+08    -246
IHH_P529_F    51467740           IHH
                         NM_002181.1        3549    2   36.1    2.2E+08    -529
IL10_P348_F   24430216           IL10
                         NM_000572.2        3586    1   36.1   2.05E+08    -348
IL10_P85_F    24430216           IL10
                         NM_000572.2        3586    1   36.1   2.05E+08     -85
IL11_E232_F   24430217           IL11
                         NM_000641.2        3589   19   36.1   60573394     232
IL11_P11_R    24430217           IL11
                         NM_000641.2        3589   19   36.1   60573637     -11
IL12A_E287_R 24430218            IL12A
                         NM_000882.2        3592    3   36.1   1.61E+08     287
IL12B_E25_F   24497437           IL12B
                         NM_002187.2        3593    5   36.1   1.59E+08      25
IL12B_P1453_F 24497437           IL12B
                         NM_002187.2        3593    5   36.1   1.59E+08   -1453
IL12B_P392_R 24497437            IL12B
                         NM_002187.2        3593    5   36.1   1.59E+08    -392
IL13_E75_R    26787977           IL13
                         NM_002188.2        3596    5   36.1   1.32E+08      75
IL16_P226_F   27262654           IL16
                         NM_004513.3        3603   15   36.1   79262029    -226
IL16_P93_R    27262654           IL16
                         NM_004513.3        3603   15   36.1   79262162     -93
IL17RB_E164_R 27477073           IL17RB
                         NM_018725.2       55540    3   36.1   53855776    -560
IL17RB_P788_R 27477073           IL17RB
                         NM_018725.2       55540    3   36.1   53854824     392
IL18BP_E285_F 27502394           IL18BP
                         NM_005699.2       10068   11   36.1   71387872     285
IL18BP_P51_R 27502394            IL18BP
                         NM_005699.2       10068   11   36.1   71387536     -51
IL1A_E113_R 27894329             IL1A
                         NM_000575.3        3552    2   36.1   1.13E+08     113
IL1B_P582_R 27894305             IL1B
                         NM_000576.2        3553    2   36.1   1.13E+08    -582
IL1B_P829_F   27894305           IL1B
                         NM_000576.2        3553    2   36.1   1.13E+08    -829
IL1RN_E42_F 27894320             IL1RN
                         NM_173843.1        3557    2   36.1   1.14E+08      42
IL1RN_P93_R 27894320            IL1RN
                        NM_173843.1       3557      2   36.1   1.14E+08       -93
IL2_P607_R   28178860           IL2
                        NM_000586.2       3558      4   36.1   1.24E+08      -607
IL3_P556_F   28416914           IL3
                        NM_000588.3       3562      5   36.1   1.31E+08      -556
IL4_P262_R   27477090           IL4
                        NM_000589.2       3565      5   36.1   1.32E+08      -262
IL6_E168_F   10834983           IL6
                        NM_000600.1       3569      7   36.1   22733513       168
IL6_P213_R   10834983           IL6
                        NM_000600.1       3569      7   36.1   22733132      -213
IL6_P611_F   10834983           IL6
                        NM_000600.1       3569      7   36.1   22732734      -611
IL8_E118_R   28610153           IL8
                        NM_000584.2       3576      4   36.1   74825257       118
IL8_P83_F    28610153           IL8
                        NM_000584.2       3576      4   36.1   74825056       -83
IMPACT_P186_F 8923818           IMPACT
                        NM_018439.1      55364     18   36.1   20260494      -186
IMPACT_P234_R 8923818           IMPACT
                        NM_018439.1      55364     18   36.1   20260446      -234
INHA_P1144_R 9257223            INHA
                        NM_002191.2       3623      2   36.1    2.2E+08 .
INHA_P1189_F 9257223            INHA
                        NM_002191.2       3623      2   36.1    2.2E+08 .
INS_P248_F    4557670           INS
                        NM_000207.1       3630     11   36.1    2139248      -248
INS_P804_R    4557670           INS
                        NM_000207.1       3630     11   36.1    2139804      -804
INSR_E97_F    4557883           INSR
                        NM_000208.1       3643     19   36.1    7244914        97
INSR_P1063_R 4557883            INSR
                        NM_000208.1       3643     19   36.1    7246074     -1063
IPF1_P234_F   4557672           IPF1
                        NM_000209.1       3651     13   36.1   27391943      -234
IPF1_P750_F   4557672           IPF1
                        NM_000209.1       3651     13   36.1   27391427      -750
IRAK1_P312_F 68800242           IRAK1
                        NM_001569.3       3654 X        36.1   1.53E+08      -312
IRAK1_P455_R 68800242           IRAK1
                        NM_001569.3       3654 X        36.1   1.53E+08      -455
IRAK3_E130_F 6005791            IRAK3
                        NM_007199.1      11213     12   36.1   64869414       130
IRAK3_P13_F   6005791           IRAK3
                        NM_007199.1      11213     12   36.1   64869271       -13
IRAK3_P185_F 6005791            IRAK3
                        NM_007199.1      11213     12   36.1   64869099      -185
IRF5_E101_F 38683858            IRF5
                        NM_032643.3       3663      7   36.1   1.28E+08       101
IRF5_P123_F 38683858            IRF5
                        NM_032643.3       3663      7   36.1   1.28E+08      -123
IRF7_E236_R   4809283           IRF7
                        NM_004029.1       3665     11   36.1     605691       236
IRF7_P277_R   4809283           IRF7
                        NM_004029.1       3665     11   36.1     606204      -277
ISL1_E87_R    4504736           ISL1
                        NM_002202.1       3670      5   36.1   50715113       132
ISL1_P379_F   4504736           ISL1
                        NM_002202.1       3670      5   36.1   50714647      -379
ISL1_P554_F   4504736           ISL1
                        NM_002202.1       3670      5   36.1   50714472      -554
ITGA2_E120_F 6006008            ITGA2
                        NM_002203.2       3673      5   36.1   52321134       120
ITGA2_P26_R   6006008           ITGA2
                        NM_002203.2       3673      5   36.1   52320988       -26
ITGA6_P298_R 4557674            ITGA6
                        NM_000210.1       3655      2   36.1   1.73E+08      -298
ITGA6_P718_R 4557674            ITGA6
                        NM_000210.1       3655      2   36.1   1.73E+08      -718
ITGB1_P451_F 19743816           ITGB1
                        NM_033667.1       3688     10   36.1   33287655      -451
ITGB4_E144_F 54607034           ITGB4
                        NM_000213.3       3691     17   36.1   71229255       144
ITGB4_P517_F 54607034           ITGB4
                        NM_000213.3       3691     17   36.1   71228594      -517
ITK_E166_R   21614549           ITK
                        NM_005546.3       3702      5   36.1   1.57E+08       166
ITK_P114_F   21614549           ITK
                        NM_005546.3       3702      5   36.1   1.57E+08      -114
ITPR2_P804_F 4504792            ITPR2
                        NM_002223.1       3709     12   36.1   26878202      -804
ITPR3_E86_R   4504794           ITPR3
                        NM_002224.1       3710      6   36.1   33697408        86
ITPR3_P1112_F 4504794           ITPR3
                        NM_002224.1       3710      6   36.1   33696210     -1112
JAG1_P66_F    4557678           JAG1
                        NM_000214.1        182     20   36.1   10602656       -66
JAG2_E54_F   21704278           JAG2
                        NM_145159.1       3714     14   36.1   1.05E+08        54
JAG2_P264_F 21704278            JAG2
                        NM_145159.1       3714     14   36.1   1.05E+08      -264
JAK2_P772_R 13325062            JAK2
                        NM_004972.2       3717      9   36.1    4974473      -772
JAK3_E64_F   47157314           JAK3
                        NM_000215.2       3718     19   36.1   17819736        64
JAK3_P1075_R 47157314           JAK3
                        NM_000215.2       3718     19   36.1   17820875     -1075
JAK3_P156_R 47157314            JAK3
                        NM_000215.2       3718     19   36.1   17819956      -156
JUNB_P1149_R 44921611           JUNB
                        NM_002229.2       3726     19   36.1   12762161     -1149
KCNK4_E3_F 15718764             KCNK4
                        NM_016611.2      50801     11   36.1   63815454         3
KCNK4_P171_R 15718764            KCNK4
                         NM_016611.2        50801     11   36.1   63815280    -171
KCNQ1_E349_R32479522             KCNQ1
                         NM_181797.1         3784     11   36.1    2423146     349
KCNQ1_P546_R32479522             KCNQ1
                         NM_181797.1         3784     11   36.1    2422251    -546
KDR_E79_F    11321596            KDR
                         NM_002253.1         3791      4   36.1   55686440      79
KDR_P445_R 11321596              KDR
                         NM_002253.1         3791      4   36.1   55686964    -445
             20302136
KIAA0125_E29_F                   KIAA0125
                         NM_014792.2         9834     14   36.1   1.05E+08      29
             24308329
KIAA1804_P689_R                  KIAA1804
                         NM_032435.1        84451      1   36.1   2.32E+08    -689
KIT_P367_R     4557694           KIT
                         NM_000222.1         3815      4   36.1   55218551    -367
KIT_P405_F     4557694           KIT
                         NM_000222.1         3815      4   36.1   55218513    -405
KLF5_E190_R 52630441             KLF5
                         NM_001730.3          688     13   36.1   72531333     190
KLF5_P13_F   52630441            KLF5
                         NM_001730.3          688     13   36.1   72531130     -13
KLK10_P268_R 22208981            KLK10
                         NM_002776.3         5655     19   36.1   56215362    -268
KLK11_P103_R 21618356            KLK11
                         NM_144947.1        11012     19   36.1   56223205    -103
KLK11_P1290_F21618356            KLK11
                         NM_144947.1        11012     19   36.1   56224392   -1290
KRAS_E82_F 34485724              KRAS
                         NM_033360.2         3845     12   36.1   25295039      82
KRAS_P651_F 34485724             KRAS
                         NM_033360.2         3845     12   36.1   25295772    -651
KRT1_P798_R 17318568             KRT1
                         NM_006121.2         3848     12   36.1   51361244    -798
KRT13_P341_R 24234693            KRT13
                         NM_002274.2         3860     17   36.1   36915732    -341
KRT13_P676_F 24234693            KRT13
                         NM_002274.2         3860     17   36.1   36916067    -676
KRT5_E196_R 17318577             KRT5
                         NM_000424.2         3852     12   36.1   51200314     196
KRT5_P308_F 17318577             KRT5
                         NM_000424.2         3852     12   36.1   51200818    -308
L1CAM_P148_R 13435352            L1CAM
                         NM_024003.1         3897 X        36.1   1.53E+08    -148
L1CAM_P19_F 13435352             L1CAM
                         NM_024003.1         3897 X        36.1   1.53E+08     -19
LAMB1_E144_R 4504950             LAMB1
                         NM_002291.1         3912      7   36.1   1.07E+08     144
LAMC1_E466_R 9845497             LAMC1
                         NM_002293.2         3915      1   36.1   1.81E+08     466
LAMC1_P808_F 9845497             LAMC1
                         NM_002293.2         3915      1   36.1   1.81E+08    -808
LAT_E46_F    62739153            LAT
                         NM_014387.3        27040     16   36.1   28903694      46
LCK_E28_F    20428651            LCK
                         NM_005356.2         3932      1   36.1   32489548      28
LCN2_P141_R 38455401             LCN2
                         NM_005564.2         3934      9   36.1    1.3E+08    -141
LCN2_P86_R 38455401              LCN2
                         NM_005564.2         3934      9   36.1    1.3E+08     -86
LEFTY2_P561_F27436880            LEFTY2
                         NM_003240.2         7044      1   36.1   2.24E+08    -561
LEFTY2_P719_F27436880            LEFTY2
                         NM_003240.2         7044      1   36.1   2.24E+08    -719
LIF_E208_F     6006018           LIF
                         NM_002309.2         3976     22   36.1   28972540     208
LIF_P383_R     6006018           LIF
                         NM_002309.2         3976     22   36.1   28973131    -383
LIG3_P622_R 73747828             LIG3
                         NM_013975.2         3980     17   36.1   30331029    -622
LIG4_P194_F 46255050             LIG4
                         NM_002312.3         3981     13   36.1   1.08E+08    -194
LIMK1_P709_R 8051616             LIMK1
                         NM_002314.2         3984      7   36.1   73135383    -709
LMO1_E265_R 4505004              LMO1
                         NM_002315.1         4004     11   36.1    8241717     265
LMO1_P169_F 4505004              LMO1
                         NM_002315.1         4004     11   36.1    8242151    -169
LMO2_E148_F 6633806              LMO2
                         NM_005574.2         4005     11   36.1   33870264     148
LMO2_P794_R 6633806              LMO2
                         NM_005574.2         4005     11   36.1   33871206    -794
LMTK2_P1034_F38016936            LMTK2
                         NM_014916.2        22853      7   36.1   97573099   -1034
LOX_P313_R 21264603              LOX
                         NM_002317.3         4015      5   36.1   1.21E+08    -313
LOX_P71_F    21264603            LOX
                         NM_002317.3         4015      5   36.1   1.21E+08     -71
LRP2_E20_F     6806918           LRP2
                         NM_004525.1         4036      2   36.1    1.7E+08      20
LRRC32_E157_F 5031706            LRRC32
                         NM_005512.1         2615     11   36.1   76058386     157
LRRC32_P865_R 5031706            LRRC32
                         NM_005512.1         2615     11   36.1   76059408    -865
LRRK1_P39_F 33469142             LRRK1
                         NM_024652.2        79705     15   36.1   99380156     -39
LRRK1_P834_F 33469142            LRRK1
                         NM_024652.2        79705     15   36.1   99379361    -834
LTA_E28_R      6806892           LTA
                         NM_000595.2         4049      6   36.1   31648100      28
LTA_P214_R     6806892           LTA
                         NM_000595.2         4049      6   36.1   31647858    -214
LTB4R_E64_R 31881791             LTB4R
                         NM_181657.1         1241     14   36.1   23852421      64
LTB4R_P163_F 31881791            LTB4R
                        NM_181657.1         1241       14   36.1   23852194      -163
LY6G6E_P45_R 13236491            LY6G6E
                        NM_024123.1        79136        6   36.1   31789613     -1499
LYN_E353_F    4505054            LYN
                        NM_002350.1         4067        8   36.1   56955279       353
LYN_P241_F    4505054            LYN
                        NM_002350.1         4067        8   36.1   56954685      -241
MAD2L1_E93_F 6466452             MAD2L1
                        NM_002358.2         4085        4   36.1   1.21E+08      -213
MAF_E77_R    73427804            MAF
                        NM_005360.3         4094       16   36.1   78192035        77
MAF_P826_R 73427804              MAF
                        NM_005360.3         4094       16   36.1   78192938      -826
             2
MAGEA1_E113_R9029615             MAGEA1
                        NM_004988.3         4100   X        36.1   1.52E+08       113
             2
MAGEA1_P926_F9029615             MAGEA1
                        NM_004988.3         4100   X        36.1   1.52E+08      -926
             2
MAGEC3_E307_F0162567             MAGEC3
                        NM_138702.1       139081   X        36.1   1.41E+08       307
             2
MAGEC3_P903_F0162567             MAGEC3
                        NM_138702.1       139081   X        36.1   1.41E+08      -903
MAGEL2_E166_R18765721            MAGEL2
                        NM_019066.2        54551       15   36.1   21441916       166
MAGEL2_P170_R18765721            MAGEL2
                        NM_019066.2        54551       15   36.1   21442252      -170
MALT1_P406_R 27886564            MALT1
                        NM_006785.2        10892       18   36.1   54489192      -406
MAP2K6_E297_F14589899            MAP2K6
                        NM_002758.2         5608       17   36.1   64922731       297
MAP2K6_P297_R14589899            MAP2K6
                        NM_002758.2         5608       17   36.1   64922137      -297
MAP3K1_E81_F 88983555            MAP3K1
                        XM_042066.10        4214        5   36.1   56146103        81
MAP3K1_P7_F 88983555             MAP3K1
                        XM_042066.10        4214        5   36.1   56146015        -7
             22035597
MAP3K8_P1036_F                   MAP3K8
                        NM_005204.2         1326       10   36.1   30761836     -1036
MAP3K9_E17_R52421789             MAP3K9
                        NM_033141.2         4293       14   36.1   70345624        17
MAPK10_E26_F 20986509            MAPK10
                        NM_138982.1         5602        4   36.1   87593281        26
MAPK12_E165_R48255969            MAPK12
                        NM_002969.3         6300       22   36.1   49042051       165
MAPK12_P416_F48255969            MAPK12
                        NM_002969.3         6300       22   36.1   49042632      -416
MAPK14_P327_R20986513            MAPK14
                        NM_139013.1         1432        6   36.1   36103224      -327
MAPK4_E273_R 6715608             MAPK4
                        NM_002747.2         5596       18   36.1   46444109       273
MAPK9_P1175_F21237744            MAPK9
                        NM_139070.1         5601        5   36.1    1.8E+08     -1175
MAS1_P469_R 6006022              MAS1
                        NM_002377.2         4142        6   36.1    1.6E+08      -469
MAS1_P657_R 6006022              MAS1
                        NM_002377.2         4142        6   36.1    1.6E+08      -657
MATK_P190_R 21450845             MATK
                        NM_139355.1         4145       19   36.1    3753000      -190
MATK_P64_F 21450845              MATK
                        NM_139355.1         4145       19   36.1    3752874       -64
MBD2_P233_F 21464121             MBD2
                        NM_003927.3         8932       18   36.1   50005389      -233
MC2R_E455_F 66346710             MC2R
                        NM_000529.2         4158       18   36.1   13905080       455
MC2R_P1025_F 66346710            MC2R
                        NM_000529.2         4158       18   36.1   13906560     -1025
MCAM_P169_R 71274106             MCAM
                        NM_006500.2         4162       11   36.1   1.19E+08      -169
MCAM_P265_R 71274106             MCAM
                        NM_006500.2         4162       11   36.1   1.19E+08      -265
MCC_E23_R     4505128            MCC
                        NM_002387.1         4163        5   36.1   1.13E+08        23
MCC_P196_R    4505128            MCC
                        NM_002387.1         4163        5   36.1   1.13E+08      -196
MCF2_E195_F 19923309             MCF2
                        NM_005369.2         4168   X        36.1   1.39E+08       195
MCF2_P1024_R 19923309            MCF2
                        NM_005369.2         4168   X        36.1   1.39E+08     -1024
MCF2_P445_F 19923309             MCF2
                        NM_005369.2         4168   X        36.1   1.39E+08      -445
MCM2_P241_R 33356546             MCM2
                        NM_004526.2         4171       3    36.1   1.29E+08      -241
MCM2_P260_F 33356546             MCM2
                        NM_004526.2         4171       3    36.1   1.29E+08      -260
MCM6_E136_F 33469920             MCM6
                        NM_005915.4         4175       2    36.1   1.36E+08       136
             42741658
MDR1_seq_42_S300_R               ABCB1
                        NM_000927.3         5243       7    36.1   87068270 .
MDS1_E45_F    4826827            MDS1
                        NM_004991.1         4197       3    36.1   1.71E+08        45
MECP2_E90_R 7710148              MECP2
                        NM_004992.2         4204   X        36.1   1.53E+08        90
MECP2_P398_R 7710148             MECP2
                        NM_004992.2         4204   X        36.1   1.53E+08      -398
MEG3_E91_F 89037804              MEG3
                        XR_001355.1        55384       14   36.1      1E+08        91
MEG3_P235_F 89037804             MEG3
                        XR_001355.1        55384       14   36.1      1E+08      -235
MEST_E150_F 29294638             MEST
                        NM_002402.2         4232        7   36.1    1.3E+08       150
MEST_P4_F    29294638            MEST
                        NM_002402.2         4232        7   36.1    1.3E+08        -4
MEST_P62_R 29294638              MEST
                        NM_002402.2         4232        7   36.1    1.3E+08       -62
MET_E333_F 42741654             MET
                        NM_000245.2          4233        7   36.1   1.16E+08       333
MFAP4_P10_R 23111004            MFAP4
                        NM_002404.1          4239       17   36.1   19231096       -10
MFAP4_P197_F 23111004           MFAP4
                        NM_002404.1          4239       17   36.1   19231283      -197
MGMT_P272_R 49574515            MGMT
                        NM_002412.2          4255       10   36.1   1.31E+08      -272
MGMT_P281_F 49574515            MGMT
                        NM_002412.2          4255       10   36.1   1.31E+08      -281
MKRN3_E144_F74272285            MKRN3
                        NM_005664.2          7681       15   36.1   21361691       144
MKRN3_P108_F74272285            MKRN3
                        NM_005664.2          7681       15   36.1   21361439      -108
MKRN4_E249_R.           .       MKRN4   .           X        36.1   40578589       249
            .
MKRN4_P1320_R           .       MKRN4   .           X        36.1   40577020     -1320
MLF1_E243_F 33636694            MLF1
                        NM_022443.2          4291        3   36.1    1.6E+08       243
MLF1_P97_F   33636694           MLF1
                        NM_022443.2          4291        3   36.1    1.6E+08       -97
MLH1_P381_F 28559089            MLH1
                        NM_000249.2          4292        3   36.1   37009602       197
MLH3_E72_F    7657336           MLH3
                        NM_014381.1         27030       14   36.1   74587814        72
MLH3_P25_F    7657336           MLH3
                        NM_014381.1         27030       14   36.1   74587911       -25
MLLT3_E93_R 4758719             MLLT3
                        NM_004529.1          4300        9   36.1   20612357        93
MLLT4_P1400_F 5174574           MLLT4
                        NM_005936.1          4301        6   36.1   1.68E+08     -1400
MLLT6_P957_F 57222567           MLLT6
                        NM_005937.2          4302       17   36.1   34114444      -957
MME_E29_F     6042205           MME
                        NM_000902.2          4311        3   36.1   1.56E+08        29
MME_P388_F    6042205           MME
                        NM_000902.2          4311        3   36.1   1.56E+08      -388
MMP1_P397_R 13027798            MMP1
                        NM_002421.2          4312       11   36.1   1.02E+08      -397
MMP1_P460_F 13027798            MMP1
                        NM_002421.2          4312       11   36.1   1.02E+08      -460
MMP10_E136_R 4505204            MMP10
                        NM_002425.1          4319       11   36.1   1.02E+08       136
MMP14_P13_F 13027797            MMP14
                        NM_004995.2          4323       14   36.1   22375620       -13
MMP14_P208_R13027797            MMP14
                        NM_004995.2          4323       14   36.1   22375425      -208
MMP19_E274_R89036201            MMP19
                        XM_938761.1          4327       12   36.1   54522728       274
MMP19_P306_F 89036201           MMP19
                        XM_938761.1          4327       12   36.1   54523308      -306
MMP2_E21_R 75905807             MMP2
                        NM_004530.2          4313       16   36.1   54070610        21
MMP2_P197_F 75905807            MMP2
                        NM_004530.2          4313       16   36.1   54070392      -197
MMP2_P303_R 75905807            MMP2
                        NM_004530.2          4313       16   36.1   54070286      -303
MMP3_P16_R 73808272             MMP3
                        NM_002422.3          4314       11   36.1   1.02E+08       -16
MMP3_P55_F 73808272             MMP3
                        NM_002422.3          4314       11   36.1   1.02E+08       -55
MMP7_E59_F 75709180             MMP7
                        NM_002423.3          4316       11   36.1   1.02E+08        59
MMP7_P613_F 75709180            MMP7
                        NM_002423.3          4316       11   36.1   1.02E+08      -613
MMP8_E89_R    4505220           MMP8
                        NM_002424.1          4317       11   36.1   1.02E+08        89
MMP9_E88_R 74272286             MMP9
                        NM_004994.2          4318       20   36.1   44071042        88
MMP9_P189_F 74272286            MMP9
                        NM_004994.2          4318       20   36.1   44070765      -189
MMP9_P237_R 74272286            MMP9
                        NM_004994.2          4318       20   36.1   44070717      -237
MOS_E60_R     4885488           MOS
                        NM_005372.1          4342        8   36.1   57189035        60
MOS_P27_R     4885488           MOS
                        NM_005372.1          4342        8   36.1   57189122       -27
MOS_P746_F    4885488           MOS
                        NM_005372.1          4342        8   36.1   57189841      -746
MPL_P62_F     4885490           MPL
                        NM_005373.1          4352        1   36.1   43576000       -62
MPL_P657_F    4885490           MPL
                        NM_005373.1          4352        1   36.1   43575405      -657
MPO_E302_R    4557758           MPO
                        NM_000250.1          4353       17   36.1   53712993       302
MPO_P883_R    4557758           MPO
                        NM_000250.1          4353       17   36.1   53714178      -883
MSH2_P1008_F 4557760            MSH2
                        NM_000251.1          4436        2   36.1   47482759     -1008
MSH3_E3_F    68303634           MSH3
                        NM_002439.2          4437        5   36.1   79986053         3
MSH3_P13_R 68303634             MSH3
                        NM_002439.2          4437        5   36.1   79986037       -13
             63025195
MSSK1_seq_27_S45_F              SRPK3
                        NM_014370.2         26576 X          36.1   1.53E+08 .
MST1R_E42_R 4505264             MST1R
                        NM_002447.1          4486        3   36.1   49916032        42
MST1R_P392_F 4505264            MST1R
                        NM_002447.1          4486        3   36.1   49916466      -392
MST1R_P87_R 4505264             MST1R
                        NM_002447.1          4486        3   36.1   49916161       -87
MT1A_E13_R 71274112             MT1A
                        NM_005946.2          4489       16   36.1   55230092        13
MT1A_P49_R 71274112             MT1A
                        NM_005946.2        4489        16   36.1   55230030     -49
MT1A_P600_F 71274112            MT1A
                        NM_005946.2        4489        16   36.1   55229479    -600
MTA1_P478_F 14141149            MTA1
                        NM_004689.2        9112        14   36.1   1.05E+08    -478
MUC1_E18_R 65301116             MUC1
                        NM_002456.4        4582         1   36.1   1.53E+08      18
MUC1_P191_F 65301116            MUC1
                        NM_002456.4        4582         1   36.1   1.53E+08    -191
MUSK_P308_F 5031926             MUSK
                        NM_005592.1        4593         9   36.1   1.12E+08    -308
MXI1_P1269_F 57242781           MXI1
                        NM_005962.4        4601        10   36.1   1.12E+08   -1269
MXI1_P75_R   57242781           MXI1
                        NM_005962.4        4601        10   36.1   1.12E+08     -75
MYB_P673_R 46361979             MYB
                        NM_005375.2        4602         6   36.1   1.36E+08    -673
MYBL2_P211_F 31652260           MYBL2
                        NM_002466.2        4605        20   36.1   41728912    -211
MYBL2_P354_F 31652260           MYBL2
                        NM_002466.2        4605        20   36.1   41728769    -354
MYCL1_P502_R 74315994           MYCL1
                        NM_001033081.1     4610         1   36.1   40140776    -502
MYCL2_E44_R .           .       MYCL2  .           X        36.1   1.06E+08      44
MYCL2_P19_F .           .       MYCL2  .           X        36.1   1.06E+08     -19
MYCN_E77_R 62750358             MYCN
                        NM_005378.4         4613        2   36.1   15998211      77
MYCN_P464_R 62750358            MYCN
                        NM_005378.4         4613        2   36.1   15997670    -464
MYH11_P22_F 13124874            MYH11
                        NM_022844.1         4629       16   36.1   15858391     -22
MYH11_P236_R 13124874           MYH11
                        NM_022844.1         4629       16   36.1   15858605    -236
MYLK_E132_R 47132560            MYLK
                        NM_053025.2         4638        3   36.1   1.25E+08     132
MYLK_P469_R 47132560            MYLK
                        NM_053025.2         4638        3   36.1   1.25E+08    -469
MYOD1_E156_F23111008            MYOD1
                        NM_002478.3         4654       11   36.1   17697891     156
MYOD1_P50_F 23111008            MYOD1
                        NM_002478.3         4654       11   36.1   17697685     -50
NAT2_P11_F    4557782           NAT2
                        NM_000015.1           10        8   36.1   18293024     -11
NBL1_E205_R 33519445            NBL1
                        NM_005380.3         4681        1   36.1   19842518     205
NBL1_P24_F   33519445           NBL1
                        NM_005380.3         4681        1   36.1   19842289     -24
NCL_P1102_F 55956787            NCL
                        NM_005381.2         4691        2   36.1   2.32E+08   -1102
NCL_P840_R 55956787             NCL
                        NM_005381.2         4691        2   36.1   2.32E+08    -840
NDN_E131_R 10800414             NDN
                        NM_002487.2         4692       15   36.1   21483412     131
NDN_P1110_F 10800414            NDN
                        NM_002487.2         4692       15   36.1   21484653   -1110
NEFL_E23_R    5453761           NEFL
                        NM_006158.1         4747        8   36.1   24869923      23
NEFL_P209_R 5453761             NEFL
                        NM_006158.1         4747        8   36.1   24870155    -209
NEO1_P1067_F 4505374            NEO1
                        NM_002499.1         4756       15   36.1   71130861   -1067
NES_P239_R 38176299             NES
                        NM_006617.1        10763        1   36.1   1.55E+08    -239
NEU1_P745_F 40806202            NEU1
                        NM_000434.2         4758        6   36.1   31939407    -745
NFKB1_P336_R 34577121           NFKB1
                        NM_003998.2         4790        4   36.1   1.04E+08    -336
NFKB1_P496_F 34577121           NFKB1
                        NM_003998.2         4790        4   36.1   1.04E+08    -496
NFKB2_P709_R 19923222           NFKB2
                        NM_002502.2         4791       10   36.1   1.04E+08    -709
NGFB_E353_F 70995318            NGFB
                        NM_002506.2         4803        1   36.1   1.16E+08     353
NGFB_P13_F 70995318             NGFB
                        NM_002506.2         4803        1   36.1   1.16E+08     -13
NGFR_E328_F 4505392             NGFR
                        NM_002507.1         4804       17   36.1   44927994     328
NGFR_P355_F 4505392             NGFR
                        NM_002507.1         4804       17   36.1   44927311    -355
NID1_P677_F   4505394           NID1
                        NM_002508.1         4811        1   36.1   2.34E+08    -677
NID1_P714_R   4505394           NID1
                        NM_002508.1         4811        1   36.1   2.34E+08    -714
NKX3-1_P146_F19923351           NKX3-1
                        NM_006167.2         4824        8   36.1   23596541    -146
NKX3-1_P871_R19923351           NKX3-1
                        NM_006167.2         4824        8   36.1   23597266    -871
NNAT_P544_R 32307135            NNAT
                        NM_181689.1         4826       20   36.1   35582477    -544
NOS2A_E117_R24041028            NOS2A
                        NM_000625.3         4843       17   36.1   23151565     117
NOS2A_P288_R24041028            NOS2A
                        NM_000625.3         4843       17   36.1   23151970    -288
NOS3_P38_F 48762674             NOS3
                        NM_000603.3         4846        7   36.1    1.5E+08     -38
             2
NOTCH1_E452_R7894367            NOTCH1
                        NM_017617.2         4851        9   36.1   1.39E+08     452
             27894367
NOTCH1_P1198_F                  NOTCH1
                        NM_017617.2         4851        9   36.1   1.39E+08   -1198
             2
NOTCH2_P312_R4041034            NOTCH2
                        NM_024408.2         4853        1   36.1    1.2E+08    -312
NOTCH3_E403_F4557798             NOTCH3
                         NM_000435.1          4854     19   36.1   15172389       403
NOTCH3_P198_R4557798             NOTCH3
                         NM_000435.1          4854     19   36.1   15172990      -198
NOTCH4_E4_F 55770875             NOTCH4
                         NM_004557.3          4855      6   36.1   32299818         4
              5
NOTCH4_P938_F5770875             NOTCH4
                         NM_004557.3          4855      6   36.1   32300760      -938
NPR2_P1093_F 73915098            NPR2
                         NM_003995.3          4882      9   36.1   35781313     -1093
NPR2_P618_F 73915098             NPR2
                         NM_003995.3          4882      9   36.1   35781788      -618
NPY_E31_R     31542152           NPY
                         NM_000905.2          4852      7   36.1   24290365        31
NPY_P295_F    31542152           NPY
                         NM_000905.2          4852      7   36.1   24290039      -295
NPY_P91_F     31542152           NPY
                         NM_000905.2          4852      7   36.1   24290243       -91
NQO1_E74_R 70995421              NQO1
                         NM_001025434.1       1728     16   36.1   68317960        74
NQO1_P345_R 70995421             NQO1
                         NM_001025434.1       1728     16   36.1   68318379      -345
NR2F6_E375_R 46411186            NR2F6
                         NM_005234.3          2063     19   36.1   17216776       375
NRAS_P103_R 6006027              NRAS
                         NM_002524.2          4893      1   36.1   1.15E+08      -103
NRAS_P12_R     6006027           NRAS
                         NM_002524.2          4893      1   36.1   1.15E+08       -12
NRG1_E74_F     7669515           NRG1
                         NM_013958.1          3084      8   36.1   32525369        74
NRG1_P558_R 7669515              NRG1
                         NM_013958.1          3084      8   36.1   32524737      -558
NTRK1_E74_F 56118209             NTRK1
                         NM_001007792.1       4914      1   36.1   1.55E+08        74
NTRK2_P10_F 65506778             NTRK2
                         NM_001018066.1       4915      9   36.1   86473276      -271
NTRK2_P395_R 65506778            NTRK2
                         NM_001018066.1       4915      9   36.1   86472891      -656
NTRK3_E131_F 59889559            NTRK3
                         NM_002530.2          4916     15   36.1   86600534       131
NTRK3_P636_R 59889559            NTRK3
                         NM_002530.2          4916     15   36.1   86601301      -636
NTRK3_P752_F 59889559            NTRK3
                         NM_002530.2          4916     15   36.1   86601417      -752
NTSR1_E109_F 4505476             NTSR1
                         NM_002531.1          4923     20   36.1   60810743       109
NTSR1_P318_F 4505476             NTSR1
                         NM_002531.1          4923     20   36.1   60810316      -318
OAT_P465_F     4557808           OAT
                         NM_000274.1          4942     10   36.1   1.26E+08      -465
ODC1_P424_F 4505488              ODC1
                         NM_002539.1          4953      2   36.1   10506328      -424
OGG1_E400_F 8670539              OGG1
                         NM_016828.1          4968      3   36.1    9766105       400
ONECUT2_E96_F4758847             ONECUT2
                         NM_004852.1          9480     18   36.1   53254011        96
ONECUT2_P315_R 4758847           ONECUT2
                         NM_004852.1          9480     18   36.1   53253600      -315
OPCML_E219_R59939898             OPCML
                         NM_002545.3          4978     11   36.1   1.33E+08       219
OPCML_P71_F 59939898             OPCML
                         NM_002545.3          4978     11   36.1   1.33E+08       -71
OSM_P188_F 28178862              OSM
                         NM_020530.3          5008     22   36.1   28993028      -188
OSM_P34_F     28178862           OSM
                         NM_020530.3          5008     22   36.1   28992874       -34
              47132605
p16_seq_47_S188_R                CDKN2A
                         NM_058195.2          1029      9   36.1   21964709 .
              47132605
p16_seq_47_S85_F                 CDKN2A
                         NM_058195.2          1029      9   36.1   21964812 .
P2RX7_E323_R 34335274            P2RX7
                         NM_177427.2          5027     12   36.1    1.2E+08       323
P2RX7_P119_R 34335274            P2RX7
                         NM_177427.2          5027     12   36.1    1.2E+08      -119
P2RX7_P597_F 34335274            P2RX7
                         NM_177427.2          5027     12   36.1    1.2E+08      -597
PADI4_E24_F    6912575           PADI4
                         NM_012387.1         23569      1   36.1   17507303        24
PADI4_P1011_R 6912575            PADI4
                         NM_012387.1         23569      1   36.1   17506268     -1011
PADI4_P1158_R 6912575            PADI4
                         NM_012387.1         23569      1   36.1   17506121     -1158
              22325355
PALM2-AKAP2_P183_R       NM_147150.1
                                 PALM2-AKAP2
                                           445815       9   36.1   1.12E+08      -313
              22325355
PALM2-AKAP2_P420_R       NM_147150.1
                                 PALM2-AKAP2
                                           445815       9   36.1   1.12E+08      -550
PARP1_P610_R 11496989            PARP1
                         NM_001618.2           142      1   36.1   2.25E+08      -610
PAX6_E129_F 71482587             PAX6
                         NM_001604.3          5080     11   36.1   31789326       129
PAX6_P1121_F 71482587            PAX6
                         NM_001604.3          5080     11   36.1   31790576     -1121
PAX6_P50_R 71482587              PAX6
                         NM_001604.3          5080     11   36.1   31789505       -50
PCDH1_E22_F 27754772             PCDH1
                         NM_032420.2          5097      5   36.1   1.41E+08        22
PCDH1_P264_F 27754772            PCDH1
                         NM_032420.2          5097      5   36.1   1.41E+08      -264
PCGF4_P760_R 39725706            PCGF4
                         NM_005180.5           648     10   36.1   22649386      -760
PCGF4_P92_R 39725706             PCGF4
                         NM_005180.5           648     10   36.1   22650054       -92
PCTK1_E77_R 53729342             PCTK1
                         NM_006201.3          5127 X        36.1   46962653        77
PDE1B_E141_F 24431942            PDE1B
                         NM_000924.2        5153     12   36.1   53229812     141
PDE1B_P263_R 24431942            PDE1B
                         NM_000924.2        5153     12   36.1   53229408    -263
PDGFA_P78_F 89024648             PDGFA
                         XM_926001.1        5154      7   36.1     525644     -78
PDGFA_P841_R89024648             PDGFA
                         XM_926001.1        5154      7   36.1     526407    -841
PDGFB_E25_R 4505680              PDGFB
                         NM_002608.1        5155     22   36.1   37970911      25
PDGFB_P719_F 4505680             PDGFB
                         NM_002608.1        5155     22   36.1   37971655    -719
              6
PDGFRA_E125_F1699224             PDGFRA
                         NM_006206.3        5156      4   36.1   54790329     125
PDGFRA_P1429_F61699224           PDGFRA
                         NM_006206.3        5156      4   36.1   54788775   -1429
              6
PDGFRB_E195_R8216043             PDGFRB
                         NM_002609.3        5159      5   36.1    1.5E+08     195
              6
PDGFRB_P273_F8216043             PDGFRB
                         NM_002609.3        5159      5   36.1    1.5E+08    -273
              6
PDGFRB_P343_F8216043             PDGFRB
                         NM_002609.3        5159      5   36.1    1.5E+08    -343
PECAM1_E32_R21314616             PECAM1
                         NM_000442.2        5175     17   36.1   59817691      32
              2
PECAM1_P135_F1314616             PECAM1
                         NM_000442.2        5175     17   36.1   59817858    -135
PEG10_P978_R 89026228            PEG10
                         XM_940371.1       23089      7   36.1   94122646    -978
PEG3_E496_F 33354284             PEG3
                         NM_006210.1        5178     19   36.1   62043380     496
PENK_E26_F 40254835              PENK
                         NM_006211.2        5179      8   36.1   57521117      26
PENK_P447_R 40254835             PENK
                         NM_006211.2        5179      8   36.1   57521590    -447
PGF_E33_F     56676307           PGF
                         NM_002632.4        5228     14   36.1   74492011      33
PGF_P320_F    56676307           PGF
                         NM_002632.4        5228     14   36.1   74492364    -320
PGR_E183_R 31981491              PGR
                         NM_000926.2        5241     11   36.1   1.01E+08     183
PGR_P456_R 31981491              PGR
                         NM_000926.2        5241     11   36.1   1.01E+08    -456
PGR_P790_F 31981491              PGR
                         NM_000926.2        5241     11   36.1   1.01E+08    -790
PHLDA2_E159_R 57863296           PHLDA2
                         NM_003311.3        7262     11   36.1    2907067     159
PHLDA2_P622_F 57863296           PHLDA2
                         NM_003311.3        7262     11   36.1    2907848    -622
PI3_E107_F    31657130           PI3
                         NM_002638.2        5266     20   36.1   43237019     107
PI3_P1394_R 31657130             PI3
                         NM_002638.2        5266     20   36.1   43235518   -1394
PI3_P274_R    31657130           PI3
                         NM_002638.2        5266     20   36.1   43236638    -274
PIK3R1_P307_F 32455249           PIK3R1
                         NM_181524.1        5295      5   36.1   67557911    -307
PITX2_E24_R 40316913             PITX2
                         NM_000325.4        5308      4   36.1   1.12E+08      24
PITX2_P183_R 40316913            PITX2
                         NM_000325.4        5308      4   36.1   1.12E+08    -183
PKD2_P287_R 33286447             PKD2
                         NM_000297.2        5311      4   36.1   89147557    -287
PKD2_P336_R 33286447             PKD2
                         NM_000297.2        5311      4   36.1   89147508    -336
PLA2G2A_E268_F20149501           PLA2G2A
                         NM_000300.2        5320      1   36.1   20179228     268
PLA2G2A_P528_F20149501           PLA2G2A
                         NM_000300.2        5320      1   36.1   20180024    -528
PLAGL1_E68_R 37622889            PLAGL1
                         NM_002656.2        5325      6   36.1   1.44E+08     -92
PLAGL1_P236_R 37622889           PLAGL1
                         NM_002656.2        5325      6   36.1   1.44E+08    -236
PLAGL1_P334_F37622889            PLAGL1
                         NM_002656.2        5325      6   36.1   1.44E+08    -334
PLAT_E158_F 14702166             PLAT
                         NM_000931.2        5327      8   36.1   42184193     158
PLAT_P80_F    14702166           PLAT
                         NM_000931.2        5327      8   36.1   42184431     -80
PLAU_P11_F    53729348           PLAU
                         NM_002658.2        5328     10   36.1   75340885     -11
PLAU_P176_R 53729348             PLAU
                         NM_002658.2        5328     10   36.1   75340720    -176
PLAUR_E123_F 53829380            PLAUR
                         NM_001005377.1     5329     19   36.1   48866219     123
PLAUR_P82_F 53829380             PLAUR
                         NM_001005377.1     5329     19   36.1   48866424     -82
PLG_E406_F     4505880           PLG
                         NM_000301.1        5340      6   36.1   1.61E+08     406
PLG_P370_F     4505880           PLG
                         NM_000301.1        5340      6   36.1   1.61E+08    -370
PLS3_E70_F    28416938           PLS3
                         NM_005032.3        5358 X        36.1   1.15E+08      70
PLS3_P94_R    28416938           PLS3
                         NM_005032.3        5358 X        36.1   1.15E+08     -94
PLSCR3_P751_R 31543416           PLSCR3
                         NM_020360.2       57048     17   36.1    7239318    -751
PLXDC1_E71_F 21361852            PLXDC1
                         NM_020405.3       57125     17   36.1   34561227      71
PLXDC1_P236_F 21361852           PLXDC1
                         NM_020405.3       57125     17   36.1   34561534    -236
PLXDC2_E337_F 40255004           PLXDC2
                         NM_032812.7       84898     10   36.1   20145715     337
PLXDC2_P914_R 40255004           PLXDC2
                         NM_032812.7       84898     10   36.1   20144464    -914
PMP22_P1254_F24430161           PMP22
                        NM_000304.2         5376   17   36.1   15110623     -1254
PMP22_P975_F 24430161           PMP22
                        NM_000304.2         5376   17   36.1   15110344      -975
PODXL_P1341_R66277201           PODXL
                        NM_001018111.1      5420    7   36.1   1.31E+08     -1341
POMC_E254_F 4505948             POMC
                        NM_000939.1         5443    2   36.1   25244702       254
POMC_P400_R 4505948             POMC
                        NM_000939.1         5443    2   36.1   25245356      -400
POMC_P53_F    4505948           POMC
                        NM_000939.1         5443    2   36.1   25245009       -53
PPARD_P846_F 29171748           PPARD
                        NM_006238.2         5467    6   36.1   35417518      -846
PPARG_E178_R62865855            PPARG
                        NM_005037.4         5468    3   36.1   12304537       178
PPARG_P693_F62865855            PPARG
                        NM_005037.4         5468    3   36.1   12303666      -693
PPAT_E170_R 29570797            PPAT
                        NM_002703.3         5471    4   36.1   56996432      -266
             32455243
PPP2R1B_P268_R                  PPP2R1B
                        NM_181699.1         5519   11   36.1   1.11E+08      -268
PRDM2_P1340_R55953109           PRDM2
                        NM_001007257.1      7799    1   36.1   13902597     -1340
             47132582
PRKAR1A_P337_R                  PRKAR1A
                        NM_212472.1         5573   17   36.1   64019368      -337
             47132586
PRKCDBP_E206_F                  PRKCDBP
                        NM_145040.2       112464   11   36.1    6298110       206
             47132586
PRKCDBP_P352_R                  PRKCDBP
                        NM_145040.2       112464   11   36.1    6298668      -352
PROK2_E0_F 24475653             PROK2
                        NM_021935.2        60675    3   36.1   71916902         0
PROK2_P390_F 24475653           PROK2
                        NM_021935.2        60675    3   36.1   71917292      -390
PROM1_P44_R 5174386             PROM1
                        NM_006017.1         8842    4   36.1   15686708       -44
PRSS1_E45_R 21071011            PRSS1
                        NM_002769.2         5644    7   36.1   1.42E+08        45
PRSS1_P1249_R21071011           PRSS1
                        NM_002769.2         5644    7   36.1   1.42E+08     -1249
PRSS8_E134_R 21536453           PRSS8
                        NM_002773.2         5652   16   36.1   31054518       134
PSCA_E359_F 29893565            PSCA
                        NM_005672.2         8000    8   36.1   1.44E+08       359
PSCA_P135_F 29893565            PSCA
                        NM_005672.2         8000    8   36.1   1.44E+08      -135
PSIP1_P163_R 19923652           PSIP1
                        NM_033222.2        11168    9   36.1   15501145      -163
PTCH_E42_F 25121959             PTCH
                        NM_000264.2         5727    9   36.1   97310610        42
PTCH2_E173_F 52145304           PTCH2
                        NM_003738.3         8643    1   36.1   45081030       173
PTCH2_P37_F 52145304            PTCH2
                        NM_003738.3         8643    1   36.1   45081240       -37
PTCH2_P568_R 52145304           PTCH2
                        NM_003738.3         8643    1   36.1   45081771      -568
PTEN_P438_F 73765543            PTEN
                        NM_000314.3         5728   10   36.1   89612737      -438
PTGS1_E80_F 18104966            PTGS1
                        NM_000962.2         5742    9   36.1   1.24E+08        80
PTGS1_P2_F 18104966             PTGS1
                        NM_000962.2         5742    9   36.1   1.24E+08        -2
PTGS2_P308_F 4506264            PTGS2
                        NM_000963.1         5743    1   36.1   1.85E+08      -308
PTGS2_P524_R 4506264            PTGS2
                        NM_000963.1         5743    1   36.1   1.85E+08      -524
PTHLH_E251_F 39995088           PTHLH
                        NM_198964.1         5744   12   36.1   28015932       251
PTHLH_P15_R 39995088            PTHLH
                        NM_198964.1         5744   12   36.1   28016198       -15
PTHLH_P757_F 39995088           PTHLH
                        NM_198964.1         5744   12   36.1   28016940      -757
PTHR1_E36_R 39995096            PTHR1
                        NM_000316.2         5745    3   36.1   46894276        36
PTHR1_P170_R 39995096           PTHR1
                        NM_000316.2         5745    3   36.1   46894070      -170
PTHR1_P258_F 39995096           PTHR1
                        NM_000316.2         5745    3   36.1   46893982      -258
PTK2_P735_R 27886592            PTK2
                        NM_005607.3         5747    8   36.1   1.42E+08      -735
PTK2B_P673_R 27886587           PTK2B
                        NM_173175.1         2185    8   36.1   27224243 .
PTK6_E50_F   27886594           PTK6
                        NM_005975.2         5753   20   36.1   61639101        50
PTK7_E317_F 27886610            PTK7
                        NM_002821.3         5754    6   36.1   43152324       317
PTPN6_E171_R 34328901           PTPN6
                        NM_080548.2         5777   12   36.1    6926172       171
PTPN6_P282_R 34328901           PTPN6
                        NM_080548.2         5777   12   36.1    6925719      -282
PTPNS1_E433_R18426910           PTPNS1
                        NM_080792.1       140885   20   36.1    1823858       433
PTPNS1_P301_R18426910           PTPNS1
                        NM_080792.1       140885   20   36.1    1823124      -301
PTPRF_E178_R 18860871           PTPRF
                        NM_002840.2         5792    1   36.1   43769312       178
PTPRG_E40_R 18860897            PTPRG
                        NM_002841.2         5793    3   36.1   61522325        40
PTPRG_P476_F 18860897           PTPRG
                        NM_002841.2         5793    3   36.1   61521809      -476
PTPRH_E173_F 67190343           PTPRH
                        NM_002842.2         5794   19   36.1   60412481       173
PTPRH_P255_F 67190343           PTPRH
                        NM_002842.2         5794   19   36.1   60412909      -255
PTPRO_E56_F 13677212             PTPRO
                        NM_002848.2         5800   12   36.1   15366810      56
PTPRO_P371_F 13677212            PTPRO
                        NM_002848.2         5800   12   36.1   15366383    -371
PURA_P928_R 62530389             PURA
                        NM_005859.3         5813    5   36.1   1.39E+08    -928
PWCR1_E81_R 29171309             PWCR1
                        NR_001290.1        63968   15   36.1   22847798      81
PWCR1_P357_F29171309             PWCR1
                        NR_001290.1        63968   15   36.1   22847360    -357
PWCR1_P811_F29171309             PWCR1
                        NR_001290.1        63968   15   36.1   22846906    -811
PXN_P308_F    4506344            PXN
                        NM_002859.1         5829   12   36.1   1.19E+08    -308
PYCARD_E87_F22035619             PYCARD
                        NM_145182.1        29108   16   36.1   31121665      87
             2
PYCARD_P150_F2035619             PYCARD
                        NM_145182.1        29108   16   36.1   31121902    -150
             2
PYCARD_P393_F2035619             PYCARD
                        NM_145182.1        29108   16   36.1   31122145    -393
RAB32_E314_R 20127508            RAB32
                        NM_006834.2        10981    6   36.1   1.47E+08     314
RAB32_P493_R 20127508            RAB32
                        NM_006834.2        10981    6   36.1   1.47E+08    -493
RAD50_P191_F 19924130            RAD50
                        NM_133482.1        10111    5   36.1   1.32E+08    -191
RAD54B_P227_F20143929            RAD54B
                        NM_134434.1        25788    8   36.1   95556713    -227
RAF1_P330_F 52486392             RAF1
                        NM_002880.2         5894    3   36.1   12681008    -330
RAN_P581_R    6042206            RAN
                        NM_006325.2         5901   12   36.1    1.3E+08    -581
RAP1A_P285_R 58331201            RAP1A
                        NM_001010935.1      5906    1   36.1   1.12E+08    -285
RARA_E128_R 75812906             RARA
                        NM_000964.2         5914   17   36.1   35719100     128
RARA_P1076_R 75812906            RARA
                        NM_000964.2         5914   17   36.1   35717896   -1076
RARA_P176_R 75812906             RARA
                        NM_000964.2         5914   17   36.1   35718796    -176
RARB_E114_F 14916495             RARB
                        NM_016152.2         5915    3   36.1   25444872     114
RARB_P60_F 14916495              RARB
                        NM_016152.2         5915    3   36.1   25444698     -60
             46255042
RARRES1_E235_F                   RARRES1
                        NM_206963.1         5918    3   36.1    1.6E+08     235
             46255042
RARRES1_P426_R                   RARRES1
                        NM_206963.1         5918    3   36.1    1.6E+08    -426
             4
RARRES1_P57_R6255042             RARRES1
                        NM_206963.1         5918    3   36.1    1.6E+08     -57
RASA1_E107_F 12545405            RASA1
                        NM_022650.1         5921    5   36.1   86600014     107
             2
RASGRF1_E16_F4797098             RASGRF1
                        NM_002891.3         5923   15   36.1   77169879      16
             24797098
RASGRF1_P768_F                   RASGRF1
                        NM_002891.3         5923   15   36.1   77170663    -768
RASSF1_E116_F25777679            RASSF1
                        NM_170712.1        11186    3   36.1   50353255     116
RASSF1_P244_F25777679            RASSF1
                        NM_170712.1        11186    3   36.1   50353615    -244
RBL2_P250_R 21361291             RBL2
                        NM_005611.2         5934   16   36.1   52025651    -250
RBP1_E158_F   8400726            RBP1
                        NM_002899.2         5947    3   36.1   1.41E+08     158
RBP1_P150_F   8400726            RBP1
                        NM_002899.2         5947    3   36.1   1.41E+08    -150
RBP1_P426_R 8400726              RBP1
                        NM_002899.2         5947    3   36.1   1.41E+08    -426
RET_P717_F   50593520            RET
                        NM_020630.3         5979   10   36.1   42891816    -717
             50593520
RET_seq_53_S374_F                RET
                        NM_020630.3         5979   10   36.1   42892087    -446
             50593520
RET_seq_54_S260_F                RET
                        NM_020630.3         5979   10   36.1   42892544      11
RHOC_P536_F 34222243             RHOC
                        NM_175744.3          389    1   36.1   1.13E+08    -536
RHOH_P121_F 45827772             RHOH
                        NM_004310.2          399    4   36.1   39874876    -121
RHOH_P953_R 45827772             RHOH
                        NM_004310.2          399    4   36.1   39874044    -953
RIPK1_P744_R 57242760            RIPK1
                        NM_003804.3         8737    6   36.1    3021313    -744
RIPK1_P868_F 57242760            RIPK1
                        NM_003804.3         8737    6   36.1    3021189    -868
RIPK2_E123_F 40255024            RIPK2
                        NM_003821.4         8767    8   36.1   90839296     123
RIPK3_P124_F 40254843            RIPK3
                        NM_006871.2        11035   14   36.1   23879137    -124
RIPK3_P24_F 40254843             RIPK3
                        NM_006871.2        11035   14   36.1   23879037     -24
RIPK4_E166_F 41327753            RIPK4
                        NM_020639.2        54101   21   36.1   42060152     166
RIPK4_P172_F 41327753            RIPK4
                        NM_020639.2        54101   21   36.1   42060490    -172
ROR1_P6_F     4826867            ROR1
                        NM_005012.1         4919    1   36.1   64012296      -6
ROR2_E112_F 19743897             ROR2
                        NM_004560.2         4920    9   36.1   93752153     112
ROR2_P317_R 19743897             ROR2
                        NM_004560.2         4920    9   36.1   93752582    -317
RRAS_P100_R 20127497             RRAS
                        NM_006270.2         6237   19   36.1   54835312    -100
             28329418
RUNX1T1_E145_R                   RUNX1T1
                        NM_175635.1          862    8   36.1   93176474     145
             28329418
RUNX1T1_P103_F                  RUNX1T1
                        NM_175635.1          862    8   36.1   93176722    -103
RUNX3_E27_R 72534651            RUNX3
                        NM_001031680.1       864    1   36.1   25164035      27
RUNX3_P247_F 72534651           RUNX3
                        NM_001031680.1       864    1   36.1   25164309    -247
RUNX3_P393_R72534651            RUNX3
                        NM_001031680.1       864    1   36.1   25164455    -393
RYK_P493_F   88971122           RYK
                        XM_940269.1         6259    3   36.1   1.35E+08    -493
              5
S100A12_P1221_R032058           S100A12
                        NM_005621.1         6283    1   36.1   1.52E+08   -1221
S100A2_E36_R 45269153           S100A2
                        NM_005978.3         6273    1   36.1   1.52E+08      36
             4
S100A2_P1186_F5269153           S100A2
                        NM_005978.3         6273    1   36.1   1.52E+08   -1186
S100A4_E315_F 9845515           S100A4
                        NM_019554.1         6275    1   36.1   1.52E+08     315
S100A4_P194_R 9845515           S100A4
                        NM_019554.1         6275    1   36.1   1.52E+08    -194
S100A4_P887_R 9845515           S100A4
                        NM_019554.1         6275    1   36.1   1.52E+08    -887
SCGB3A1_E55_R50363225           SCGB3A1
                        NM_052863.2        92304    5   36.1    1.8E+08      55
             50363225
SCGB3A1_P103_R                  SCGB3A1
                        NM_052863.2        92304    5   36.1    1.8E+08    -103
SEMA3A_P343_F5174672            SEMA3A
                        NM_006080.1        10371    7   36.1   83662191    -343
SEMA3A_P658_R5174672            SEMA3A
                        NM_006080.1        10371    7   36.1   83662506    -658
SEMA3B_E96_F54607087            SEMA3B
                        NM_004636.2         7869    3   36.1   50280140      96
SEMA3B_P110_R54607087           SEMA3B
                        NM_004636.2         7869    3   36.1   50279934    -110
SEMA3C_E49_R32307182            SEMA3C
                        NM_006379.2        10512    7   36.1   80386554      49
             3
SEMA3C_P642_F2307182            SEMA3C
                        NM_006379.2        10512    7   36.1   80387245    -642
SEMA3F_E333_R31377801           SEMA3F
                        NM_004186.2         6405    3   36.1   50168185     333
SEMA3F_P692_R31377801           SEMA3F
                        NM_004186.2         6405    3   36.1   50167160    -692
SEPT5_P441_F 58331273           SEPT5.
                        NM_001009939.1      5413   22   36.1   18081546    -441
SEPT5_P464_R 58331273           SEPT5.
                        NM_001009939.1      5413   22   36.1   18081523    -464
SEPT9_P374_F 19923366           SEPT9.
                        NM_006640.2        10801   17   36.1   72827370    -374
SEPT9_P58_R 19923366            SEPT9.
                        NM_006640.2        10801   17   36.1   72827686     -58
             34147643
SERPINA5_E69_F                  SERPINA5
                        NM_000624.3         5104   14   36.1   94117633      69
             34147643
SERPINA5_P156_F                 SERPINA5
                        NM_000624.3         5104   14   36.1   94117408    -156
              4505594
SERPINB2_P939_F                 SERPINB2
                        NM_002575.1         5055   18   36.1   59704983    -939
             52851464
SERPINB5_P19_R                  SERPINB5
                        NM_002639.2         5268   18   36.1   59295180     -19
             10835158
SERPINE1_E189_R                 SERPINE1
                        NM_000602.1         5054    7   36.1   1.01E+08     189
             10835158
SERPINE1_P519_F                 SERPINE1
                        NM_000602.1         5054    7   36.1   1.01E+08    -519
SEZ6L_P249_F 55956782           SEZ6L
                        NM_021115.3        23544   22   36.1   24895231    -249
SEZ6L_P299_F 55956782           SEZ6L
                        NM_021115.3        23544   22   36.1   24895181    -299
SFN_E118_F   45238846           SFN
                        NM_006142.3         2810    1   36.1   27062338     118
SFN_P248_F   45238846           SFN
                        NM_006142.3         2810    1   36.1   27061972    -248
SFRP1_E398_R 56117837           SFRP1
                        NM_003012.3         6422    8   36.1   41285739     398
SFRP1_P157_F 56117837           SFRP1
                        NM_003012.3         6422    8   36.1   41286294    -157
SFTPA1_E340_R38888174           SFTPA1
                        NM_005411.3         6435   10   36.1   81361004     340
SFTPA1_P421_F38888174           SFTPA1
                        NM_005411.3         6435   10   36.1   81360243    -421
SFTPB_P689_R 33943098           SFTPB
                        NM_000542.2         6439    2   36.1   85749512    -689
SFTPC_E13_F 42476334            SFTPC
                        NM_003018.2         6440    8   36.1   22075126      13
SFTPD_E169_F 61699225           SFTPD
                        NM_003019.4         6441   10   36.1   81698672     169
SGCE_E149_F 10835046            SGCE
                        NM_003919.1         8910    7   36.1   94123265    -359
SGCE_P250_R 10835046            SGCE
                        NM_003919.1         8910    7   36.1   94123664      40
SH3BP2_E18_F 19923154           SH3BP2
                        NM_003023.2         6452    4   36.1    2790357      18
SH3BP2_P771_R19923154           SH3BP2
                        NM_003023.2         6452    4   36.1    2789568    -771
SHB_P473_R    4506934           SHB
                        NM_003028.1         6461    9   36.1   38059683    -473
SHB_P691_R    4506934           SHB
                        NM_003028.1         6461    9   36.1   38059901    -691
SHH_E328_F 21071042             SHH
                        NM_000193.2         6469    7   36.1   1.55E+08     328
SHH_P104_R 21071042             SHH
                        NM_000193.2         6469    7   36.1   1.55E+08    -104
SIN3B_P514_R 52138512           SIN3B
                        NM_015260.1        23309   19   36.1   16800704    -514
SIN3B_P607_F 52138512           SIN3B
                        NM_015260.1        23309   19   36.1   16800611    -607
SKI_E465_R    4506966           SKI
                        NM_003036.1          6497      1   36.1    2150459       465
SLC14A1_E295_F7706676           SLC14A1
                        NM_015865.1          6563     18   36.1   41558450       295
SLC14A1_P369_R7706676           SLC14A1
                        NM_015865.1          6563     18   36.1   41557786      -369
             34734074
SLC22A18_P216_R                 SLC22A18
                        NM_002555.3          5002     11   36.1    2877311      -216
             34734074
SLC22A18_P472_R                 SLC22A18
                        NM_002555.3          5002     11   36.1    2877055      -472
             23510414
SLC22A2_E271_R                  SLC22A2
                        NM_153191.1          6582      6   36.1   1.61E+08       271
             2
SLC22A2_P109_F3510414           SLC22A2
                        NM_153191.1          6582      6   36.1   1.61E+08      -109
             24497488
SLC22A3_E122_R                  SLC22A3
                        NM_021977.2          6581      6   36.1   1.61E+08       122
             2
SLC22A3_P528_F4497488           SLC22A3
                        NM_021977.2          6581      6   36.1   1.61E+08      -528
             2
SLC22A3_P634_F4497488           SLC22A3
                        NM_021977.2          6581      6   36.1   1.61E+08      -634
SLC5A5_E60_F 4507034            SLC5A5
                        NM_000453.1          6528     19   36.1   17843842        60
SLC5A8_E60_R 33942075           SLC5A8
                        NM_145913.2        160728     12   36.1      1E+08        60
SLC5A8_P38_R 33942075           SLC5A8
                        NM_145913.2        160728     12   36.1      1E+08       -38
SLC6A8_P193_R 5032096           SLC6A8
                        NM_005629.1          6535 X        36.1   1.53E+08      -193
SLC6A8_P409_F 5032096           SLC6A8
                        NM_005629.1          6535 X        36.1   1.53E+08      -409
              5032096
SLC6A8_seq_28_S227_F            SLC6A8
                        NM_005629.1          6535 X        36.1   1.53E+08 .
SLIT2_E111_R 4759145            SLIT2
                        NM_004787.1          9353      4   36.1   19864444       111
SLIT2_P208_F 4759145            SLIT2
                        NM_004787.1          9353      4   36.1   19864125      -208
SMAD2_P708_R51173728            SMAD2
                        NM_005901.3          4087     18   36.1   43711929      -708
SMAD2_P848_R51173728            SMAD2
                        NM_005901.3          4087     18   36.1   43712069      -848
SMAD4_P474_R34147555            SMAD4
                        NM_005359.3          4089     18   36.1   46810137      -474
             2
SMARCA3_E20_F1071053            SMARCA3
                        NM_139048.1          6596      3   36.1    1.5E+08        20
             21071053
SMARCA3_P109_R                  SMARCA3
                        NM_139048.1          6596      3   36.1    1.5E+08      -109
SMARCA3_P17_R21071053           SMARCA3
                        NM_139048.1          6596      3   36.1    1.5E+08       -17
             21071055
SMARCA4_P362_R                  SMARCA4
                        NM_003072.2          6597     19   36.1   10932244      -362
             55956799
SMARCB1_P220_R                  SMARCB1
                        NM_003073.3          6598     22   36.1   22458930      -220
SMO_E57_F    34147561           SMO
                        NM_005631.3          6608      7   36.1   1.29E+08        57
SMO_P455_R 34147561             SMO
                        NM_005631.3          6608      7   36.1   1.29E+08      -455
SNCG_E119_F 4507112             SNCG
                        NM_003087.1          6623     10   36.1   88708514       119
SNCG_P53_F    4507112           SNCG
                        NM_003087.1          6623     10   36.1   88708342       -53
SNCG_P98_R    4507112           SNCG
                        NM_003087.1          6623     10   36.1   88708297       -98
SNRPN_E14_F 29540553            SNRPN
                        NM_022806.2          6638     15   36.1   22619901        14
SNRPN_P230_R29540553            SNRPN
                        NM_022806.2          6638     15   36.1   22619657      -230
             29540553
SNRPN_seq_12_S127_F             SNRPN
                        NM_022806.2          6638     15   36.1   22751217       -11
             29540553
SNRPN_seq_18_S99_F              SNRPN
                        NM_022806.2          6638     15   36.1   22751285        57
SNURF_E256_R29540557            SNURF
                        NM_005678.3          8926     15   36.1   22751484       256
SNURF_P2_R 29540557             SNURF
                        NM_005678.3          8926     15   36.1   22751226        -2
SNURF_P78_F 29540557            SNURF
                        NM_005678.3          8926     15   36.1   22751150       -78
SOD3_P225_F 4507150             SOD3
                        NM_003102.1          6649      4   36.1   24404928      -225
SOD3_P460_R 4507150             SOD3
                        NM_003102.1          6649      4   36.1   24404693      -460
SOX1_P1018_R 30179899           SOX1
                        NM_005986.2          6656     13   36.1   1.12E+08     -1018
SOX1_P294_F 30179899            SOX1
                        NM_005986.2          6656     13   36.1   1.12E+08      -294
SOX17_P287_R 31077196           SOX17
                        NM_022454.2         64321      8   36.1   55532761      -287
SOX17_P303_F 31077196           SOX17
                        NM_022454.2         64321      8   36.1   55532745      -303
SOX2_P546_F 29826338            SOX2
                        NM_003106.2          6657      3   36.1   1.83E+08      -546
SPARC_E50_R 48675809            SPARC
                        NM_003118.2          6678      5   36.1   1.51E+08        50
SPARC_P195_F 48675809           SPARC
                        NM_003118.2          6678      5   36.1   1.51E+08      -195
SPDEF_E116_R 6912579            SPDEF
                        NM_012391.1         25803      6   36.1   34631953       116
SPDEF_P6_R    6912579           SPDEF
                        NM_012391.1         25803      6   36.1   34632075        -6
SPI1_E205_F   4507174           SPI1
                        NM_003120.1          6688     11   36.1   47356469       205
SPI1_P48_F    4507174           SPI1
                        NM_003120.1          6688     11   36.1   47356722       -48
SPI1_P929_F   4507174           SPI1
                        NM_003120.1          6688     11   36.1   47357603      -929
SPP1_E140_R 38146097            SPP1
                        NM_000582.2        6696        4   36.1   89115966    140
SPP1_P647_F 38146097            SPP1
                        NM_000582.2        6696        4   36.1   89115179   -647
SRC_E100_R 38202216             SRC
                        NM_198291.1        6714       20   36.1   35406602    100
SRC_P164_F 38202216             SRC
                        NM_198291.1        6714       20   36.1   35406338   -164
SRC_P297_F 38202216             SRC
                        NM_198291.1        6714       20   36.1   35406205   -297
             27765090
ST6GAL1_P164_R                  ST6GAL1
                        NM_173216.1        6480        3   36.1   1.88E+08   -164
             27765090
ST6GAL1_P528_F                  ST6GAL1
                        NM_173216.1        6480        3   36.1   1.88E+08   -528
STAT5A_E42_F 21618341           STAT5A
                        NM_003152.2        6776       17   36.1   37693133     42
STAT5A_P704_R21618341           STAT5A
                        NM_003152.2        6776       17   36.1   37692387   -704
STK11_P295_R 58530881           STK11
                        NM_000455.4        6794       19   36.1    1156503   -295
STK23_E182_R 63025195           STK23
                        NM_014370.2       26576   X        36.1   1.53E+08    182
STK23_P24_F 63025195            STK23
                        NM_014370.2       26576   X        36.1   1.53E+08    -24
SYBL1_E23_R 27545446            SYBL1
                        NM_005638.3        6845   X        36.1   1.55E+08     23
SYBL1_P349_F 27545446           SYBL1
                        NM_005638.3        6845   X        36.1   1.55E+08   -349
SYK_E372_F   34147655           SYK
                        NM_003177.3        6850        9   36.1   92604263    372
SYK_P584_F   34147655           SYK
                        NM_003177.3        6850        9   36.1   92603307   -584
TAL1_E122_F   4507362           TAL1
                        NM_003189.1        6886        1   36.1   47467908    122
TAL1_P594_F   4507362           TAL1
                        NM_003189.1        6886        1   36.1   47468624   -594
TAL1_P817_F   4507362           TAL1
                        NM_003189.1        6886        1   36.1   47468847   -817
TBX1_P520_F 18104949            TBX1
                        NM_080646.1        6899       22   36.1   18123706   -520
TBX1_P885_R 18104949            TBX1
                        NM_080646.1        6899       22   36.1   18123341   -885
TCF4_P175_R 4507398             TCF4
                        NM_003199.1        6925       18   36.1   51406615   -175
TCF4_P317_F   4507398           TCF4
                        NM_003199.1        6925       18   36.1   51406757   -317
TCF7L2_E411_F13540470           TCF7L2
                        NM_030756.1        6934       10   36.1   1.15E+08    411
TCF7L2_P193_R13540470           TCF7L2
                        NM_030756.1        6934       10   36.1   1.15E+08   -193
TDG_E129_F 56549140             TDG
                        NM_001008411.1     6996       12   36.1   1.03E+08    129
TDGF1_E53_R 4507424             TDGF1
                        NM_003212.1        6997        3   36.1   46594270     53
TDGF1_P428_R 4507424            TDGF1
                        NM_003212.1        6997        3   36.1   46593789   -428
TEK_E75_F     4557868           TEK
                        NM_000459.1        7010        9   36.1   27099516     75
TEK_P479_R    4557868           TEK
                        NM_000459.1        7010        9   36.1   27098962   -479
TEK_P526_F    4557868           TEK
                        NM_000459.1        7010        9   36.1   27098915   -526
TERT_E20_F 38201701             TERT
                        NM_198255.1        7015        5   36.1    1348139     20
TERT_P360_R 38201701            TERT
                        NM_198255.1        7015        5   36.1    1348519   -360
TES_E172_F   23238186           TES
                        NM_015641.2       26136        7   36.1   1.16E+08    172
TES_P182_F   23238186           TES
                        NM_015641.2       26136        7   36.1   1.16E+08   -182
TESK2_P252_R 6005895            TESK2
                        NM_007170.1       10420        1   36.1   45729672   -252
TFAP2C_E260_F39812473           TFAP2C
                        NM_003222.3        7022       20   36.1   54638025    260
TFAP2C_P765_F39812473           TFAP2C
                        NM_003222.3        7022       20   36.1   54637000   -765
TFDP1_P543_R 34147667           TFDP1
                        NM_007111.3        7027       13   36.1   1.13E+08   -543
TFE3_P421_F 21359903            TFE3
                        NM_006521.3        7030   X        36.1   48788355   -421
TFF1_P180_R 48928023            TFF1
                        NM_003225.2        7031       21   36.1   42659893   -180
TFF2_P178_F 48928025            TFF2
                        NM_005423.3        7032       21   36.1   42644354   -178
TFF2_P557_R 48928025            TFF2
                        NM_005423.3        7032       21   36.1   42644733   -557
TFPI2_E141_F 31543803           TFPI2
                        NM_006528.2        7980        7   36.1   93357860    141
TFPI2_P152_R 31543803           TFPI2
                        NM_006528.2        7980        7   36.1   93358153   -152
TFPI2_P9_F   31543803           TFPI2
                        NM_006528.2        7980        7   36.1   93358010     -9
TFRC_P414_R 4507456             TFRC
                        NM_003234.1        7037        3   36.1   1.97E+08   -414
TGFA_P558_F 4507460             TGFA
                        NM_003236.1        7039        2   36.1   70634996   -558
TGFA_P642_R 4507460             TGFA
                        NM_003236.1        7039        2   36.1   70635080   -642
TGFB1_P833_R 63025221           TGFB1
                        NM_000660.3        7040       19   36.1   46552489   -833
TGFB2_E226_R 4507462            TGFB2
                        NM_003238.1        7042        1   36.1   2.17E+08    226
TGFB2_P632_F 4507462            TGFB2
                        NM_003238.1        7042        1   36.1   2.17E+08   -632
TGFB3_E58_R 4507464             TGFB3
                        NM_003239.1          7043     14   36.1   75517184        58
TGFBI_P173_F 4507466            TGFBI
                        NM_000358.1          7045      5   36.1   1.35E+08      -173
TGFBI_P31_R   4507466           TGFBI
                        NM_000358.1          7045      5   36.1   1.35E+08       -31
TGFBR3_E188_R56682965           TGFBR3
                        NM_003243.2          7049      1   36.1   92124055       188
TGFBR3_P429_F56682965           TGFBR3
                        NM_003243.2          7049      1   36.1   92124672      -429
THBS1_E207_R 40317625           THBS1
                        NM_003246.2          7057     15   36.1   37660779       207
THBS1_P500_F 40317625           THBS1
                        NM_003246.2          7057     15   36.1   37660072      -500
THBS2_E129_F 40317627           THBS2
                        NM_003247.2          7058      6   36.1   1.69E+08       129
THBS2_P605_R 40317627           THBS2
                        NM_003247.2          7058      6   36.1   1.69E+08      -605
THPO_E483_F 40805872            THPO
                        NM_199228.1          7066      3   36.1   1.86E+08       483
THPO_P585_R 40805872            THPO
                        NM_199228.1          7066      3   36.1   1.86E+08      -585
THY1_P149_R 19923361            THY1
                        NM_006288.2          7070     11   36.1   1.19E+08      -149
THY1_P20_R 19923361             THY1
                        NM_006288.2          7070     11   36.1   1.19E+08       -20
TIAM1_P117_F 4507500            TIAM1
                        NM_003253.1          7074     21   36.1   31853278      -117
TIAM1_P188_R 4507500            TIAM1
                        NM_003253.1          7074     21   36.1   31853349      -188
TIE1_E66_R   31543809           TIE1
                        NM_005424.2          7075      1   36.1   43539317        66
TIMP1_E254_R 73858576           TIMP1
                        NM_003254.2          7076 X        36.1   47326888       254
TIMP1_P615_R 73858576           TIMP1
                        NM_003254.2          7076 X        36.1   47326019      -615
TIMP2_E394_R 89043088           TIMP2
                        XM_941104.1          7077     17   36.1   74432673       394
TIMP2_P267_F 89043088           TIMP2
                        XM_941104.1          7077     17   36.1   74433334      -267
TIMP3_P1114_R75905820           TIMP3
                        NM_000362.4          7078     22   36.1   31525688     -1114
TIMP3_P690_R 75905820           TIMP3
                        NM_000362.4          7078     22   36.1   31526112      -690
             75905820
TIMP3_seq_7_S38_F               TIMP3
                        NM_000362.4          7078     22   36.1   31527437 .
TJP1_P326_R 28416401            TJP1
                        NM_175610.1          7082     15   36.1   27902324      -326
TJP1_P390_F 28416401            TJP1
                        NM_175610.1          7082     15   36.1   27902388      -390
TJP2_P330_R 42518069            TJP2
                        NM_004817.2          9414      9   36.1   70978579      -330
TJP2_P518_F 42518069            TJP2
                        NM_004817.2          9414      9   36.1   70978391      -518
TK1_E47_F     4507518           TK1
                        NM_003258.1          7083     17   36.1   73694679        47
TK1_P62_R     4507518           TK1
                        NM_003258.1          7083     17   36.1   73694788       -62
TM7SF3_P1068_R7706574           TM7SF3
                        NM_016551.1         51768     12   36.1   27059473     -1068
TMEFF1_E180_R29568104           TMEFF1
                        NM_003692.2          8577      9   36.1   1.02E+08       180
TMEFF1_P234_F29568104           TMEFF1
                        NM_003692.2          8577      9   36.1   1.02E+08      -234
TMEFF1_P626_R29568104           TMEFF1
                        NM_003692.2          8577      9   36.1   1.02E+08      -626
TMEFF2_E94_R 12383050           TMEFF2
                        NM_016192.2         23671      2   36.1   1.93E+08        94
TMEFF2_P152_R12383050           TMEFF2
                        NM_016192.2         23671      2   36.1   1.93E+08      -152
TMEFF2_P210_R12383050           TMEFF2
                        NM_016192.2         23671      2   36.1   1.93E+08      -210
TMEM63A_E63_F7662307            TMEM63A
                        NM_014698.1          9725      1   36.1   2.24E+08        63
             3
TMPRSS4_E83_F4304348            TMPRSS4
                        NM_019894.2         56649     11   36.1   1.17E+08        83
             34304348
TMPRSS4_P552_F                  TMPRSS4
                        NM_019894.2         56649     11   36.1   1.17E+08      -552
TNC_P198_F    4504548           TNC
                        NM_002160.1          3371      9   36.1   1.17E+08      -198
TNC_P57_F     4504548           TNC
                        NM_002160.1          3371      9   36.1   1.17E+08       -57
TNF_P1084_F 25952110            TNF
                        NM_000594.2          7124      6   36.1   31650245     -1084
TNF_P158_F   25952110           TNF
                        NM_000594.2          7124      6   36.1   31651171      -158
             21361085
TNFRSF10A_P171_F                TNFRSF10A
                        NM_003844.2          8797      8   36.1   23138755        70
             21361085
TNFRSF10A_P91_F                 TNFRSF10A
                        NM_003844.2          8797      8   36.1   23138675       -10
             22547118
TNFRSF10B_E198_R                TNFRSF10B
                        NM_147187.1          8795      8   36.1   22982439       198
             22547118
TNFRSF10B_P108_R                TNFRSF10B
                        NM_147187.1          8795      8   36.1   22982745      -108
             22547120
TNFRSF10C_E109_F                TNFRSF10C
                        NM_003841.2          8794      8   36.1   23016488       109
             22547120
TNFRSF10C_P612_R                TNFRSF10C
                        NM_003841.2          8794      8   36.1   23015767      -612
             22547120
TNFRSF10C_P7_F                  TNFRSF10C
                        NM_003841.2          8794      8   36.1   23016372        -7
             42544227
TNFRSF10D_E27_F                 TNFRSF10D
                        NM_003840.3          8793      8   36.1   23077458        27
             42544227
TNFRSF10D_P70_F                 TNFRSF10D
                        NM_003840.3          8793      8   36.1   23077555       -70
              23312372
TNFRSF1A_P678_F                  TNFRSF1A
                         NM_001065.2         7132   12   36.1    6322200    -678
TNFRSF1B_E5_F 23312365           TNFRSF1B
                         NM_001066.2         7133    1   36.1   12149652       5
              23312365
TNFRSF1B_P167_F                  TNFRSF1B
                         NM_001066.2         7133    1   36.1   12149480    -167
TNFSF10_E53_F 23510439           TNFSF10
                         NM_003810.2         8743    3   36.1   1.74E+08      53
TNFSF10_P2_R 23510439            TNFSF10
                         NM_003810.2         8743    3   36.1   1.74E+08      -2
TNFSF8_E258_R 24119162           TNFSF8
                         NM_001244.2          944    9   36.1   1.17E+08     258
TNFSF8_P184_F 24119162           TNFSF8
                         NM_001244.2          944    9   36.1   1.17E+08    -184
TNK1_P221_F    4507610           TNK1
                         NM_003985.1         8711   17   36.1    7224913    -221
TNK1_P41_R     4507610           TNK1
                         NM_003985.1         8711   17   36.1    7225093     -41
TP73_E155_F    4885644           TP73
                         NM_005427.1         7161    1   36.1    3559144     155
TP73_P496_F    4885644           TP73
                         NM_005427.1         7161    1   36.1    3558493    -496
TP73_P945_F    4885644           TP73
                         NM_005427.1         7161    1   36.1    3558044    -945
              12383050
TPEF_seq_44_S36_F                TMEFF2
                         NM_016192.2        23671    2   36.1   1.93E+08     442
              12383050
TPEF_seq_44_S88_R                TMEFF2
                         NM_016192.2        23671    2   36.1   1.93E+08     494
TRAF4_P372_F 22027623            TRAF4
                         NM_145751.1         9618   17   36.1   24094801    -372
TRIM29_E189_F17402908            TRIM29
                         NM_012101.2        23650   11   36.1    1.2E+08     189
TRIM29_P135_F17402908            TRIM29
                         NM_012101.2        23650   11   36.1    1.2E+08    -135
TRIM29_P261_F17402908            TRIM29
                         NM_012101.2        23650   11   36.1    1.2E+08    -261
TRIP6_E33_F 23308730             TRIP6
                         NM_003302.1         7205    7   36.1      1E+08      33
TRIP6_P1090_F 23308730           TRIP6
                         NM_003302.1         7205    7   36.1      1E+08   -1090
TRIP6_P1274_R23308730            TRIP6
                         NM_003302.1         7205    7   36.1      1E+08   -1274
TRPM5_E87_F 24475627             TRPM5
                         NM_014555.2        29850   11   36.1    2400764      87
TRPM5_P721_F 24475627            TRPM5
                         NM_014555.2        29850   11   36.1    2401572    -721
TRPM5_P979_F 24475627            TRPM5
                         NM_014555.2        29850   11   36.1    2401830    -979
TSC2_E140_F 10938006             TSC2
                         NM_000548.2         7249   16   36.1    2038740     140
TSG101_P139_R 18765712           TSG101
                         NM_006292.2         7251   11   36.1   18505204    -139
TSG101_P257_R 18765712           TSG101
                         NM_006292.2         7251   11   36.1   18505322    -257
TSP50_E21_R 31543829             TSP50
                         NM_013270.2        29122    3   36.1   46734347      21
TSP50_P137_F 31543829            TSP50
                         NM_013270.2        29122    3   36.1   46734505    -137
TUBB3_E91_F 50592995             TUBB3
                         NM_006086.2        10381   16   36.1   88517337      91
TUBB3_P364_F 50592995            TUBB3
                         NM_006086.2        10381   16   36.1   88516882    -364
TUBB3_P721_R 50592995            TUBB3
                         NM_006086.2        10381   16   36.1   88516525    -721
TUSC3_E29_R 30410789             TUSC3
                         NM_178234.1         7991    8   36.1   15442130      29
TUSC3_P85_R 30410789             TUSC3
                         NM_178234.1         7991    8   36.1   15442016     -85
TWIST1_E117_R 68160957           TWIST1
                         NM_000474.3         7291    7   36.1   19123703     117
TWIST1_P355_R 68160957           TWIST1
                         NM_000474.3         7291    7   36.1   19124175    -355
TWIST1_P44_R 68160957            TWIST1
                         NM_000474.3         7291    7   36.1   19123864     -44
TYK2_P494_F 34222294             TYK2
                         NM_003331.3         7297   19   36.1   10352705    -494
TYRO3_P366_F 27597077            TYRO3
                         NM_006293.2         7301   15   36.1   39638158    -366
TYRO3_P501_F 27597077            TYRO3
                         NM_006293.2         7301   15   36.1   39638023    -501
UBA52_P293_R 15451941            UBA52
                         NM_003333.2         7311   19   36.1   18543375    -293
UGT1A1_E11_F 45827762            UGT1A1
                         NM_000463.2        54658    2   36.1   2.34E+08      11
UGT1A1_P315_R 45827762           UGT1A1
                         NM_000463.2        54658    2   36.1   2.34E+08    -315
UGT1A1_P564_R 45827762           UGT1A1
                         NM_000463.2        54658    2   36.1   2.34E+08    -564
UGT1A7_P751_R 41282212           UGT1A7
                         NM_019077.2        54577    2   36.1   2.34E+08    -751
UNG_P170_F 19718744              UNG
                         NM_003362.2         7374   12   36.1   1.08E+08    -170
USP29_E274_F 56790915            USP29
                         NM_020903.2        57663   19   36.1   62323595     274
USP29_P205_R 56790915            USP29
                         NM_020903.2        57663   19   36.1   62323116    -205
USP29_P282_R 56790915            USP29
                         NM_020903.2        57663   19   36.1   62323039    -282
VAMP8_E7_F 14043025              VAMP8
                         NM_003761.2         8673    2   36.1   85658235       7
VAMP8_P114_F 14043025            VAMP8
                         NM_003761.2         8673    2   36.1   85658114    -114
VAMP8_P241_F 14043025            VAMP8
                         NM_003761.2         8673    2   36.1   85657987    -241
VAV1_E9_F       7108366            VAV1
                          NM_005428.2          7409       19   36.1    6723731       9
VAV1_P317_F     7108366            VAV1
                          NM_005428.2          7409       19   36.1    6723405    -317
VAV2_E58_F     40549447            VAV2
                          NM_003371.2          7410        9   36.1   1.36E+08      58
VAV2_P1182_F 40549447              VAV2
                          NM_003371.2          7410        9   36.1   1.36E+08   -1182
VBP1_E127_F 66346740               VBP1
                          NM_003372.4          7411   X        36.1   1.54E+08     127
VBP1_P12_R 66346740                VBP1
                          NM_003372.4          7411   X        36.1   1.54E+08     -12
VBP1_P194_F 66346740               VBP1
                          NM_003372.4          7411   X        36.1   1.54E+08    -194
VEGFB_P658_F 89034833              VEGFB
                          XM_938483.1          7423       11   36.1   63758184    -658
VIM_P343_R     62414288            VIM
                          NM_003380.2          7431       10   36.1   17310961    -343
VIM_P811_R     62414288            VIM
                          NM_003380.2          7431       10   36.1   17310493    -811
WEE1_P924_R 19718775               WEE1
                          NM_003390.2          7465       11   36.1    9549992    -924
WNT1_E157_F 16936523               WNT1
                          NM_005430.2          7471       12   36.1   47658660     157
WNT1_P79_R 16936523                WNT1
                          NM_005430.2          7471       12   36.1   47658424     -79
               1
WNT10B_P823_R6936521               WNT10B
                          NM_003394.2          7480       12   36.1   47652633    -823
               1
WNT10B_P993_F6936521               WNT10B
                          NM_003394.2          7480       12   36.1   47652803    -993
WNT2_E109_R 4507926                WNT2
                          NM_003391.1          7472        7   36.1   1.17E+08     109
WNT2_P217_F 4507926                WNT2
                          NM_003391.1          7472        7   36.1   1.17E+08    -217
               1
WNT2B_P1185_R3518020               WNT2B
                          NM_024494.1          7482        1   36.1   1.13E+08   -1185
               1
WNT2B_P1195_F3518020               WNT2B
                          NM_024494.1          7482        1   36.1   1.13E+08   -1195
WNT5A_E43_F 40806204               WNT5A
                          NM_003392.3          7474        3   36.1   55496328      43
WNT5A_P655_F40806204               WNT5A
                          NM_003392.3          7474        3   36.1   55497026    -655
WNT8B_E487_F17505196               WNT8B
                          NM_003393.2          7479       10   36.1   1.02E+08     487
WNT8B_P216_R17505196               WNT8B
                          NM_003393.2          7479       10   36.1   1.02E+08    -216
WRN_E57_F      19924171            WRN
                          NM_000553.2          7486        8   36.1   31010377     396
WRN_P969_F 19924171                WRN
                          NM_000553.2          7486        8   36.1   31009351    -969
WT1_E32_F      65507816            WT1
                          NM_024424.2          7490       11   36.1   32413631      32
WT1_P853_F 65507816                WT1
                          NM_024424.2          7490       11   36.1   32414516    -853
               37704377
Xist_seq_80_S47_R                  XIST
                          NR_001564.1          7503   X        36.1   72989344     -31
               37704377
Xist_seq_80_S95_R                  XIST
                          NR_001564.1          7503   X        36.1   72989296      17
XPC_P226_R 54607142                XPC
                          NM_004628.3          7508        3   36.1   14195369    -226
XRCC1_P681_R 5454171               XRCC1
                          NM_006297.1          7515       19   36.1   48772236    -681
XRCC2_P1077_F 4885656              XRCC2
                          NM_005431.1          7516        7   36.1   1.52E+08   -1077
YES1_P216_F 51702529               YES1
                          NM_005433.3          7525       18   36.1     802543    -216
YES1_P600_F 51702529               YES1
                          NM_005433.3          7525       18   36.1     802927    -600
ZAP70_P220_R 46488942              ZAP70
                          NM_001079.3          7535        2   36.1   97696243    -220
ZIM2_E110_F 33354272               ZIM2
                          NM_015363.3         23619       19   36.1   62043777     110
ZIM2_P22_F     33354272            ZIM2
                          NM_015363.3         23619       19   36.1   62043909     -22
ZIM3_E203_F 16418390               ZIM3
                          NM_052882.1        114026       19   36.1   62348179     203
ZIM3_P451_R 16418390               ZIM3
                          NM_052882.1        114026       19   36.1   62348833    -451
ZIM3_P718_R 16418390               ZIM3
                          NM_052882.1        114026       19   36.1   62349100    -718
               3
ZMYND10_E77_R7594443               ZMYND10
                          NM_015896.2         51364        3   36.1   50358083      77
ZMYND10_P329_F 37594443            ZMYND10
                          NM_015896.2         51364        3   36.1   50358489    -329
ZNF215_P129_R 7019582              ZNF215
                          NM_013250.1          7762       11   36.1    6904101    -129
ZNF215_P71_R 7019582               ZNF215
                          NM_013250.1          7762       11   36.1    6904159     -71
ZNF264_E48_R 55769562              ZNF264
                          NM_003417.2          9422       19   36.1   62394729      48
ZNF264_P397_F55769562              ZNF264
                          NM_003417.2          9422       19   36.1   62394284    -397
ZNFN1A1_E102_F 31657112            ZNFN1A1
                          NM_006060.2         10320        7   36.1   50411827     102
ZNFN1A1_P179_F 31657112            ZNFN1A1
                          NM_006060.2         10320        7   36.1   50411546    -179
ZP3_E90_F      89026125            ZP3
                          XM_939654.1          7784        7   36.1   75864894      90
ZP3_P220_F     89026125            ZP3
                          XM_939654.1          7784        7   36.1   75864584    -220
                    Synonym Annotation Product
CpG_islandInput_Sequence                              cg_no
N                   .          PREDICTED: Homo sapiens apoptosis-associated tyrosine kinase (AATK),
                                          apoptosis-associated tyrosine kinase
                                                      cg05292376
          GGGCAGAAGCCAGCTTGATGGCAGACACCT[CG]CCACCAGTAGCAGGCGTGGGAGAGTC mRNA.
Y                   .          PREDICTED: Homo sapiens apoptosis-associated tyrosine kinase (AATK), mRNA.
                                          apoptosis-associated tyrosine kinase
                                                      cg17279079
          GGGGACGTGCCCAGTGGGTCCT[CG]AAGAAGGCAGGACAGAAGGCGG
Y                   .          PREDICTED: Homo sapiens apoptosis-associated tyrosine kinase (AATK), mRNA.
                                          apoptosis-associated tyrosine kinase
                                                      cg02979355
          ACGGGTGGCCCGTGGCCCAGCAG[CG]GCTCCATGGCCAGCGAGGCGG
Y                   TGD, ABC1, CERP, ABC-1, HDLDT1 cassette, sub-family A (ABC1),
                               Homo sapiens ATP-binding
                                          ATP-binding cassette, sub-family A member
                                                      cg24415731
          ACCGGGGAAAAAACAAGGAGCAAAG[CG]CCCTGAGAACCGGCTCTGTTG 1 member 1 (ABCA1), mRNA.
Y                   TGD, ABC1, CERP, ABC-1, HDLDT1 cassette, sub-family A (ABC1), member
                               Homo sapiens ATP-binding
                                          ATP-binding cassette, sub-family A member 1
                                                      cg26272837
          AGTTCCTTTTATAGATTCGGCTGCAC[CG]AGCGCAGAGGTTACTATCGGTCAAAGCCT 1 (ABCA1), mRNA.
N                   MDR3, PGY3, ABC21, ATP-binding cassette, subfamily B, member 4 isoform C
                               Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP),
                                           MDR2/3, PFIC-3
                                                      cg05279864
          TTCCTTGGACTTCTCAGTCTATTCT[CG]CCACTTCTGTCATGTCAGTCAGTCACAC member 4 (ABCB4), transcr
N                   MDR3, PGY3, ABC21, ATP-binding cassette, subfamily B, member 4 isoform C
                               Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 4 (ABCB4), transcr
                                           MDR2/3, PFIC-3
                                                      cg18655915
          TCTGTCCTTTCCTCCTCTTC[CG]CCTTTGTCCATTGTCAAAAGCATGGCCTGG
N                   MDR3, PGY3, ABC21, ATP-binding cassette, subfamily B, member 4 isoform
                               Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 4 (ABCB4), transcr
                                           MDR2/3, PFIC-3
                                                      cg02810586
          GAATTAGGCTTCCAGCTCTGGCCA[CG]TGACTTCAGCTTCTCATTCTGTATTCCTAT C
N                   DJS, MRP2, cMRP, ABC30, CMOAT, KIAA1010 sub-family C (CFTR/MRP),
                               Homo sapiens ATP-binding cassette,
                                          ATP-binding cassette, sub-family C (CFTR/MRP), member 2
                                                      cg14947634
          AATAGAAGAGTCTTCGTTCCAGA[CG]CAGTCCAGGAATCATGCTGGAGAAGTTCT member 2 (ABCC2), mRN
N                   DJS, MRP2, cMRP, ABC30, CMOAT, KIAA1010 sub-family C (CFTR/MRP), member
                               Homo sapiens ATP-binding cassette,
                                          ATP-binding cassette, sub-family C (CFTR/MRP),
                                                      cg08067239
          GTTGGGATGAAAGGTCATCCTTTA[CG]GAGAACATCAGAATGGTAGATAATTCC member 2 2 (ABCC2), mRN
Y                   MRP5, SMRP, ABC33,ATP-binding cassette, sub-family C, member 5 isoform 1
                               Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP),
                                           MOATC, MOAT-C, pABC11, EST277145
                                                      cg16378421
          GCTCATGGTTCGACCCTGCAGTCTG[CG]CAGATACCGCCTTTCTCACTTTAACAC member 5 (ABCC5), trans
Y                   MRX, MXR, ABCP, BCRP,ATP-binding cassette, sub-familymember 2EST157481, MGC102821
                               Homo sapiens BMDP,cg08748699
                                          ATP-bindingMXR1, ABC15, BCRP1, CDw338,
                                                        cassette, sub-family G, G (WHITE), member 2 (ABCG2), mRNA.
          CCGGCTGAAAGCGCACACGTGTCCTGC[CG]CGCTGAGCCGCCAGCAGGACTGG
Y                   MRX, MXR, ABCP, BCRP,ATP-binding cassette, sub-familymember 2EST157481, MGC102821
                               Homo sapiens BMDP,cg11000292
                                          ATP-bindingMXR1, ABC15, BCRP1, CDw338,
                                                        cassette, sub-family G, G (WHITE), member 2 (ABCG2), mRNA.
          CGAACGGAATGAACCAGAGTGATTAACTA[CG]AGAATCACCAGGCGCTCATTGGGC
Y                   ABL, JTK7,Homo sapiensv-abl Abelson murine leukemia viral oncogene homolog 1 (ABL1),
                               p150, c-ABL, v-abl cg25211462
                                          v-abl Abelson murine leukemia viral oncogene homolog
          TCCGGAGAGCAAAGCAGAGAAGCGAGAG[CG]GCCACTAGTTCGGCAGGAAATTTG 1 isoform a transcript v
Y                   ARG, ABLLHomo sapiens v-abl Abelson murine leukemia viral oncogene homolog 2 (arg,
                                          v-abl Abelson murine leukemia viral oncogene homolog
                                                      cg00467594
          GAGTGAGTCGAGGGCTCAGTGCCACCG[CG]TGCGCAGCTCAGGTGCAGGCACAGGT2 isoform bAbelson-relat
Y                   GTB, NAGAT, A3GALNT, A3GALT1 group (transferasealpha 1-3-N-acetylgalactosaminyltransferase; tr
                               Homo sapiens ABO blood (transferase A, A, alpha
                                          ABO blood cg01511667
                                                      group
          CCGGCTGTCGGGTGCACCC[CG]CATTCCCTGCGGTAGCGGCTCCCTC 1-3-N-acetylgalactosaminyltransferas
Y                   GTB, NAGAT, A3GALNT, A3GALT1 group (transferasealpha 1-3-N-acetylgalactosaminyltransferase; tr
                               Homo sapiens ABO blood (transferase A, A, alpha
                                          ABO blood cg27345669
                                                      group
          CTTGACACCCTGTCTCCCGGG[CG]GGGGCGACCCCCTGACATCCTGCT 1-3-N-acetylgalactosaminyltransferas
N                   ACT, ACTE, ACTA3, ACTL3,gamma 2 propeptide muscle, enteric (ACTG2), mRNA.
                               Homo sapiens actin, gamma 2, smooth
                                          actin, ACTSGcg04793455
          CCTCTCATACCCTCGGTAAGTACTGTA[CG]GCTTTTGCCACCTCTTCCTTTCC
N                   ACT, ACTE, ACTA3, ACTL3,gamma 2 propeptide muscle, enteric (ACTG2), mRNA.
                               Homo sapiens actin, gamma 2, smooth
                                          actin, ACTSGcg15966469
          GGGCGTCCCAGGCAGACCCAGGGGC[CG]CATGCAGCAGGGCCTGAGGAGG
N                   ACT, ACTE, ACTA3, ACTL3,gamma 2 propeptide muscle, enteric (ACTG2),
                               Homo sapiens actin, gamma 2, smooth
                                          actin, ACTSGcg05473646
          GCACGCAGGATTTCTTTCCTGGGTA[CG]GAAGGCATTTCTCTTCAGCTTTCATTGG mRNA.
N                   ALK2, SKR1, ACTRI, ACVRLK2type I receptor precursor
                               Homo sapiens activin A receptor, type I (ACVR1), mRNA.
                                          activin A cg09919801
          GCACGAAGCGTTGCCAGTCTGGGAC[CG]GCTTCCAGTGAGGACAGCATTGTTT
N                   ALK2, SKR1, ACTRI, ACVRLK2type I receptor precursor
                               Homo sapiens activin A receptor, type I (ACVR1), mRNA.
                                          activin A cg10122840
          GTAAGCACTGGCCTCTCTCGGGTCT[CG]CCTTTCTATTGTCCCACCCTGCAGGG
Y                   ALK4, SKR2, ACTRIB, activin A type IB receptor isoform a
                               Homo sapiens activin A receptor, type IB (ACVR1B), transcript variant 1, mRNA.
                                           ACVRLK4 cg10587921
          CCTTCACCGTGTCCAGGGG[CG]GGGGGCTTTCTTCCCTCCCTCCprecursor
Y                   ALK4, SKR2, ACTRIB, activin A type IB receptor isoform a precursor
                               Homo sapiens activin A receptor, type IB (ACVR1B), transcript variant 1, mRNA.
                                           ACVRLK4 cg16774435
          CCCAATCAGAGTGCCTCACA[CG]GCACCCTCACCCATACTGTCATC
Y                   ALK7, ACVRLK7 sapiens activin A receptor, type IC (ACVR1C), mRNA.
                               Homo       activin A receptor, type IC
                                                      cg19905951
          AGGCAGGCAAAGGCGGCCCTGTGCC[CG]GCAGTGAGATCGCCCAGAGCTGG
Y                   ALK7, ACVRLK7 sapiens activin A receptor, type IC (ACVR1C), mRNA.
                               Homo       activin A receptor, type IC
                                                      cg05010623
          GGTCCTTAAGTCCAACCAGGTTG[CG]CTGTGAGAGCCCCGCGGGCTTCCTAC
Y                   ActR-IIB, MGC116908 activin A type IIB receptor precursor
                               Homo sapiens activin A receptor, type IIB (ACVR2B), mRNA.
                                                      cg12086765
          TGACGGCGCCCTGGGTGGCCCT[CG]CCCTCCTCTGGGGATCGCTGTGCGCCG
Y                   ActR-IIB, MGC116908 activin A type IIB receptor precursor
                               Homo sapiens activin A receptor, type IIB (ACVR2B), mRNA.
                                                      cg23840480
          CTAATTGCGAGTGCAGTGGCCACAGGCTCC[CG]GGCAAAGTGGTCAGGAGCCC
Y                   .          Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 12 (ADAMTS12),
                                          ADAM metallopeptidase with thrombospondin type
                                                      cg13887940
          AGATGCAGGGGTGCATGGTCAGGCG[CG]AGAAGGCAGCGACTGCAAAGCTGCC1 motif, 12 preproprotein
Y                   .          Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 12 (ADAMTS12),
                                          ADAM metallopeptidase with thrombospondin
                                                      cg24560027
          CGAACGCCAGGCCCAGCTGGCCGAGC[CG]GCCAAATAGGGGAGACCCGG type 1 motif, 12 preproprotein
Y                   PACAP, MGC126852 adenylate cyclase activating polypeptide precursor
                               Homo sapiens adenylate cyclase activating polypeptide
                                                      cg01277640
          GCTGGGGCTTCCCAGGCACAGA[CG]CTTCCTCACGGTCTCCTTCCTGCA 1 (pituitary) (ADCYAP1), mRNA.
Y                   PACAP, MGC126852 adenylate cyclase activating polypeptide precursor
                               Homo sapiens adenylate cyclase activating polypeptide
                                                      cg01521573
          TGCCTCTCGGGTGGTGACTCCAG[CG]CAGGAACTTGAAGAAGCGCTTTG 1 (pituitary) (ADCYAP1), mRNA.
Y                   PACAP, MGC126852 adenylate cyclase activating polypeptide precursor
                               Homo sapiens adenylate cyclase activating polypeptide 1
                                                      cg01799816
          TCCTGCTGCTCCCGCTGGTTCCTG[CG]GCTTCTGCTCAGACACCAACGCCA(pituitary) (ADCYAP1), mRNA.
N                   LAF4, MLLT2-like sapiens AF4/FMR2 family, member 3 (AFF3), transcript variant 2, mRNA.
                               Homo       AF4/FMR2 cg23497683
                                                      family, member 3 isoform 2
          GTGACTAAACCAGATACCCAAC[CG]GCCAACTCTCACTTGTGGCAGGGCCT
N                   LAF4, MLLT2-like sapiens AF4/FMR2 family, member 3 (AFF3), transcript
                               Homo       AF4/FMR2 cg17356467
                                                      family, member 3 isoform 2
          CCATACTCTCCTGGTTTTTGTCAGG[CG]GTCTCTCACACTGGCAGGCTTCCATT variant 2, mRNA.
N                   FETA, HPAFPHomo sapiens alpha-fetoprotein (AFP), mRNA.
                                          alpha-fetoprotein precursor
                                                      cg10778295
          CCCCCAGTGATTCTAATGTGTAGCCAAGAT[CG]GGAACCCTTGTAGACAGGGAT
Y                   AT1, AG2S, AT1B, AT2R1, HAT1R, AGTR1A, type 1 1 (AGTR1), AT2R1B variant 1, mRNA.
                               Homo sapiens angiotensin II receptor, type AT2R1A, transcript
                                          angiotensincg20530314 AGTR1B,
                                                       II receptor,
          GGTGAACGCTGATCTGATAGTTGACA[CG]GGACGACTGTGGCATCATCCT
Y                   AT1, AG2S, AT1B, AT2R1, HAT1R, AGTR1A, type 1 1 (AGTR1), AT2R1B variant 1, mRNA.
                               Homo sapiens angiotensin II receptor, type AT2R1A, transcript
                                          angiotensincg22498996 AGTR1B,
                                                       II receptor,
          GGAGGAGGGAATGCAAAACAGAGCCT[CG]TCCCCGGAACCCAAGAAGCAGCAACGC
N                   AGT, SPT, Homo sapiensTLH6, AGXT1 aminotransferase
                               AGT1, SPAT, alanine-glyoxylate aminotransferase (oxalosis I; hyperoxaluria I; glycolicacidu
                                          alanine-glyoxylate
                                                      cg15446157
          GGTTCCCGAGCGGCAGGTTGGGTG[CG]GACCATGGCCTCTCACAAGCTGCTGGTGAC
N                   AGT, SPT, Homo sapiensTLH6, AGXT1 aminotransferase
                               AGT1, SPAT, alanine-glyoxylate aminotransferase (oxalosis
                                          alanine-glyoxylate
                                                      cg20657132
          GAGCTAAGCAGAATAAGAGGGGCTGGA[CG]TGCAGGACTCAGAGTGGGAGCG I; hyperoxaluria I; glycolicacidu
Y                   .          Homo sapiens aryl hydrocarbon receptor (AHR), mRNA.
                                          aryl hydrocarbon receptor
                                                      cg04315015
          CGGACCGCCAGCTCAGAACAGGGGCAGC[CG]TGTAGCCGAACGGAAGCTGG
Y                   .          Homo sapiens aryl hydrocarbon receptor (AHR), mRNA.
                                          aryl hydrocarbon receptor
                                                      cg04616961
          TTGCCTATGCACGAAGATGGCTACCGG[CG]GGGGGGGGCGTCCTTACGTCCTACGTC
N                   PYHIN4 Homo sapiens absent in melanoma 2 (AIM2), mRNA.
                                          absent in melanoma 2
                                                      cg05998059
          GGTGCTTACCTCCTGATCCCTGGGG[CG]ATCAGCAAACCGGGTCTGCCACC
N                   PYHIN4 Homo sapiens absent in melanoma 2 (AIM2), mRNA.
                                          absent in melanoma 2
                                                      cg17311798
          GTCAGCAGTCAGCCAAGTTTT[CG]ACCATCTTGGCTTTAACCAGTTGCGGCC
Y                   PKB, RAC, Homo sapiens v-akt murine thymoma viral oncogene homolog
                               PRKBA, MGC99656, RAC-ALPHAviral oncogene homolog 1
                                          v-akt murine thymoma
                                                      cg17052569
          TGCCGTGACCCTAGCAGAAGGGGCC[CG]AGACAGGTCAGGGACGAATCCCG 1 (AKT1), transcript variant 2,
Y                   CD246      Homo sapiens anaplastic lymphoma kinase (Ki-1) (ALK), mRNA.
                                          anaplastic lymphoma kinase Ki-1
                                                      cg02931220
          TTCGCAGGCACTGGAGCGGCCCCGG[CG]GCAGCAGCTGAGGGCGTTCAGG
Y                   CD246      Homo sapiens anaplastic lymphoma kinase (Ki-1) (ALK), mRNA.
                                          anaplastic lymphoma kinase Ki-1
                                                      cg14528334
          AGCCGCTGGATCGCATCTGCCTGGG[CG]CCCGCCACTTGCAGCTGGCTGAGCCG
Y                   LOG12      Homo sapiens arachidonate 12-lipoxygenase (ALOX12), mRNA.
                                          arachidonate 12-lipoxygenase
                                                      cg05878700
          GGGGCCTGGCTCTTCTCCGGGT[CG]TACAACCGCGTGCAGCTTTGGCTGGTCGG
Y                   LOG12      Homo sapiens arachidonate 12-lipoxygenase (ALOX12),
                                          arachidonate 12-lipoxygenase
                                                      cg22819332
          CCGTTGGCCTCACCCTGGCT[CG]GGCCCCTTTATCATCCTGCAGCTACG mRNA.
Y                   HOPS, TNAP, TNSALP, AP-TNAPcg03975786 liver/bone/kidney (ALPL), mRNA.
                               Homo sapiens alkaline phosphatase, phosphatase precursor
                                          tissue non-specific alkaline
          TGCCGACGGTAAAGACAAAACAGGAGACG[CG]CGCAAGGAGCAGGTCAGAGCCCAGGC
Y                   HOPS, TNAP, TNSALP, AP-TNAPcg23352747 liver/bone/kidney (ALPL), mRNA.
                               Homo sapiens alkaline phosphatase, phosphatase precursor
                                          tissue non-specific alkaline
          GAGAGACAGGGACACGTGGGCAGAGA[CG]GATAAAGACAGAGACCCAGAGAAAGCC
N           HPAO, VAP1, VAP-1 amine oxidase, copper containing 3 precursor
                       Homo sapiens amine oxidase, copper containing 3 (vascular adhesion protein 1) (AOC3), m
                                             cg14591538
    AATCCTGTGGCCTGCCTCCC[CG]ACCTGGCAGCCTGTGTCCCGGACTTAC
Y           X11, X11A,Homo sapiens amyloid cg18505908 protein-binding, family A, member 1
                       MINT1, D9S411E, X11ALPHA precursor protein-binding,
                                 amyloid beta A4 precursor
                                              beta (A4)
    CGGGAGCAGGCGGCGCTAGTGACAG[CG]CTGGTGCCAAGCCTGGGAATA family A, member 1 (X11) (APBA
Y           X11, X11A,Homo sapiens amyloid cg05223973 protein-binding, family A, member 1
                       MINT1, D9S411E, X11ALPHA precursor protein-binding, family A, member 1 (X11) (APBA
                                 amyloid beta A4 precursor
                                              beta (A4)
    GAGTGACTCCCGAGCTTTCC[CG]CTTCCCAGGCCCCTTAGATATCG
N           X11L, MINT2, LIN-10, HsT16821, MGC99508, D15S1518E,
                       Homo sapiens amyloid cg20840847 protein-binding, family
                                 amyloid beta A4 precursor
                                              beta (A4) precursor protein-binding, family A, member 2 (X11-like) (A
    TGAAGACTTGGGGGAGAATCA[CG]GTCAACTTGTGACGCTTGGTT MGC:14091A, member 2
N           X11L, MINT2, LIN-10, HsT16821, MGC99508, D15S1518E, MGC:14091A, member 2
                       Homo sapiens amyloid cg17121025 protein-binding, family
                                 amyloid beta A4 precursor
                                              beta (A4) precursor protein-binding, family A,
    AGCATGCAGCTCTGCTACCTGTGGCC[CG]AAATCATTAGTTGTCCATACTCACTGACCTmember 2 (X11-like) (A
Y           GS, DP2, DP3, FAP, FPC,adenomatosis polyposis coli (APC), mRNA.
                       Homo sapiens DP2.5 cg24136097 coli
                                 adenomatosis polyposis
    TTTCCCTCGCACTGTCTTAAAC[CG]ATGGCCTTTCCTTGGCACAGGGTCC
Y           GS, DP2, DP3, FAP, FPC,adenomatosis polyposis coli (APC), mRNA.
                       Homo sapiens DP2.5 cg21634602 coli
                                 adenomatosis polyposis
    CCGACATGTGGCTGTATTGGTGCAGCC[CG]CCAGGGTGTCACTGGAGACAGAA
Y           GS, DP2, DP3, FAP, FPC,adenomatosis polyposis coli (APC), mRNA.
                       Homo sapiens DP2.5 cg05117367 coli
                                 adenomatosis polyposis
    CCTCCCCCGACTCTTTACTATG[CG]TGTCAACTGCCATCAACTTCCTTGCTTGC
N           MGC117399 omo sapiens apolipoprotein preproprotein mRNA.
                       H         apolipoprotein A-I A-I (APOA1),
                                             cg17542807
    GCTTGCAGGTCTCCCGGGTGGGGT[CG]GGGTTCCCTGCACTCATCCCCT
N           MGC117399 omo sapiens apolipoprotein preproprotein mRNA.
                       H         apolipoprotein A-I A-I (APOA1),
                                             cg09558982
    AGGCTGATAAGCCCAGCCC[CG]GCCCTGTTGCTGCTCACTGGTCCTGGCAAT
Y           .          Homo sapiens apolipoprotein precursor
                                 apolipoprotein C-I C-I (APOC1), mRNA.
                                             cg06342766
    CCCCTGCTTGTTCAATCGATCA[CG]ACCCTCTCACGTGCACCCACTTA
N           MGC75082Homo sapiens apolipoprotein C-II (APOC2), mRNA.
                                 apolipoprotein C-II precursor
                                             cg27593634
    GGGAAGGAAGAGTAGGGAGGT[CG]GGAAGGGTATCAAGGAATAACACC
Y           AAA, AD1, PN2, ABPP, APPI, CVAP, ABETA, CTFgamma
                       Homo sapiens amyloid cg03779431 precursor, isoform
                                 amyloid beta A4 protein
                                              beta (A4) precursor protein (peptidase nexin-II, Alzheimer disease) (A
    GCGGCGGGGCTCAGAGCCAGG[CG]AGTCAGCTGATCCGGCCCACCC b
Y           AAA, AD1, PN2, ABPP, APPI, CVAP, ABETA, CTFgamma
                       Homo sapiens amyloid cg04750566 precursor, isoform b
                                 amyloid beta A4 protein
                                              beta (A4) precursor protein
    GGCCGACGGCCCACCTGGGCTT[CG]TGAACAGTGGGAGGGAGAG (peptidase nexin-II, Alzheimer disease) (A
Y           KD, AIS, TFM, DHTR, SBMA, NR3C4, SMAX1, HUMARA
                       Homo sapiens androgen receptor (dihydrotestosterone receptor; testicular feminization; spin
                                 androgen receptor isoform 2
                                             cg20878850
    CTAGAGCTAGCCTCTCCTGCCCT[CG]CCCACGCTGCGCCAGCACTTGTTTCT
Y           KD, AIS, TFM, DHTR, SBMA, NR3C4, SMAX1, HUMARA
                       Homo sapiens androgen receptor (dihydrotestosterone receptor; testicular feminization; spin
                                 androgen receptor isoform 2
                                             cg01329401
    AGGAGGCCGGCCCGGTGGGGG[CG]GGACCCGACTCGCAAACTGTTGCATTT
Y           PKS2, A-RAF, ARAF1,v-raf murine sarcoma 3611 viral oncogene homolog
                       Homo sapiens v-raf murine sarcoma 3611 viral oncogene homolog
                                  RAFA1      cg07768416
    CCAATAAGGGTGGAAGGCTGAGTCC[CG]CAGAGCCAATAACGAGAGTCCGAGAGG (ARAF), mRNA.
Y           PKS2, A-RAF, ARAF1,v-raf murine sarcoma 3611 viral oncogene
                       Homo sapiens v-raf murine sarcoma 3611 viral oncogene homolog (ARAF), mRNA.
                                  RAFA1      cg06922569
    GAGCGCTTGCCCCAGATCTTGA[CG]TTTCAGGCGGCCCCTCCTAATC homolog
Y           AR, SDGF, Homo sapiens amphiregulin (schwannoma-derived growth factor) (AREG), mRNA.
                       CRDGF, MGC13647 cg04027823
                                 amphiregulin preproprotein
    CCTACAGACGTTCGCACACCTGGGTGCCAG[CG]CCCCAGAGGTCCCGGGACAGCCC
Y           AR, SDGF, Homo sapiens amphiregulin (schwannoma-derived growth
                       CRDGF, MGC13647 cg23375843
                                 amphiregulin preproprotein
    TCCGGAACTCCAGTCCTGCT[CG]CCCTCAAAAACGGCTTGCAGCTAGAGG factor) (AREG), mRNA.
N           10C, RGL1, MGC1295 Rho GTPase activating protein 9 9 (ARHGAP9), mRNA.
                       Homo sapiens Rho GTPase activating protein
                                             cg11953654
    TAAGGTCCCTGTCTTGCAGCTGGATAG[CG]GCAACTACCTCTTCTCCACTAGTGCAATC
N           10C, RGL1, MGC1295 Rho GTPase activating protein 9 9 (ARHGAP9),
                       Homo sapiens Rho GTPase activating protein
                                             cg11714628
    TAACCAGTGGCTGGAATGGGAAG[CG]ACAGAGCTGCAGGTAGGACTAAGGTAT mRNA.
N           D4, GDIA2,Homo sapiens Rho GDP RAP1GN1 inhibitor (GDI) beta (ARHGDIB), mRNA.
                       GDID4, LYGDI,GDP dissociation inhibitor (GDI) beta
                                 Rho Ly-GDI, dissociation
                                             cg15450139
    GCACATGTGCGAGCATGACAGCCCGTGTGA[CG]TGGAGATGCATGAATGTACACGCAAGA
Y           HIF1B, TANGO, HIF1BETA, HIF-1beta receptor nuclear translocator isoform
                       Homo sapiens aryl hydrocarbon receptor nuclear translocator (ARNT),
                                 aryl hydrocarbon
                                             cg14555435
    CCTTGCGTAAGAGGTCAATGACCGAGTAA[CG]TCATTGAAATGCAATTAAAATGGGT 2 transcript variant 2, m
N           ASB-4      Homo sapiens ankyrin cg14154704 box-containing protein
                                 ankyrin repeat andand SOCS box-containing 4 (ASB4), transcript variant 1, mRN
                                             repeat SOCS
    TCCTTGAGGCGCTAAAGTCCAATGACTT[CG]GAAAATTGAAGGCTATTTTGAT 4 isoform a
N           ASB-4      Homo sapiens ankyrin cg06784129 box-containing protein 4 isoform
                                 ankyrin repeat andand SOCS box-containing 4 (ASB4), transcript variant 1, mRN
                                             repeat SOCS
    TTTTGGATATTGGCTTGTCAGAGCAAGA[CG]CTGGATCTCCAGCCAGGCACCAGATGT a
N           ASB-4      Homo sapiens ankyrin cg19100779 box-containing protein 4 isoform
                                 ankyrin repeat andand SOCS box-containing 4 (ASB4), transcript variant 1, mRN
                                             repeat SOCS
    ACTCTCCAGCATGCGCCTGTTTGCT[CG]GTGCTGTTCTCTCGATAAATCACAACAAAG a
Y           ASH1, HASH1, MASH1 achaete-scute complex-like 1 (Drosophila) (ASCL1), mRNA.
                       Homo sapiens
                                 achaete-scute complex homolog-like 1
                                             cg23812196
    TCTGGCCAGGGAACGTGGAAGG[CG]CACCGACAGGGATCCGGCCAGG
Y           ASH1, HASH1, MASH1 achaete-scute complex-like 1 (Drosophila) (ASCL1), mRNA.
                       Homo sapiens
                                 achaete-scute complex homolog-like 1
                                             cg26578415
    ATTCTGTGGCTGCAGACGAGGAAG[CG]AAGGCTCAGAGAGGATGCCACTTC
Y           ASH2, HASH2, MASH2 achaete-scute complex-like 2 (Drosophila) (ASCL2), mRNA.
                       Homo sapiens
                                 achaete-scute complex homolog-like 2
                                             cg22073478
    GGTGCTTAGTGCGCCCCCAAAGCAAGGTA[CG]CAGGTCCTGGGTTGAGCCTTC
Y           ASH2, HASH2, MASH2 achaete-scute complex-like 2 (Drosophila) (ASCL2), mRNA.
                       Homo sapiens
                                 achaete-scute complex homolog-like 2
                                             cg15376678
    CCTAGCGCAGCTATGTCCCGAG[CG]CGCCCCCACCTGTGCGTTAATCTACTGG
Y           ASH2, HASH2, MASH2 achaete-scute complex-like 2 (Drosophila)
                       Homo sapiens
                                 achaete-scute complex homolog-like 2
                                             cg00868120
    GGGCCTGGAGGTCTGCACCCGAC[CG]CCTTGTGCCAGGACGGTCAGGT (ASCL2), mRNA.
Y           ATPVA, ATPVC, ATP10C,ATPase, Classtype 10A10A (ATP10A), mRNA.
                       Homo sapiens KIAA0566 V, V, type
                                 ATPase, Class
                                             cg06932470
    CCACTTTCAGATTCCGTTGTTGGG[CG]AACTAGACCGTTTCCTTTCCACC
Y           ATPVA, ATPVC, ATP10C,ATPase, Classtype 10A10A (ATP10A), mRNA.
                       Homo sapiens KIAA0566 V, V, type
                                 ATPase, Class
                                             cg18939241
    AGAAGGGGTGGGAGAATAAGCA[CG]GCATGGAAAAAGGAGCTGG
Y           AXIN, MGC52315 sapiens axin 1 (AXIN1), transcript variant 1, mRNA.
                       Homo      axin 1 isoform a
                                             cg24498552
    GGGGACCGCCACGGCCTGCCCGC[CG]CCGTGAGGGAAGCAGGCTCCCA
N           UFO        Homo sapiens AXL receptor tyrosine kinase (AXL), transcript variant 1,
                                 AXL receptor tyrosine kinase isoform 1
                                             cg20384525
    ACAGAGCCCAGAGGGACAGCGCCCAGAGCC[CG]GATAGAGAGACACGGCCTCACTGG mRNA.
Y           UFO        Homo sapiens AXL receptor tyrosine kinase (AXL), transcript
                                 AXL receptor tyrosine kinase isoform 1
                                             cg09524393
    GCCAGTAGCATGCCCCTGCC[CG]TCTGGGTCCCTCTGCGTGTCTCTGCTTGTC variant 1, mRNA.
N           B3T5, GLCT5, B3GalTx, B3GalT-V, beta3Gal-T5beta 1,3-galactosyltransferase, polypeptide 5 (B3GALT
                       Homo sapiens UDP-Gal:betaGlcNAc 1,3-galactosyltransferase 5
                                 UDP-Gal:betaGlcNAc beta
                                             cg11479877
    CACACTCCTGGCATCCCAG[CG]TCTCCAGCTTGCATGGCCTGTCACGGTATT
N           B3T5, GLCT5, B3GalTx, B3GalT-V, beta3Gal-T5beta 1,3-galactosyltransferase,
                       Homo sapiens UDP-Gal:betaGlcNAc 1,3-galactosyltransferase
                                 UDP-Gal:betaGlcNAc beta
                                             cg06700769
    GGGGGCAGTGACCTAGGCAGAGGG[CG]GGAGCCAGCAGATGGGATACACTCAG 5 polypeptide 5 (B3GALT
Y           Bax zeta Homo sapiens BCL2-associated X protein (BAX), transcript variant sigma, mRNA.
                                 BCL2-associated X protein isoform sigma
                                             cg04555391
    AGGTTCCTGGCTCTCTGATCCC[CG]TGTCCCGATCCCTGCCTCTCTGGC
Y           AU, LU, CD239, MSK19 basal cell adhesion molecule (Lutheran blood
                       Homo sapiens cell adhesion molecule isoform 2 precursor
                                 basal       cg12108695
    GGGGCCCCGCGGCTGCTGTTGCT[CG]CAGTCCTGCTGGCGGCGCACCCAGG group) (BCAM), transcript varia
Y           AU, LU, CD239, MSK19 basal cell adhesion molecule (Lutheran blood
                       Homo sapiens cell adhesion molecule isoform 2 precursor
                                 basal       cg18958184
    GGCTACGCTGGTCGATCAGGCCCCC[CG]CTGCAGGCGCTGGTCAGTAAGCCCgroup) (BCAM), transcript varia
Y           CDM, BAP31, 6C6-AG, DXS1357E
                       Homo sapiens B-cell receptor-associated protein 31 (BCAP31),
                                 B-cell receptor-associated protein 31
                                             cg08372952
    CCTGCAGCGGCTCCTGTGGCTCCTG[CG]GCTGCTGTTCCCCCGGGTCCTGTGCCmRNA.
Y           CDM, BAP31, 6C6-AG, DXS1357E
                       Homo sapiens B-cell receptor-associated protein 31 (BCAP31), mRNA.
                                 B-cell receptor-associated protein 31
                                             cg05632706
    GGGGCTGCTGGCCCTGCACTCGGC[CG]CCTTGGTGAGCCGCACCTTCCTGTCGG
Y           GRS, BFL1, HBPA1, BCL2L5
                       Homo sapiens BCL2-related protein A1 (BCL2A1), mRNA.
                                 BCL2-related protein A1
                                             cg27177709
    TGGGTGGCAGAGAACAGGGCCTCT[CG]AGGTGACTCTGGCAGTACCGCCC
N           BCLW, BCL-W, KIAA0271BCL2-like 2 (BCL2L2), mRNA.
                       Homo sapiens
                                 BCL2-like 2cg09582636
                                              protein
    TTGGGCTGCACTAGGGGGAAC[CG]GGAATAGAGATGGTGTCGG
N           BCLW, BCL-W, KIAA0271BCL2-like 2 (BCL2L2), mRNA.
                       Homo sapiens
                                 BCL2-like 2cg04542489
                                              protein
    CTGGAAAAGTTCAACAAGTGCATGGAACAT[CG]GAAACCTCCTGAAAATGCTAAATT
Y           BCL4, D19S37 sapiens B-cell CLL/lymphoma 3 (BCL3), mRNA.
                       Homo      B-cell CLL/lymphoma 3
                                             cg21016032
    GGGGCCCGTGGACCTGCGCACC[CG]GCCCAAGGCCGCCGGACTCC
Y           BCL4, D19S37 sapiens B-cell CLL/lymphoma 3 (BCL3), mRNA.
                       Homo      B-cell CLL/lymphoma 3
                                             cg02162810
    CGCTCCTGCAGCACCGGCCT[CG]GTCGCGCTGACTCTGGCCTGGTGTCCGTGT
Y           BCL5, LAZ3, BCL6A, ZNF51,lymphoma 6 protein6 (zinc finger protein 51)
                       Homo sapiens B-cell CLL/lymphoma
                                 B-cell ZBTB27
                                             cg20717875
    AGCAGATCGAGCTAAATGCACAAAAGGGAG[CG]AGAGGTTTGAACCACTGGGA (BCL6), transcript variant 2, m
Y           ALL, CML, PHL, BCR1, D22S11, D22S662 region (BCR), transcript
                       Homo sapiens breakpoint cluster
                                 breakpoint cluster region isoform 2
                                             cg01574123
    CTCTGACACGACGACTGGGCAGTGC[CG]GTGACGCTTATGGCACTGCGG variant 2, mRNA.
Y           ALL, CML, PHL, BCR1, D22S11, D22S662 region (BCR), transcript
                       Homo sapiens breakpoint cluster
                                 breakpoint cluster region isoform 2
                                             cg08146988
    TGCGTCTCCATGGAAGGTGCCCTC[CG]CATCGTTGGGCCAGATCTGCCTG variant 2, mRNA.
Y           MGC34632Homo sapiens brain-derived neurotrophic factor (BDNF), transcript
                                  brain-derived neurotrophic factor isoform a preproprotein
                                               cg17037622
    TGAGTTCTTACGTGATTCTAATGAATGAG[CG]AGGTTACCAATGATTGCCCAACTGCCvariant 5, mRNA.
Y           MGC34632Homo sapiens brain-derived neurotrophic factor
                                  brain-derived neurotrophic factor isoform a preproprotein
                                               cg18882544
    TGTCAGGCTAGGGCGGGAAGAC[CG]CTGGGGAACTTGTTGCTT (BDNF), transcript variant 5, mRNA.
Y           PGI, DSPG1, PG-S1, SLRR1A preproprotein
                        Homo sapiens biglycancg00993428
                                  biglycan      (BGN), mRNA.
    GGGTGTCCACAGATTTCCC[CG]GTGCTCTCTGTAGGCTGCTGATCCACGCCC
N           PGI, DSPG1, PG-S1, SLRR1A preproprotein
                        Homo sapiens biglycancg04929865
                                  biglycan      (BGN), mRNA.
    CCATCTCTCTTTCCTCTGCCTGG[CG]AGATGCCAGCCAGCACCTCAGTGTC
Y           API3, ILP1, Homo sapiens baculoviral IAP repeat-containing 4 (BIRC4), mRNA.
                        MIHA, XIAPbaculoviral IAP repeat-containing protein 4
                                               cg18694530
    GAGGCCCTGACGTGGACACACTT[CG]GGTTTCACGACTCCGGGTTTCTCC
Y           API3, ILP1, Homo sapiens baculoviral IAP repeat-containing 4 (BIRC4), mRNA.
                        MIHA, XIAPbaculoviral IAP repeat-containing protein 4
                                               cg00808980
    AGAAGAAACACTGGAGCTGGGGG[CG]GAGACTACGAGGTGCTCACTGCG
Y           API4, EPR-1 omo sapiens baculoviral IAP repeat-containing 5 (survivin) 1
                        H         baculoviral IAP repeat-containing protein 5 isoform
                                               cg06057942
    GGCGCGCCATTAACCGCCAGATTTGAATCG[CG]GGACCCGTTGGCAGAGGTG(BIRC5), transcript variant 1, mR
N           MGC10442Homo sapiens B lymphoid tyrosine kinase (BLK), mRNA.
                                  B lymphoid cg22826986
                                               tyrosine kinase
    GACAAAGCAAAACCAGTGAGGCTGAAAGAA[CG]GCTGCCCTGGTGCACACAGATGG
N           MGC10442Homo sapiens B lymphoid tyrosine kinase (BLK), mRNA.
                                  B lymphoid cg15742700
                                               tyrosine kinase
    AAACCCCAGAACTCTGCGTTGCTG[CG]TCTATTGACATGAACACCTGTCAAACCTGC
Y           BMP2A       Homo sapiens bone morphogenetic protein 2 (BMP2), mRNA.
                                  bone morphogenetic protein 2 precursor
                                               cg18126192
    AATAACTTGCGCACCCCACTTTG[CG]CCGGTGCCTTTGCCCCAGCGGAGC
Y           BMP2A       Homo sapiens bone morphogenetic protein 2 (BMP2), mRNA.
                                  bone morphogenetic protein 2 precursor
                                               cg26536259
    AAACTGAAAGTTGAATAACGGGCCCAG[CG]GGGAAATAAGAGGCCAGACCCT
Y           .           Homo sapiens bone morphogenetic protein 3 (osteogenic)
                                  bone morphogenetic protein 3 (osteogenic) precursor
                                               cg06290734
    ACCTGTCAGGCTGCGCTGGGTCAG[CG]CAGCAAGTGGGGCTGGCCGCTA (BMP3), mRNA.
Y           .           Homo sapiens bone morphogenetic protein 3 (osteogenic)
                                  bone morphogenetic protein 3 (osteogenic) precursor
                                               cg14573361
    CAGAGCTAGTCCTAGTCCCTCG[CG]CGGCCAGTTTGGCCGGGTGTTCCCA (BMP3), mRNA.
Y           ZYME, BMP2B, BMP2B1 bone morphogenetic protein 4 (BMP4), transcript variant 3, mRNA.
                        Homo sapiens morphogenetic protein 4 preproprotein
                                  bone         cg26240298
    CCCGGAAGCCCAGGCAGCGCCCGAGTC[CG]CAGCTGCCGTCGGAGCTGGG
Y           ZYME, BMP2B, BMP2B1 bone morphogenetic protein 4 (BMP4), transcript variant 3, mRNA.
                        Homo sapiens morphogenetic protein 4 preproprotein
                                  bone         cg09229893
    GGGGCTCACCTGGGGACCACGTG[CG]GAGGTACTAGAAAGCATGCACCGACT
Y           VGR, VGR1   Homo sapiens bone morphogenetic protein 6 (BMP6), mRNA.
                                  bone morphogenetic protein 6 precursor
                                               cg05319903
    GCCAGCGAGGCCCAGAGTGACCGCGCCG[CG]ACTCGCAGGAGCCAGGGCGCAGG
Y           VGR, VGR1   Homo sapiens bone morphogenetic protein 6 (BMP6), mRNA.
                                  bone morphogenetic protein 6 precursor
                                               cg08280813
    TTCGTGAGCGAGAAGGAAGTTAAACCT[CG]CGGAATAGACTGGCATTTCGG
Y           ALK3, CD292, ACVRLK3 bone morphogenetic protein receptor, type IA (BMPR1A), mRNA.
                        Homo sapiens morphogenetic protein receptor,
                                  bone         cg14602437
    AGGAGGGAGGAGGGCCAAGGG[CG]GGCAGGAAGGCTTAGGCTCG type IA precursor
Y           ALK3, CD292, ACVRLK3 bone morphogenetic protein receptor, typeprecursor
                        Homo sapiens morphogenetic protein receptor, type IA IA
                                  bone         cg27487510
    TTTCCAAATGGACGGAATGAGCCTC[CG]GAGGGTACACGAGGTCACCAGCGT (BMPR1A), mRNA.
Y           BMR2, PPH1, BMPR3,bone morphogenetic protein receptor typetype II (serine/threonine kinase) (BMPR
                        Homo sapiens boneT-ALK, BMPR-IIprotein receptor, II precursor
                                   BRK-3, morphogenetic
                                               cg15362398
    TGTATTGTGATACGGGCAGGATCAGTCCA[CG]GGAGAGAAGACGAGCCTCCCG
Y           BMR2, PPH1, BMPR3,bone morphogenetic protein receptor typetype II (serine/threonine kinase) (BMPR
                        Homo sapiens boneT-ALK, BMPR-IIprotein receptor, II precursor
                                   BRK-3, morphogenetic
                                               cg19618755
    GTTGAGGAAAGCAGGACGTCGATTACAG[CG]AACACATCAAAGGGGTGGTCTTT
Y           IRIS, PSCP, BRCAI, BRCC1, cancer 1, early onset isoform BRCA1-delta9-11
                        Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant BRCA1-delta9-11, m
                                  breast RNF53 cg00579360
    GCAATCGCCACCAGTCAATGGGGTGGT[CG]TTTTGAGGGACAAGTGGTAAGA
Y           M6, OK, 5F7, TCSF, CD147, EMMPRIN
                        Homo sapiens basigin (Ok blood group) (BSG), transcript variant 1, mRNA.
                                  basigin isoform 1
                                               cg17382033
    CTCTTCAAAGGTTTGGCTCGTTCAG[CG]CCCTCGTTCTTCGTTTCCTACTTCC
N           AT, ATK, BPK, XLA, IMD1, AGMX1, PSCTK1, MGC126261, kinase
                        Homo sapiens Bruton agammaglobulinemia tyrosine kinase (BTK), mRNA.
                                  Bruton agammaglobulinemia tyrosine MGC126262
                                               cg16763121
    CAGGACTTGGAAGGTGGGACT[CG]ATCGCAGCAGACACTGGCCCTGGAG
N           AT, ATK, BPK, XLA, IMD1, AGMX1, PSCTK1, MGC126261, kinase
                        Homo sapiens Bruton agammaglobulinemia tyrosine kinase
                                  Bruton agammaglobulinemia tyrosine MGC126262
                                               cg03791917
    GCAGCATGCTATCTGGTTCCCTGCTGC[CG]TCCCTATTCCACCCCCTCAAC (BTK), mRNA.
Y           Erv46, CGI-54, PRO0989, ERGIC and golgi breast cancer antigen 84 isoform mRNA.
                        Homo sapiens C20orf47, NY-BR-84, SDBCAG84, dJ477O4.2 2, b
                                  serologically defined 3 (ERGIC3), transcript variant
                                               cg12630922
    AGTTCCGAGCACAAGGCACA[CG]AACGGTGCTATTAGCGTTTCTAACCCCGC
N           CH, C4F, CO4, C4B1, C4B3, CPAMD3 component preproprotein
                        Homo sapiens complement
                                  complement component 4B 4B (Childo blood group) (C4B), mRNA.
                                               cg01672355
    GGCAGGGCTGGCATCGGGACC[CG]ATTCAGGAGTGAGGGAGAGCAG
N           CH, C4F, CO4, C4B1, C4B3, CPAMD3 component preproprotein
                        Homo sapiens complement
                                  complement component 4B 4B (Childo blood
                                               cg14877208
    CTCAGGCACTGGAATGAGAGGAGTTAA[CG]GGGAAGGACAGGGTTATTT group) (C4B), mRNA.
Y           CT, KC, CGRP, CALC1, CGRP1, CGRP-I, MGC126648
                        Homo sapiens calcitonin/calcitonin-related polypeptide, alpha (CALCA),
                                  calcitonin isoform CALCA preproprotein
                                               cg09068492
    TCCAACCTAGGGCACGAGCCTGGTATAAAT[CG]CGGACTAACAGAGACTATCTGATGAA transcript variant 2,
Y           CT, KC, CGRP, CALC1, CGRP1, CGRP-I, MGC126648
                        Homo sapiens calcitonin/calcitonin-related polypeptide, alpha (CALCA), transcript variant 2,
                                  calcitonin isoform CALCA preproprotein
                                               cg24117998
    AGGGGTCCTTTGCCCCTGGGTTG[CG]TCACCCTCATGCTTCCAGAACCTG
Y           CT, KC, CGRP, CALC1, CGRP1, CGRP-I, MGC126648
                        Homo sapiens calcitonin/calcitonin-related polypeptide, alpha
                                  calcitonin isoform CALCA preproprotein
                                               cg14988155
    GGCAGTGTCTCTGATGCCTCCCAG[CG]CCAGCGACTGCTCTTATTCCCGCCG (CALCA), transcript variant 2,
N           MCP, AFCP   Homo sapiens cappingcg13268943 filament), gelsolin-like (CAPG), mRNA.
                                  gelsolin-like protein (actin
                                                capping protein
    CTTTCTTCCTCCTACCTCTGCTT[CG]TAGGTTCGTCTTCCTTCCAGCCTGC
N           CD, ACUG,Homo sapiensNOD2, NOD2B, PSORAS1 family, member
                         BLAU, IBD1, caspase recruitment domain
                                  NOD2 protein cg23486288
    AGAGCTCCGAGTCACGTGGCTTGGG[CG]GGCCTCCCCTTCCTGGTGTCCA 15 (CARD15), mRNA.
N           CD, ACUG,Homo sapiensNOD2, NOD2B, PSORAS1 family, member
                         BLAU, IBD1, caspase recruitment domain
                                  NOD2 protein cg16771652
    ATTTCGCCTGAAGAGGGGAAGCC[CG]ACCAGGTAATAAAGGAGTAAGAGGAA 15 (CARD15), mRNA.
N           MCH4, ALPS2, FLICE2 caspase isoform a preproprotein
                        Homo sapiens
                                  caspase 10cg20209903
                                                10, apoptosis-related cysteine peptidase
    TTTGTTTTCAGGCAATTTCCCTGAGAAC[CG]TTTACTTCCAGAAGATTGGTGGAG (CASP10), transcript varian
N           MCH4, ALPS2, FLICE2 caspase isoform a preproprotein
                        Homo sapiens
                                  caspase 10cg14420164
                                                10, apoptosis-related cysteine peptidase (CASP10), transcript varian
    GAAAGCCTGAAGCACTTTGTGGCTTCCA[CG]GGTTCGTTTCTAGGAAGCTTTT
N           MCH4, ALPS2, FLICE2 caspase isoform a preproprotein
                        Homo sapiens
                                  caspase 10cg13782463
                                                10, apoptosis-related cysteine peptidase (CASP10), transcript varian
    TGTGGACATAAGAAAGGGTTAACATGGC[CG]ACAACTATTTCATGAGCTTTTTGGCTT
Y           ICH1, NEDD2, CASP-2, ICH-1L, ICH-1L/1S preproprotein
                        Homo sapiens caspase 2, apoptosis-related cysteine peptidase (neural precursor cell expres
                                  caspase 2 isoform 1
                                               cg26050838
    GAGAGGCACCGGGGTGATTTCCG[CG]GGAATCGATAACCAATCGGATTC
Y           CPP32, SCA-1, CPP32B caspase 3, apoptosis-related cysteine peptidase (CASP3), transcript variant a
                        Homo sapiens
                                  caspase 3 preproprotein
                                               cg15495273
    CTCTGGGAAGAAGAGGAGCAGGC[CG]GGACGCCCACCGGTAATTTCTG
Y           MCH2        Homo sapiens caspase 6, apoptosis-related cysteine peptidase (CASP6), transcript variant a
                                  caspase 6 isoform alpha preproprotein
                                               cg07942426
    TCCAGGCCCGCTGGGACTAAC[CG]TGCCCTGGGGACATGCCAGTTGCCAC
Y           MCH2        Homo sapiens caspase 6, apoptosis-related cysteine peptidase
                                  caspase 6 isoform alpha preproprotein
                                               cg20044306
    TGCCCTGGGGACATGCCAGTTGCCACC[CG]GGGGGACACACAGACCGCCTAGC (CASP6), transcript variant a
N           CAP4, MACH, MCH5, FLICE, MGC78473 A
                        Homo sapiens caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant A
                                  caspase 8 isoform
                                               cg05776114
    CCTTGCCCAGAGGCTGCGGGCTG[CG]GGTCAAGACATCAGTAGAAGGAGG
Y           CAV, VIP21, MSTP085caveolin 1 cg24980893 protein, 22kDa (CAV1),
                        Homo sapiens caveolin 1, caveolae
    CATACTGGGCATCTCTGCAGGCGCGT[CG]GCTCCCTCCACCCCTGCTGAGAT mRNA.
Y           CAV, VIP21, MSTP085caveolin 1 cg07838272 protein, 22kDa (CAV1),
                        Homo sapiens caveolin 1, caveolae
    GGCAGGATTGTGGATTGTTTCTGC[CG]CCTTGGTTGCCCATACTGGGCATC mRNA.
Y           CAV, MGC12294 sapiens caveolincg26774312
                        Homo      caveolin 2 isoform c transcript variant 2, mRNA.
                                                2 (CAV2),
    AAGGCCGTTGTCTTCCCTGGGA[CG]ACTTGCCAGCTCTGAGGCATGACAGTACGG
N           CCK-A, CCKRA, CCK1-R cholecystokinin A receptor (CCKAR), mRNA.
                        Homo sapiens
                                  cholecystokinin A receptor
                                               cg08845028
    CCGGCTCATTCCTCTAATGAC[CG]AAGCGTCTCGCAGATGCAACCTGCCG
N           CCK-A, CCKRA, CCK1-R cholecystokinin A receptor (CCKAR), mRNA.
                        Homo sapiens
                                  cholecystokinin A receptor
                                               cg12336680
    CCAGTACTCCTCTATATAGGAACC[CG]TCACCATCCCAGACATATGCAGAA
Y           GASR, CCK-B Homo sapiens cholecystokinin B receptor (CCKBR),
                                  cholecystokinin B receptor
                                               cg10802353
    GCACGCAGACCTGGTCTCCAA[CG]CCACCTCCACGTTCCCTGATACA mRNA.
Y           GASR, CCK-B Homo sapiens cholecystokinin B receptor (CCKBR), mRNA.
                                  cholecystokinin B receptor
                                               cg08254087
    CGCAGCGAGGAGCTGCAGGGAACTA[CG]GTAGCAATAGTGTCACGGTCACTGCGG
N           MIP1A, SCYA3, G0S19-1, chemokine (C-C motif) ligand 3 (CCL3), mRNA.
                        Homo sapiens LD78ALPHA,motif) ligand 3
                                  chemokine cg21335375
                                               (C-C MIP-1-alpha
    AGCAGGTGACGGAATGTGGGCT[CG]AGTGTCAGCAGAGCCAAGAAAGGACTG
N           MIP1A, SCYA3, G0S19-1, chemokine (C-C motif) ligand 3 (CCL3), mRNA.
                        Homo sapiens LD78ALPHA,motif) ligand 3
                                  chemokine cg05481196
                                               (C-C MIP-1-alpha
    ATGTAGTGACTAGGGCGCTGTGTTAAA[CG]CTAGTTGTGGATCATAAAAATACTTT
Y           .           Homo sapiens cyclin A1 (CCNA1), mRNA.
                                  cyclin A1 cg27186533
    GCGATCCTCCAGTGCACTTGCCAGTTGTTC[CG]GACACATAGAAAGATAACGACGGGA
Y           .          Homo sapiens cyclin A1 (CCNA1), mRNA.
                                   cyclin A1 cg05780306
    CGCCGCTGATTGGCCGATTCAACAGACG[CG]GGTGGGCAGCTCAGCCGCATCG
Y           .          Homo sapiens cyclin Ccg24043820
                                   cyclin C isoform b
                                                 (CCNC), transcript variant 2, mRNA.
    GAGTTGCTGAGTGGGTCTAACCTAGG[CG]AAGTGGCTCAGATACGGGGTT
Y           BCL1, PRAD1, U21B31, D11S287E,(PRAD1: parathyroid adenomatosis
                       Homo sapiens cyclin D1 cyclin D1
                                   cyclin D1 cg08247756
    CCGATGCCAACCTCCTCAA[CG]ACCGGGTGCTGCGGGCCATGCTGAAGGCG 1) (CCND1), mRNA.
Y           BCL1, PRAD1, U21B31, D11S287E,(PRAD1: parathyroid adenomatosis 1)
                       Homo sapiens cyclin D1 cyclin D1
                                   cyclin D1 cg09551996
    TTCTCGTGGTCTCCCCAGGCTG[CG]TGTGGCCTGCCGGCCTTCCTAGTTGTCC (CCND1), mRNA.
Y           KIAK0002, MGC102758 cyclin D2 (CCND2), mRNA.
                       Homo sapiens D2 cg00814733
                                   cyclin
    CGGTGTGGCCACGCTCAGCGCAGACACCT[CG]GGCGGCTTGTCAGCAGATGCAG
Y           KIAK0002, MGC102758 cyclin D2 (CCND2), mRNA.
                       Homo sapiens D2 cg23124313
                                   cyclin
    GCTGCATCGGTGTGGCCACGCTCAG[CG]CAGACACCTCGGGCGGCTTGTCAGCA
Y           .          Homo sapiens cyclin D3 (CCND3), mRNA.
                                   cyclin D3 cg22537023
    ACTCACTACATCTTCACGAAAACT[CG]GAAACCGAGGCAACTGTCATTCAGTTGG
Y           CCNE       Homo sapiens cyclin isoform 2
                                   cyclin E1 E1 (CCNE1), transcript variant 2, mRNA.
                                                cg18621017
    AATGCACTGACGGATGAATGGACAGG[CG]GCCAGGAATAGCAGCCGGCCCCCAG
N           CKR5, CD195, CKR-5,chemokine CMKBR5, CC-CKR-55 5 (CCR5), mRNA.
                       Homo sapiens chemokine (C-C motif) receptor
                                    CCCKR5, cg21689024
                                                (C-C motif) receptor
    ACTTCTAAACACCATTACATTGGGATT[CG]AATTTCAACATGAATTTTTGGGGAACACAA
N           CD1        Homo sapiens CD1a antigen (CD1A), mRNA.
                                   CD1A antigen precursor
                                                cg19355763
    AACATTGAAGTCAAAATTCTGGGCTGG[CG]TACATTAGTTAGGAGCCCCCATTTTAG
N           CD1        Homo sapiens CD1a antigen (CD1A), mRNA.
                                   CD1A antigen precursor
                                                cg03528325
    TGGAGAAAAGGTGTTAGTTTGTACTGT[CG]CACAGGGCAGTCGTAGGAGACTCTG
N           T11, SRBCHomo sapiens CD2 antigen (p50), sheep red blood cell receptor (CD2), mRNA.
                                   CD2 antigen (p50), sheep red blood cell receptor
                                                cg20405187
    TGTAAAGAGAGGCACGTGGTTAAGCTCT[CG]GGGTGTGGACTCCACCAGTC
N           .          Homo sapiens CD34 antigen (CD34), transcript variant 1, mRNA.
                                   CD34 antigen isoform a
                                                cg19626977
    TTAGGAGGGAGGCTGGGTTGC[CG]CCGTCGAGGCCAAAAAAGGTG
N           .          Homo sapiens CD34 antigen (CD34), transcript variant 1, mRNA.
                                   CD34 antigen isoform a
                                                cg03583857
    ATCCTGTGCTGTGTGTGAGTGAAG[CG]TCAGGAGTGAGCAGGTATACGTGACT
N           .          Homo sapiens CD34 antigen (CD34), transcript variant 1, mRNA.
                                   CD34 antigen isoform a
                                                cg14637677
    GGCAGCCTAGTCTTGGGGACGTAGAGA[CG]GGAGAAAGGAGAAGCCAGCCT
Y           p50, Bp50, Homo sapiens CD40TNFRSF5 2 receptor superfamily member
                       CDW40, MGC9013, antigen (TNF precursor
                                   CD40 antigen isoform
                                                cg20698532
    CGGGCGCCCAGTGGTCCTGC[CG]CCTGGTCTCACCTCGCTATGGTTCGTCTGC 5) (CD40), transcript varian
Y           p50, Bp50, Homo sapiens CD40TNFRSF5 2 receptor superfamily member 5) (CD40), transcript varian
                       CDW40, MGC9013, antigen (TNF precursor
                                   CD40 antigen isoform
                                                cg26940394
    GGAACTTCCTCAGGCCTCTC[CG]CAGTGGAGCCTCTTTCGGTTCTGCCAGG
Y           IN, LHR, MC56, MDU2, MDU3, MIC4, Pgp1, CDW44, MUTCH-I,
                       Homo sapiens CD44 antigen (Indian blood group) (CD44), transcript variant
                                   CD44 antigen isoform 2 precursor
                                                cg13656027
    GAGAAGAAAGCCAGTGCGTCTCTGGG[CG]CAGGGGCCAGTGGGGCTCECMR-III, MGC10468 2, mRNA.
Y           IN, LHR, MC56, MDU2, MDU3, MIC4, Pgp1, CDW44, MUTCH-I, ECMR-III, MGC10468 2, mRNA.
                       Homo sapiens CD44 antigen (Indian blood group) (CD44), transcript variant
                                   CD44 antigen isoform 2 precursor
                                                cg20143092
    CTTGCTCCAGCCGGATTCAGAGAAATTTAG[CG]GGAAAGGAGAGGCCAAAGG
Y           S5.7, TAPA1, TSPAN28 CD81 antigen (target of antiproliferative antibody
                       Homo sapiensCD81 antigen cg04069951
    CGACAGCAGCTTGGGGACGCCTCCCG[CG]CCCAGCACGGTGCACCTGGGCCC 1) (CD81), mRNA.
Y           S5.7, TAPA1, TSPAN28 CD81 antigen (target of antiproliferative antibody 1) (CD81), mRNA.
                       Homo sapiensCD81 antigen cg26129028
    ACGCTGCATGCCTGTCCTCAGGCG[CG]GCCCTGCTGCCACCCCCTTGGG
Y           R2, 4F9, C33, IA4, ST6, GR15, KAI1,isoform TSPAN27
                       Homo sapiens CD82 antigen (CD82), transcript variant
                                   CD82 antigen SAR2, 1
                                                cg24700286
    AAAGTTCCTGGGCCCAGGC[CG]CCTCCTGATAGAGGCCCCGACTTAGG 1, mRNA.
N           B70, B7-2, LAB72, CD28LG2, MGC34413 2 precursor
                       Homo sapiens CD86 antigen (CD28 antigen ligand 2, B7-2 antigen) (CD86), transcript varian
                                   CD86 antigen isoform
                                                cg01878435
    AAGTTAGCTGGGTAGGTATACAGTCATTGC[CG]AGGAAGGCTTGCACAGGGTG
Y           5H9, BA2, P24, GIG2, MIC3, MRP-1, BTCC-1, DRAP-27, TSPAN29
                       Homo sapiens CD9 antigen (p24) (CD9), mRNA.
                                   CD9 antigen g04502700
                                                c
    CCGGAGACCAGCCTACAGC[CG]CCTGCATCTGTATCCAGCGCCAGGTCC
Y           5H9, BA2, P24, GIG2, MIC3, MRP-1, BTCC-1, DRAP-27, TSPAN29
                       Homo sapiens CD9 antigen (p24) (CD9), mRNA.
                                   CD9 antigen g01573484
                                                c
    GCGAGCGAAGGTTTGCAAGGAGACAGA[CG]AGGGCGAAATTAAGCCAGGCG
Y           5H9, BA2, P24, GIG2, MIC3, MRP-1, BTCC-1, DRAP-27, TSPAN29
                       Homo sapiens CD9 antigen (p24) (CD9), mRNA.
                                   CD9 antigen g19415774
                                                c
    CTGTCATCCCACCCAGACTG[CG]CGCTTCTAATTCCTCCTACCCCAC
Y           .          Homo sapiens cell division cycle 25B (CDC25B), transcript
                                   cell divisioncg00837159
                                                 cycle 25B isoform 2
    TGGAGCGAGCGAATCCTGGCCCAC[CG]CCTGCCCAACCGCGTGACCTTGA variant 2, mRNA.
Y           .          Homo sapiens cell division cycle 25B (CDC25B), transcript variant 2,
                                   cell divisioncg19418914
                                                 cycle 25B isoform 2
    CTCCTACGCTGGGCGCTTCTCCTG[CG]AATGACGTTTTGCTGCTGCTCAGCGCAGCC mRNA.
Y           UVO, CDHE, ECAD, LCAM, Arc-1,type 1 preproprotein (epithelial) (CDH1), mRNA.
                       Homo sapiens cadherin CD324 1, E-cadherin
                                   cadherin 1, cg18947377
                                                  1, type
    CTCAGCCAATCAGCGGTACGGGGGG[CG]GTGCCTCCGGGGCTCACCT
Y           UVO, CDHE, ECAD, LCAM, Arc-1,type 1 preproprotein (epithelial)
                       Homo sapiens cadherin CD324 1, E-cadherin
                                   cadherin 1, cg24310695
                                                  1, type
    CCCTCAGCCAATCAGCGGTA[CG]GGGGGCGGTGCCTCCGGGGCTCACC (CDH1), mRNA.
Y           OB, CAD11, CDHOB, OSF-4 11, 11, type 2, OB-cadherin (osteoblast)
                       Homo sapiens cadherin type 2 preproprotein
                                   cadherin cg05318914
    GAGGGTGGACGCAACCTCCGAGC[CG]CCAGTCCCTGGCGCAGGGCAAGCG (CDH11), mRNA.
Y           OB, CAD11, CDHOB, OSF-4 11, 11, type 2, OB-cadherin (osteoblast) (CDH11), mRNA.
                       Homo sapiens cadherin type 2 preproprotein
                                   cadherin cg23907145
    GAGAAGCCGAGGCTGCGAGAGGCAG[CG]AGATGGGCCTCGCAGAGGCT
Y           OB, CAD11, CDHOB, OSF-4 11, 11, type 2, OB-cadherin (osteoblast) (CDH11), mRNA.
                       Homo sapiens cadherin type 2 preproprotein
                                   cadherin cg13126606
    TCAGGGCTCAGATGGAGTCTGGAG[CG]ACTGAAGTTGGGCTCCAGGG
Y           CDHH       Homo sapiens cadherin preproprotein (heart) (CDH13), mRNA.
                                   cadherin 13cg15047333
                                                  13, H-cadherin
    GTGCATGAATGAAAACGCCGCCGGG[CG]CTTCTAGTCGGACAAAATGCAGCCGA
Y           CDHH       Homo sapiens cadherin preproprotein (heart) (CDH13), mRNA.
                                   cadherin 13cg08977371
                                                  13, H-cadherin
    CCGTATCTGCCATGCAAAACGAGGGAG[CG]TTAGGAAGGAATCCGTCTTGTAA
N           HPT1, CDH16, HPT-1,cadherin 17cg14353573
                       Homo sapiens cadherin precursor
                                    MGC138218 LI cadherin (liver-intestine) (CDH17),
                                                  17,
    CCATTCAGTGGTCGAGACTCTTGCTA[CG]ACTGGAGTATCTCCCCCGGGAACAC mRNA.
N           HPT1, CDH16, HPT-1,cadherin 17cg00368292
                       Homo sapiens cadherin precursor
                                    MGC138218 LI cadherin (liver-intestine) (CDH17),
                                                  17,
    ATTCCATCTCAAACACAAAAGA[CG]GAGCAGGGGCGCCATGTCTGAGCAATGACA mRNA.
N           HPT1, CDH16, HPT-1,cadherin 17cg01803859
                       Homo sapiens cadherin precursor
                                    MGC138218 LI cadherin (liver-intestine) (CDH17), mRNA.
                                                  17,
    CCAAAGTCTGCAAGAAACAAC[CG]ATAGCAAATTTCCCCCAAACAC
Y           CDHP, HJMD, PCAD cadherin 3, cg09665394
                       Homo sapiens cadherin 3, type 1, P-cadherin (placental) (CDH3), mRNA.
                                                type 1 preproprotein
    ATGCGGAGCCTCCGTTTTCAGT[CG]ACTTCAGATGTGTCTCCACTTTTTTCC
Y           CDHP, HJMD, PCAD cadherin 3, cg01296763
                       Homo sapiens cadherin 3, type 1, P-cadherin (placental) (CDH3),
                                                type 1 preproprotein
    GGAAGTTGTATCCAATTCAGAAACG[CG]GTCCTTCGGGACCTGCTAGTTTTATACCCmRNA.
Y           PISSLRE Homo sapiens cyclin-dependent kinase isoform 2
                                   cyclin-dependent kinase 10 (CDC2-like) 10 (CDK10),
                                                cg26843987
    GGAGCCAGATCTGGAGTGCGAGCAGATC[CG]TCTGAAGTGTATTCGTAAGGAGG transcript variant 2, mRNA
Y           PISSLRE Homo sapiens cyclin-dependent kinase isoform 2
                                   cyclin-dependent kinase 10 (CDC2-like) 10 (CDK10), transcript variant 2, mRNA
                                                cg12119029
    CCTGGAAGACCTTCACCTGGGTAAT[CG]CCGTGGCCTCCCACTACGGCGCAG
N           p33(CDK2)Homo sapiens cyclin-dependent kinase 2 (CDK2), transcript variant 2, mRNA.
                                   cyclin-dependent kinase 2 isoform 2
                                                cg01221216
    AGGCCCAGGATTCCTTTGCAA[CG]AGATTCCCGGCTTCCTGGTTTCCA
Y           PLSTIRE, MGC59692 cyclin-dependent kinase 6 6 (CDK6), mRNA.
                       Homo sapiens cyclin-dependent kinase
                                                cg19493914
    CGAAGTCCTCAACACAGACA[CG]ATTACATAGCCTCTGCCCAAGCGCGT
Y           PLSTIRE, MGC59692 cyclin-dependent kinase 6 6 (CDK6),
                       Homo sapiens cyclin-dependent kinase
                                                cg22184962
    AGCGGAAGGACTGTGGGTCCATC[CG]TGTGGGGCCGCAGAATGTG mRNA.
Y           P21, CIP1, Homo WAF1, CAP20, CDKN1, MDA-6, p21CIP1 1A (p21, Cip1) (CDKN1A), transcript variant
                       SDI1, sapiens cyclin-dependent kinase inhibitor
                                   cyclin-dependent kinase inhibitor 1A
                                                cg10762857
    GGCACTCAGAGGAGGTGAGAGAGCGG[CG]GCAGACAACAGGGGACCCCGG
Y           P21, CIP1, Homo WAF1, CAP20, CDKN1, MDA-6, p21CIP1 1A (p21,
                       SDI1, sapiens cyclin-dependent kinase inhibitor
                                   cyclin-dependent kinase inhibitor 1A
                                                cg23305046
    CACTTCGTGGGGAAATGTGTCCAG[CG]CACCAACGCAGGCGAGGGACTG Cip1) (CDKN1A), transcript variant
N           KIP1, CDKN4, P27KIP1 cyclin-dependent kinase inhibitor 1B (p27, Kip1)
                       Homo sapienscyclin-dependent kinase inhibitor 1B
                                                cg00334827
    AAGAGAAACGCTGGAATACTAGTATCGGA[CG]TTAGGACATGGTTGTGGTGTT (CDKN1B), mRNA.
Y           BWS, WBS, p57, BWCR, KIP2 cg08331513 inhibitor 1C 1C (p57, Kip2)
                       Homo sapiens cyclin-dependent kinase inhibitor
                                   cyclin-dependent kinase
    TCGCTCAGGCCTGGCCGGCACCCCT[CG]AGCACAGCGCACTTGGCCTGTGGA (CDKN1C), mRNA.
Y           BWS, WBS, p57, BWCR, KIP2 cg17511511 inhibitor 1C 1C (p57, Kip2) (CDKN1C), mRNA.
                       Homo sapiens cyclin-dependent kinase inhibitor
                                   cyclin-dependent kinase
    CTGCCAGCTCGGCCCTGGCCTG[CG]CCGGATGGGGTCTTCGGCTGCCCCC
Y           ARF, MLM,Homo sapiens cyclin-dependent kinase inhibitor isoform 4
                        p14, p16, p19, CMM2,cg16207427 inhibitorCDK4I, CDKN2,
                                   cyclin-dependent kinase TP16, 2A 2A (melanoma, p16, inhibits p16INK4, p16I
                                                 INK4, MTS1,
    CCAGGGCCGAGCTCGGCAGCCGCTG[CG]CCGCCCTTTGGCACCAGAGGTGA INK4a, p14ARF, CDK4) (CDKN2
Y           P15, MTS2, TP15,sapiens cyclin-dependent kinase inhibitor isoform 1
                       Homo INK4B  cyclin-dependent kinase inhibitor 2B 2B
                                                cg18731427
    CTCAGCTTCATTACCCTCC[CG]TCGTCCTTCTGCGGCTTGGGGCCCC (p15, inhibits CDK4) (CDKN2B), transcri
Y           P15, MTS2, TP15,sapiens cyclin-dependent kinase inhibitor isoform 1
                       Homo INK4Bcyclin-dependent kinase inhibitor 2B 2B
                                              cg25030222
    TCCACCGTTGGCCGTAAACTTAA[CG]ACACTCTTCCCTTCTTTCCCA (p15, inhibits CDK4) (CDKN2B), transcri
N           CDM, BAP31, 6C6-AG, DXS1357E
                       Homo sapiens B-cell receptor-associated protein 31
                                 B-cell receptor-associated protein 31
                                              cg18682265
    CAGACAGGTTCTACCTGTTCCAT[CG]GGTCCCAATTCCAGGGTCCAC (BCAP31), mRNA.
N           BGP, BGP1, BGPI
                       Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 1 (biliaryprecursor
                                 carcinoembryonic antigen-related cell adhesion molecule 1 isoform 1 glycoprote
                                              cg18176768
    GAGGAGAGCTTGGGCTCCAGGAA[CG]CTTCGAGCACGGCTGCTCTGTC
N           BGP, BGP1, BGPI
                       Homo sapiens carcinoembryonic antigen-related adhesion molecule 1 isoform 1 glycoprote
                                 carcinoembryonic antigen-related cell
                                              cg11811510
    TTGTCTGATCATGTGTGCTGGGG[CG]GGGTTTGTCCAGGAAGCTC cell adhesion molecule 1 (biliaryprecursor
Y           CEBP, C/EBP-alpha CCAAT/enhancer binding protein alpha
                       Homo sapiens CCAAT/enhancer binding protein (C/EBP), alpha
                                              cg11888955
    TCCAGGCCGCCGGGCTGCCAGGTC[CG]AGCACGCACAGGGAGAACTCTGCCC (CEBPA), mRNA.
Y           CEBP, C/EBP-alpha CCAAT/enhancer binding protein alpha
                       Homo sapiens CCAAT/enhancer binding protein (C/EBP),
                                              cg23071874
    TCCAGGCTACCCCTGTGATTC[CG]CGCAGAGGTACCTCTCGGAGGACGCC alpha (CEBPA), mRNA.
Y           CF, MRP7, Homo sapiens cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (
                       ABC35, ABCC7, TNR-CFTR, dJ760C5.1 conductance regulator, ATP-binding cassette (sub
                                 cystic fibrosis transmembrane
                                              cg05270674
    GTGCGTAGTGGGTGGAGAAAGC[CG]CTAGAGCAAATTTGGGGCCGG
Y           CF, MRP7, Homo sapiens cystic fibrosis transmembrane conductance
                       ABC35, ABCC7, TNR-CFTR, dJ760C5.1 conductance regulator, ATP-binding cassette (sub
                                 cystic fibrosis transmembrane
                                              cg24329417
    TCTAGGAAGCTCTCCGGGGAGC[CG]GTTCTCCCGCCGGTGGCTTCTTCTG regulator, ATP-binding cassette (
N           DKFZp781D1727 sapiens chromodomain helicase DNA binding protein 2 (CHD2),
                       Homo      chromodomain helicase DNA binding protein 2
                                              cg04650055
    TGCTCCAGTGCAACTTGAACACTAGGGAGG[CG]CTCTTGAGTTGTAAAAGTTACCCCTT mRNA.
N           DKFZp781D1727 sapiens chromodomain helicase DNA binding protein
                       Homo      chromodomain helicase DNA binding protein 2
                                              cg17404310
    CTTGGGTTACTGATTTAAAGGTGAT[CG]TGTTTGGACCATACTCTTGAATTTT 2 (CHD2), mRNA.
Y           RNF116, RNF196, FLJ10796
                       Homo sapiens checkpoint with forkhead and ring finger domains (CHFR),
                                 checkpoint with forkhead and ring finger domains
                                              cg00470794
    CGTTTTGCGGGGTCTTCCTGTTCTGAA[CG]CGCGTAACTTTTGCCTCAGTATCTCACTTC mRNA.
Y           RNF116, RNF196, FLJ10796
                       Homo sapiens checkpoint with forkhead and ring finger domains (CHFR), mRNA.
                                 checkpoint with forkhead and ring finger domains
                                              cg18592833
    GAAAGAGGAGTAAAGACGGCGAGACG[CG]TCCACGCAGGGGGAGTCTGT
Y           CGA        Homo sapiens chromogranin A (parathyroid secretory
                                 chromogranin A precursor
                                              cg15962606
    TCGAGCCCCGTGCAGGGGAGCTTG[CG]GGAGGATCGACCGACAGAC protein 1) (CHGA), mRNA.
Y           CGA        Homo sapiens chromogranin A (parathyroid secretory protein
                                 chromogranin A precursor
                                              cg02706439
    GGACACAAGGCAAATCGGTGGAATCGT[CG]AGGGGTGGAGGATCAGCCACA 1) (CHGA), mRNA.
N           YKL39, YKL-39 sapiens chitinase 3-like 2 (CHI3L2), transcript variant 3, mRNA.
                       Homo      chitinase 3-like 2 isoform c
                                              cg10045881
    TGCTTCTTTCGTGTAGGACAGGCTGT[CG]AAACCTCAGTGGATAAAAGACCTAGAG
N           YKL39, YKL-39 sapiens chitinase 3-like 2 (CHI3L2), transcript
                       Homo      chitinase 3-like 2 isoform c
                                              cg10675506
    TGATGAGGAAGGAGATTCAGGGC[CG]AGGGTGATACCAGGAGGCAGAvariant 3, mRNA.
N           CPER, CPE-R, CPETR, CPETR1,4 (CLDN4), hCPE-R
                       Homo sapiens claudin cg14826417mRNA.
                                 claudin 4 WBSCR8,
    CTGGATTCCTGGCTGTTCCCAGAA[CG]AGCTGCCTTTCCCCACCTTGCC
N           CLK, STY, CLK/STY CDC-like kinase 1 isoform 1 transcript variant
                       Homo sapiens CDC-like kinase 1 (CLK1),
                                              cg08898736
    CATGGTGCCTGCATCAGGCCCAA[CG]TGGGCAGCCAGCATACCTCCCTGTC 1, mRNA.
Y           KNO, MGC74745 sapiens collagen, XVIII XVIII, alpha 1 (COL18A1), transcript variant 3, mRNA.
                       Homo      alpha 1 type type collagen isoform 3 precursor
                                              cg26239725
    CGGGCAGCGGTGTTCACCTTC[CG]CATAAACCTGGGCTTCCTCGCGGGGCA
Y           KNO, MGC74745 sapiens collagen, XVIII XVIII, alpha 1 (COL18A1),
                       Homo      alpha 1 type type collagen isoform 3 precursor
                                              cg00309589
    CCCTGCAGGGGCCTTGCGGGC[CG]GAGGTGCCGGCTTCCTCCTCCGT transcript variant 3, mRNA.
Y           OI4, aa 694-711 sapiens collagen, Itype I, alpha 1 (COL1A1), mRNA.
                       Homo      alpha 1 type collagen preproprotein
                                              cg10100754
    CGTGCCCCAGCCAATCAGAGCTGCCTGGCC[CG]GCCCCCAATTTGGGAGTTGG
Y           OI4, aa 694-711 sapiens collagen, Itype I, alpha 1 (COL1A1), mRNA.
                       Homo      alpha 1 type collagen preproprotein
                                              cg13069732
    AGAAACTCCCGTCTGCTCCGA[CG]ACTGGCCCGGGCCCCTTTTATACTGTC
Y           OI4        Homo sapiens collagen, Itype I, alpha 2 (COL1A2), mRNA.
                                 alpha 2 type collagen
                                              cg22877867
    ACCCTAGGGCCAGGGAAACTTTTGC[CG]TATAAATAGGGCAGATCCGGGCTTT
N           OI4        Homo sapiens collagen, Itype I, alpha 2 (COL1A2), mRNA.
                                 alpha 2 type collagen
                                              cg16337370
    CAAAGCCTATCCTCCCTGTAGC[CG]GGTGCCAAGCAGCCTCGAGCCTGCTC
Y           OI4        Homo sapiens collagen, Itype I, alpha 2 (COL1A2), mRNA.
                                 alpha 2 type collagen
                                              cg26942275
    GACTGGACAGCTCCTGCTTTGATCGC[CG]GAGATCTGCAAATTCTGCCCATGTCGGGG
Y           .          Homo sapiens collagen, IV collagen isoform 5, precursor
                                 alpha 3 type type IV, alpha 3 (Goodpasture antigen) (COL4A3), transcript variant
                                              cg02171478
    CAGGCCGCAGGTGCTCCTGCTGC[CG]CTCCTGCTGGTGCTCCTGGCGGCGGCGCC
Y           .          Homo sapiens collagen, IV collagen isoform 5, precursor
                                 alpha 3 type type IV, alpha 3 (Goodpasture antigen) (COL4A3), transcript variant
                                              cg26187391
    GGCGCCTTACCTGTGGGGACGCC[CG]CAGCGCCAGGAGCTGCCGCCTTG
Y           OPLL       Homo sapiens collagen, type alpha 1 precursor
                                 collagen, type VI, VI, alpha 1 (COL6A1), mRNA.
                                              cg22734035
    TGACACGGGAACTGAACTGCAGGCCG[CG]GCGAGCCAGCCAGGGAAACCGC
Y           OPLL       Homo sapiens collagen, type alpha 1 precursor
                                 collagen, type VI, VI, alpha 1 (COL6A1), mRNA.
                                              cg16354533
    GAAGAGGCGAGTGAGCCTGCCCGTG[CG]TCCCGCATGGAGACGTCTGGA
N           .          Homo sapiens catechol-O-methyltransferase (COMT),
                                 catechol-O-methyltransferase isoform S-COMT
                                              cg24164157
    GGGCTCCAGATAGCGGTGAGAGATCC[CG]CTTCAAGACTGGGTTGGG transcript variant S-COMT, mRNA.
Y           2-COP, FLJ11781sapiens coatomer protein complex, subunit gamma 2 (COPG2), mRNA.
                       Homo      coatomer protein complex, subunit gamma 2
                                              cg21921666
    GGGGTCTGTGTTCACCCGATGAC[CG]TGGCCTTTTTGATAATCCACTGCGGGGCC
N           CPA3       Homo sapiens carboxypeptidase preproprotein
                                 carboxypeptidase A4 A4 (CPA4), mRNA.
                                              cg01796223
    CTTGACTCAGCCACTGTATGACTGACTCCC[CG]GGGACATGAGGTGGATACT
N           CPA3       Homo sapiens carboxypeptidase preproprotein
                                 carboxypeptidase A4 A4 (CPA4), mRNA.
                                              cg00845900
    CACTGATCCTCTCTGTTTTCTTTGC[CG]TATTCAGTGTTAAGCACAGTAAGTCTTTCC
N           CPA3       Homo sapiens carboxypeptidase preproprotein
                                 carboxypeptidase A4 A4 (CPA4), mRNA.
                                              cg26442210
    TCTTCCATTTATTCAGCTGTGACTTGG[CG]GAAAGGACACCAGACCCACAGT
Y           CPN1, COPN1, MGC1142copine Icg25855788
                       Homo sapiens
                                 copine I      (CPNE1), transcript variant 4, mRNA.
    ATTCAGTCCCTGCTTGCGACTGTTGG[CG]CACAGGACCGACCTTGGGCTAGTGGCC
Y           CREB, MGC9284 sapiens cAMP responsive element binding protein 1 (CREB1), transcript variant B, mR
                       Homo      cAMP responsive element binding protein 1 isoform
                                              cg22617735
    TGTAGAAAACAGGCTGAGGAAAGAAAG[CG]ACACAGGATGTTGTCTGGAGAAA B
Y           CBP, RTS, Homo sapiens CREB binding protein (Rubinstein-Taybi syndrome) (CREBBP), mRNA.
                       RSTS      CREB binding protein
                                              cg18797283
    AGTGAGGGGGCCTCACGCCTGTT[CG]CATCCCAAGGCGGCAGGGCAGACACC
Y           CRHP, CRIP, CRP1 cysteine-rich protein 1 (intestinal)
                       Homo sapiens cysteine-rich protein 1 (intestinal) (CRIP1), mRNA.
                                              cg05417129
    AGACATCACAGCGCTGGGCTAGGGGCG[CG]GCTTGAACTCGCCTAAAGAGCTG
Y           CRHP, CRIP, CRP1 cysteine-rich protein 1 (intestinal)
                       Homo sapiens cysteine-rich protein 1 (intestinal) (CRIP1), mRNA.
                                              cg03324382
    CCTCAACTTTGCAGCGTACTTGGAC[CG]CTCTGGCCGCCCTGGGCGCTACCC
Y           CRKII      Homo sapiens v-crk sarcoma virus CT10 oncogene homolog
                                 v-crk sarcoma virus CT10 oncogene homolog isoform b
                                              cg16557332
    AGCTTCTCCACAGACCAGCTGA[CG]TTCTCATTTTCATTGATTCACCTAGGAC (avian) (CRK), transcript varian
Y           MCSF, MGC31930
                       Homo sapiens colony stimulating factor 1 (macrophage) (CSF1), transcript variant 2, mRNA.
                                 colony stimulating factor 1 isoform b precursor
                                              cg25479038
    TTTGCTGAAGGCTTGGAAGTGCAG[CG]CAGAAGACAGAGGGTGACTAGGAA
Y           MCSF, MGC31930
                       Homo sapiens colony stimulating factor 1 (macrophage) (CSF1), transcript variant 2, mRNA.
                                 colony stimulating factor 1 isoform b precursor
                                              cg06450700
    GGAAAGTCCCTTGGGACGATCATAGAG[CG]CTAGCACTGAATCAGCCTGGAGAGCG
N           FMS, CSFR, FIM2, C-FMS, CD115
                       Homo sapiens colony stimulating factor 1 receptor, formerly
                                 colony stimulating factor 1 receptor precursor
                                              cg15226392
    TTCTCCTCACTTCGTGCTCTCA[CG]CTTTTGGACACTCTGTCTGCCCTTCTCC McDonough feline sarcoma vira
N           FMS, CSFR, FIM2, C-FMS, CD115
                       Homo sapiens colony stimulating factor 1 receptor, formerly McDonough feline sarcoma vira
                                 colony stimulating factor 1 receptor precursor
                                              cg01875467
    TCTAGCAGCTGCCTGTCACAGAGCA[CG]CCGGCCTCAATCCGGGCCTGTGGGC
N           GMCSF, MGC131935 colony stimulating factor 2 precursor
                       Homo sapiens colony stimulating factor 2 (granulocyte-macrophage) (CSF2), mRNA.
                                              cg08625965
    CAGCTGGCCCCTGACTGGCCA[CG]CCTGTCAGCTTGATAACATGACATTTTCCT
N           GMCSF, MGC131935 colony stimulating factor 2 precursor
                       Homo sapiens colony stimulating factor 2 (granulocyte-macrophage) (CSF2), mRNA.
                                              cg21708430
    GAAGCTTGCTGAGAGTGGCTGCAGTCT[CG]CTGCTGGATGTGCACATGGTG
N           GCSF, G-CSF, MGC45931 stimulating factor 3 isoform c
                       Homo sapiens colony stimulating factor 3 (granulocyte) (CSF3), transcript variant 3, mRNA.
                                 colony       cg05410460
    GGAACAGCATGTCTCCTGAGCC[CG]CTCTGTCCCCAGCCCTGCAGCTGCT
N           GCSF, G-CSF, MGC45931 stimulating factor 3 isoform c
                       Homo sapiens colony stimulating factor 3 (granulocyte) (CSF3),
                                 colony       cg17037194
    CACAGGCTGCTGCCGCTTCCAGG[CG]TCTATCAGCGGCTCAGCCTTTGTTCAGC transcript variant 3, mRNA.
N           CD114, GCSFR sapiens colony stimulating factor 3 receptor (granulocyte)
                       Homo      colony stimulating factor 3 receptor isoform d precursor
                                              cg07285167
    CTCACTGCTCCCCTCTTCATTA[CG]TATTCTGTGCATTGCCCATAGACCAGGCA (CSF3R), transcript variant
N           CD114, GCSFR sapiens colony stimulating factor 3 receptor (granulocyte) (CSF3R), transcript variant
                       Homo      colony stimulating factor 3 receptor isoform d precursor
                                              cg00474419
    GCTTCTCTCCCCGAGCTCTGT[CG]TTAATGGCTCAGCCTCTGACAGGCCCG
Y           MGC117393 omo sapiens c-src tyrosine kinase (CSK), mRNA.
                       H         c-src tyrosine kinase
                                              cg00855228
    CCACTTTGATCAATTATTTCCTTGC[CG]TTGTCTGTCGGCCTGTCAGCCTACCCC
Y           VERSICAN, DKFZp686K06110 cg21708808
                       Homo sapiens chondroitin sulfate proteoglycan 2 (versican) (CSPG2), mRNA.
                                 chondroitin sulfate proteoglycan 2 (versican)
    TCTGGGGAAGAACTCCAGGCGTG[CG]GACGCAACAGCCGAGAACATTAGGTG
Y          VERSICAN, DKFZp686K06110 cg02861411
                       Homo sapiens chondroitin sulfate proteoglycan 2 (versican) (CSPG2), mRNA.
                                  chondroitin sulfate proteoglycan 2 (versican)
    CTCCCTCCTCCTTCTTCT[CG]CTGAGTCTCCTCCTCGGCTCTGACGGT
Y          PME, CST6, EPM1, STFB,cystatin cg14198176(CSTB), mRNA.
                       Homo sapiens cystatinB (stefin B)
                                  cystatin B B
    CCGGGCTATCAATTCCCACT[CG]CCCTTGCTGTATTCAGCGGAGCCCAA
Y          CTAG, ESO1, CTAG1,cancer/testis antigen 1B 1B (CTAG1B), mRNA.
                       Homo sapiens cancer/testis antigen
                                   LAGE-2, LAGE2B, NY-ESO-1
                                               cg11001103
    AGAGAAGGTCAGGGCCCACGAGGATG[CG]GAGGCAGAGAGGCTGCAGGAA
Y          CTAG, ESO1, CTAG1,cancer/testis antigen 1B 1B (CTAG1B), mRNA.
                       Homo sapiens cancer/testis antigen
                                   LAGE-2, LAGE2B, NY-ESO-1
                                               cg04138784
    CCGGGATCCTCAGGGCGCCTG[CG]CACAGGGGCCCTACTTCCGGCCC
Y          ESO2, CAMEL, LAGE-1, LAGE-2b, MGC3803isoform LAGE-1a
                       Homo sapiens cancer/testis antigen 2 (CTAG2), transcript variant 1, mRNA.
                                  cancer/testis antigen 2
                                               cg06715510
    GGCTGCAGCACCCAATTAAAGC[CG]TCTTCCCTGGTAATGCTCTTCGTCTCAGT
Y          CCN2, NOV2, IGFBP8, MGC102839 tissue growth factor (CTGF), mRNA.
                       Homo sapiens connective
                                  connective tissue growth factor
                                               cg04628203
    GGACGGGGCCCATACTGGCGG[CG]GTCATGGTTGGCACTGCGGGCGGAGCGGA
N          CCN2, NOV2, IGFBP8, MGC102839 tissue growth factor (CTGF), mRNA.
                       Homo sapiens connective
                                  connective tissue growth factor
                                               cg15155239
    GGTTTTGGGACAAGAAAGAGAACAAAGA[CG]CGTGTGACTCAGGATGCAGTCTCC
N          CD152, CTLA-4 sapiens cytotoxic T-lymphocyte-associated protein 4 (CTLA4),
                       Homo       cytotoxic T-lymphocyte-associated protein 4
                                               cg05074138
    AAGCCATGGCTTGCCTTGGATTTCAG[CG]GCACAAGGCTCAGCTGAACCTGGCTACC mRNA.
N          CD152, CTLA-4 sapiens cytotoxic T-lymphocyte-associated protein
                       Homo       cytotoxic T-lymphocyte-associated protein
                                               cg09093334
    GGTGATGAGGCCTGAAAGAGGCA[CG]TGGAAGGAAAGACAAATGCAGG4 4 (CTLA4), mRNA.
Y          CAP102, FLJ36832 catenin, alpha 1
                       Homo sapiens catenin cg18680057
                                               (cadherin-associated protein),
    CCGGCGTTGCCAGACTCTCTT[CG]CGGTGGGGGCCTTCCCTTTCCC alpha 1, 102kDa (CTNNA1), mRNA.
Y          CAP102, FLJ36832 catenin, alpha 1
                       Homo sapiens catenin cg12636713
                                               (cadherin-associated protein), alpha 1, 102kDa (CTNNA1), mRNA.
    CCCCTGAGCCTCACCTGTGCG[CG]GAGCGGTGACTCACCTGCCCTCGCG
Y          .           PREDICTED: Homo sapiens catenin (cadherin-associated
                                  similar to Beta-catenin isoform 10
                                               cg11124489
    GGCTCGGCCCGGTGATTCAGGT[CG]AAATTCAAGCTGAACAGCCTGCTGA protein), beta 1, 88kDa, transcrip
Y          CPSD, MGC2311 sapiens cathepsin D (lysosomal aspartyl peptidase) (CTSD), mRNA.
                       Homo       cathepsin D preproprotein
                                               cg08798756
    GAAGCTCCTTCCCTTAGGAGGT[CG]GGCACCTTTTGTCCACTCACGTCA
Y          CPSB, MGC1519,sapiens cathepsin H (CTSH), transcript variant 2, mRNA.
                       Homo minichain, DKFZp686B24257
                                  cathepsin H isoform b precursor
                                               cg16677243
    AAGGAGTTCACGCACAGTTCGGCGGCAC[CG]CAGACGGGGACTCCCAGGAGC
Y          CPSB, MGC1519,sapiens cathepsin H (CTSH), transcript variant 2, mRNA.
                       Homo minichain, DKFZp686B24257
                                  cathepsin H isoform b precursor
                                               cg23141159
    GATCTGCCTGGACTGGCTGGCACCGCG[CG]GGGAGGTCTCAGCCTGGCCTCTCCC
Y          MEP, CATL   Homo sapiens cathepsin L (CTSL), transcript variant 1, mRNA.
                                  cathepsin Lcg20035138
                                                preproprotein
    CTGAAACAGTCCACACAGGGCTTG[CG]GTAAACGTCTTTTCAGGAGCCACTCG
Y          MEP, CATL   Homo sapiens cathepsin L (CTSL), transcript variant 1, mRNA.
                                  cathepsin Lcg04737987
                                                preproprotein
    TCTGGGACAGTCAGTAAACAAGCCACGAAC[CG]CGCCAGGGATCAGAGCACCCAGAGTCC
Y          EMS1        Homo sapiens cortactin (CTTN), transcript variant 1, mRNA.
                                  cortactin isoform a
                                               cg16684429
    TAGAGCCTGGTGCCTGGGAGCGGCTGG[CG]CGGCGGAATCCAGGGCCGACCC
N          CMK, MIG, Homo sapiens chemokine (C-X-C motif) ligand 9 (CXCL9),
                       Humig, SCYB9, crg-10cg12793812 B9 precursor
                                  small inducible cytokine
    AAAGACTTGTGTTTGACTTGGCAGAT[CG]AAGTTATGAACTTTGGATAACTGGmRNA.
Y          AHH, AHRR, CP11, CYP1, P1-450,P450, family 1, subfamily A, polypeptide 1 1 (CYP1A1), mRNA.
                       Homo sapiens cytochrome P450, P450DX subfamily A, polypeptide
                                  cytochromecg27426425
                                                 P450-C, family 1,
    CGTCATTTTTGCACCCACTGGAA[CG]CTGGGCGTGCAGATGCCTCCCCAGC
Y          CP1B, GLC3A Homo sapiens cytochrome P450, family 1, subfamily B, polypeptide
                                  cytochromecg09991178 1, subfamily B,
                                                P450, family
    GTTGAGATTGAGACTGGGGGT[CG]GTGAGTGGCGTCAATTCCCATG polypeptide 1 1 (CYP1B1), mRNA.
Y          CP1B, GLC3A Homo sapiens cytochrome P450, family 1, subfamily B, polypeptide
                                  cytochromecg07057636 1, subfamily B,
                                                P450, family
    CCACGTTTCCATTGTGCGGTAAC[CG]CGCTTCATCACAGCCACCTCC polypeptide 1 1 (CYP1B1), mRNA.
N          CPE1, CYP2E, P450-J, P450C2E cg23093817 2, subfamily E, polypeptide
                       Homo sapiens cytochrome P450, family 2, subfamily E, polypeptide
                                  cytochrome P450, family
    CATGTCTGCCCTCGGAGTCAC[CG]TGGCCCTGCTGGTGTGGGCGGCCTTCCTC 1 1 (CYP2E1), mRNA.
N          CPE1, CYP2E, P450-J, P450C2E cg17336072 2, subfamily E, polypeptide 1
                       Homo sapiens cytochrome P450, family 2, subfamily E,
                                  cytochrome P450, family
    GCTGTTGCACCAGGAGGGCCGGTAC[CG]TGTCTAGAGGTGGTCGGCATGpolypeptide 1 (CYP2E1), mRNA.
Y          DOC2, DOC-2 Homo sapiens disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) (DAB2
                                  disabled homolog 2
                                               cg14937154
    TCCAGGCTACAGCGCAGCGGATG[CG]GCGGGCCTCGCTTAAATAGCCGCC
Y          DOC2, DOC-2 Homo sapiens disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila) (DAB2
                                  disabled homolog 2
                                               cg05390738
    TCCGTTCCCTGGATTGCCACTG[CG]AGTGATGTGGCACACGGAGTCATCCTAACC
Y          AIP1, AF9Q34, DIP1/2,DAB2 interacting protein isoform 1
                       Homo sapiens DAB2 interacting protein (DAB2IP), transcript variant 1, mRNA.
                                   KIAA1743 cg13907787
    GAGCCAGCCCAAGCTGGAC[CG]CAACCACAGCTTCCGCCACATC
Y          AIP1, AF9Q34, DIP1/2,DAB2 interacting protein isoform 1
                       Homo sapiens DAB2 interacting protein (DAB2IP),
                                   KIAA1743 cg15124045
    GGGAAGGAAAGTCGCCCGGAAT[CG]GGGTCTAAGTGGCCAGGGCA transcript variant 1, mRNA.
Y          AIP1, AF9Q34, DIP1/2,DAB2 interacting protein isoform 1
                       Homo sapiens DAB2 interacting protein (DAB2IP), transcript variant 1, mRNA.
                                   KIAA1743 cg27650175
    CTCAGCCGCCGCCTCAAGGGCTCCATCAAG[CG]CACCAAGAGCCAGCCCAAGCTGGACCG
Y          DAPK, DKFZp781I035 death-associated protein kinase 1 1 (DAPK1),
                       Homo sapiens death-associated protein kinase
                                               cg22630196
    CGGGGACTTTGTTCCCTCCG[CG]GAGGGGACTCGGCAACTCGCAGCGGC mRNA.
Y          DAPK, DKFZp781I035 death-associated protein kinase 1 1 (DAPK1), mRNA.
                       Homo sapiens death-associated protein kinase
                                               cg01984172
    CGGCAAGGAGCCGAGAGGCTGCTT[CG]GAGTGTGAGGAGGACAGCCG
Y          DAPK, DKFZp781I035 death-associated protein kinase 1 1 (DAPK1), mRNA.
                       Homo sapiens death-associated protein kinase
                                               cg17784577
    ATCCCAGTACACATCTCGGGA[CG]GAAGAACCGTGTTTCCCTAGAACCC
Y          FAM5A, DBCCR1 sapiens deleted cg06602847 1 1 (DBC1), mRNA.
                       Homo       deleted in bladder cancer
                                               in bladder cancer
    CTAGCAGCCTGGCTCATACTCAGC[CG]TAAAGTCCCCTTCGCTGGTCCC
Y          FAM5A, DBCCR1 sapiens deleted cg14445814 1 1 (DBC1), mRNA.
                       Homo       deleted in bladder cancer
                                               in bladder cancer
    GCACGAGCATCCAAAGGGACCGCGCATA[CG]CGCAAACCCGGAATCCTGGTGC
Y          CRC18, CRCR1 sapiens deleted cg13618363 carcinoma (DCC), mRNA.
                       Homo       deleted in colorectal carcinoma
                                               in colorectal
    GGTACCCAAGCTGGCTTTTGTACTCTT[CG]GAGCTTCCTTGTTCAGCGCGCATCTTC
Y          CRC18, CRCR1 sapiens deleted cg22444505 carcinoma (DCC), mRNA.
                       Homo       deleted in colorectal carcinoma
                                               in colorectal
    CTGTCAGTGGACAAGGAAAAAGGCTT[CG]AAGGCAGCAGAGGCGCAGGGG
Y          CRC18, CRCR1 sapiens deleted cg22055405 carcinoma (DCC), mRNA.
                       Homo       deleted in colorectal carcinoma
                                               in colorectal
    CCAACAGCATCTCCAGCTCT[CG]CGCGGAATTGTCTCTTCAACTTTACCCA
N          PG40, PGII, PGS2, DSPG2, SLRR1B c precursor variant C, mRNA.
                       Homo sapiens decorin cg15569988
                                  decorin isoform
                                               (DCN), transcript
    GTAAAGACAATCAAATGATTGGCTATGGAC[CG]TACCCGGACTGGTGTTTTGCC
Y          .           Homo sapiens damage-specific DNA binding protein 2, 48kDa (DDB2), mRNA.
                                  damage-specific DNA binding protein 2 (48kD)
                                               cg06860950
    GATGATCGCTTAAGCCCAGGAGTTAAAGAC[CG]GCCCGGACAACAAAGCGAGACCCC
Y          .           Homo sapiens damage-specific DNA binding protein 2, 48kDa (DDB2), mRNA.
                                  damage-specific DNA binding protein 2 (48kD)
                                               cg19486271
    AAAGGCACTAGCTCTCTACAAAGC[CG]CCACTCCCCAACTACACCCTGTAG
Y          CHOP, CEBPZ, CHOP10, DNA-damage-inducible transcript 3 (DDIT3), mRNA.
                       Homo sapiens GADD153, MGC4154
                                  DNA-damage-inducible transcript 3
                                               cg19520710
    GGGTCGAGATTTACAGCGGAGTCTCATCC[CG]GGACGTGTGAGTGCACTTCAGC
Y          CAK, DDR,Homo PTK3, RTK6, TRKE, CD167, EDDR1, MCK10, 1 isoform b transcript variant 2, mR
                       NEP, sapiens discoidin domain receptor family, member 1 (DDR1),
                                  discoidin domain receptor family, member
                                               cg26146308
    TTCCCCTCGTGGGCCCTGAG[CG]GGACTGCAGCCAGCCCCCTGGGG NTRK4, PTK3A
N          CAK, DDR,Homo PTK3, RTK6, TRKE, CD167, EDDR1, MCK10, 1 isoform b transcript variant 2, mR
                       NEP, sapiens discoidin domain receptor family, member 1 (DDR1),
                                  discoidin domain receptor family, member
                                               cg02680487
    GGCCTGGGCGTCTGGACCCC[CG]GGTCCCTTAGAACGCCCTTCAGA NTRK4, PTK3A
N          TKT, NTRKR3, TYRO10 discoidin domain receptor family, member 2 (DDR2),
                       Homo sapiens
                                  discoidin domain receptor family, member 2 precursor
                                               cg22740835
    GCGTTTTAAGTCAGACAAGGAAGGGAA[CG]TAATGAGGCACCACAGACTCGAGAAAT transcript variant 1, mR
N          TKT, NTRKR3, TYRO10 discoidin domain receptor family, member 2
                       Homo sapiens
                                  discoidin domain receptor family, member 2 precursor
                                               cg23028772
    TCCTCCCCTGTTGCCTACC[CG]CCCCTTTCACATGATCTCTGACTATAGCTG (DDR2), transcript variant 1, mR
Y          CSM1, CSM2, CMD1I, desmin
                       Homo sapiens desmin cg21174728
                                  FLJ12025, (DES), mRNA.
                                               FLJ39719, FLJ41013, FLJ41793
    GGCTCTAAGGGCTCCTCCAGCT[CG]GTGACGTCCCGCGTGTACCAGGTGTC
N          CSM1, CSM2, CMD1I, desmin
                       Homo sapiens desmin cg25310553
                                  FLJ12025, (DES), mRNA.
                                               FLJ39719, FLJ41013, FLJ41793
    TCACCCTAGCCTTCCTTATCTGA[CG]CCCACCCATGCCTCCTCAGGTA
Y          KIAA0018, SELADIN1,24-dehydrocholesterol reductase precursor
                       Homo sapiens 24-dehydrocholesterol reductase (DHCR24),
                                   Nbla03646, seladin-1
                                               cg22549094
    GAAACCTGGCGGTAACCTCTGCAGGT[CG]TGCCACTCGGTGTGCGCAAGGT mRNA.
N          KIAA0018, SELADIN1,24-dehydrocholesterol reductase precursor
                       Homo sapiens 24-dehydrocholesterol reductase (DHCR24), mRNA.
                                   Nbla03646, seladin-1
                                               cg04974532
    AGTTCACTGAGGCAGATGGGAGGCC[CG]GAGGAGAAAGAATGAAGGA
Y          D3, 5DIII, TXDI3, DIOIII deiodinase, iodothyronine, type III (DIO3), mRNA.
                       Homo sapiens
                                  deiodinase,cg18191511 type III
                                                iodothyronine,
    GGCCTGCAGCCACCATGCTC[CG]CTCCCTGCTGCTTCACTCCTTGAGGCTC
Y          D3, 5DIII, TXDI3, DIOIII deiodinase, iodothyronine, type III (DIO3), mRNA.
                       Homo sapiens
                                  deiodinase,cg26104543 type III
                                                iodothyronine,
    GGCCGCTGACCCAGGAACCGCGG[CG]CCCCGCTGGAACGAGATGG
Y          D3, 5DIII, TXDI3, DIOIII deiodinase, iodothyronine, type III (DIO3),
                       Homo sapiens
                                  deiodinase,cg25468490 type III
                                                iodothyronine,
    GCGGCAGCGGCTGCCGGAGTCCCC[CG]CCCCCGAGAGCTGGCTGCGG mRNA.
Y           ARHI, NOEY2Homo sapiens DIRAS family, GTP-binding RAS-like 3 (DIRAS3), mRNA.
                                 DIRAS family, GTP-binding RAS-like 3
                                              cg15101152
    GGGAGTGTGGGTAACAGGCATAGATTC[CG]CTTGCGCAATACGTGGTAAGAAACCAG
Y           ARHI, NOEY2Homo sapiens DIRAS family, GTP-binding RAS-like 3 (DIRAS3),
                                 DIRAS family, GTP-binding RAS-like 3
                                              cg16148134
    AGGGTCTGGCTCCAGTAGCCC[CG]GGTGCCTCTCACTCCTTGGGCGCAATGCT mRNA.
Y           DKC, NAP57, NOLA4, dyskerin dyskerin
                       Homo sapiens dyskeratosis congenita 1, dyskerin (DKC1), mRNA.
                                 XAP101, cg25312083
    CGGTGCAGGGTAACATGGCGGATG[CG]GAAGGTAAGGGCTGCAGGCT
Y           DKC, NAP57, NOLA4, dyskerin dyskerin
                       Homo sapiens dyskeratosis congenita 1, dyskerin (DKC1), mRNA.
                                 XAP101, cg09055253
    CGTTCAGCCGTGAGCCCAGGCGCAGGCG[CG]GAGCTAAACCCGGAGGTGAA
Y           .          Homo sapiens DKFZP564O0823 protein (DKFZP564O0823), mRNA.
                                 DKFZP564O0823 protein
                                              cg14481786
    GGATGGAGCAGAAGAGCGCGGAGCAC[CG]GAGGGCACGCAGCTGACGGA
N           .          Homo sapiens DKFZP564O0823 protein (DKFZP564O0823),
                                 DKFZP564O0823 protein
                                              cg22860750
    GTGGATGAGGGTTTAATGATGTACA[CG]CAGAAGTGTTTTGACAAATGAAGAAG mRNA.
N           HP, ARHGAP7, STARD12, FLJ21120, p122-RhoGAP 1 transcript variant 1, mRNA.
                       Homo sapiens deleted cg24545888 isoform
                                 deleted in liver cancer 1 1 (DLC1),
                                              in liver cancer
    AGTCCATAGCGTCTTACCTAGACAA[CG]AGGAGCTGAAACGCCAAGGCATGACACTGC
N           HP, ARHGAP7, STARD12, FLJ21120, p122-RhoGAP 1 transcript variant
                       Homo sapiens deleted cg00933411 isoform
                                 deleted in liver cancer 1 1 (DLC1),
                                              in liver cancer
    ACAACTGCTTCCATCTAGCATGGCAG[CG]TTCCTGAATCACATCTCTAAAGCCGCT 1, mRNA.
N           HP, ARHGAP7, STARD12, FLJ21120, p122-RhoGAP 1 transcript variant 1, mRNA.
                       Homo sapiens deleted cg08768218 isoform
                                 deleted in liver cancer 1 1 (DLC1),
                                              in liver cancer
    GGGAGGAGGGGAGAGCCCAGC[CG]CCTGGGCGTTTTAGGAGTTC
Y           MRX, MRX90, NEDLG, NE-Dlg, SAP102, KIAA1232
                       Homo sapiens discs, large homolog 3 (neuroendocrine-dlg, Drosophila) (DLG3), mRNA.
                                 synapse-associated protein 102
                                              cg17595272
    GGGCTACGGCGACTGGCAAGTCCC[CG]ACCCTTACGGGCCAGGTGGG
Y           MRX, MRX90, NEDLG, NE-Dlg, SAP102, KIAA1232
                       Homo sapiens discs, large homolog 3 (neuroendocrine-dlg, Drosophila) (DLG3), mRNA.
                                 synapse-associated protein 102
                                              cg16394734
    CCCATTCTCTGCTTGAGCTCC[CG]CTTCTTCTTTGCCGCTGGGCCTCGGC
Y           FA1, ZOG, Homo sapiensPref-1 1 cg20175079 (Drosophila) (DLK1), transcript variant 1, mRNA.
                       pG2, PREF1, delta-like 1 homolog
                                 delta-like homolog isoform 1
    CGCGTCCTCTTGCTCCTGCTGGCTTT[CG]GCCACAGCACCTATGGTGAGTTCCC
Y           DELTA1 Homo sapiens delta-like 1 (Drosophila) (DLL1), mRNA.
                                 delta-like 1 cg20095428
    TCCGGTGTCACAGCAAAGATC[CG]CGTCTTTCCGATGAATCCAGCCAAT
Y           DELTA1 Homo sapiens delta-like 1 (Drosophila) (DLL1), mRNA.
                                 delta-like 1 cg10810632
    TTTACATTCCTGCAAAATGTTCAC[CG]CAAGAATCCCCCTGCTTCTGGAGCT
N           .          Homo sapiens dentin matrix acidic phosphoprotein (DMP1), mRNA.
                                 dentin matrix acidic phosphoprotein
                                              cg18397653
    ATACCATGTAGAGAGAGATGGGAGAGCTG[CG]CTTTGGGTAAAAACAGTTCCTATTT
N           .          Homo sapiens dentin matrix acidic phosphoprotein (DMP1), mRNA.
                                 dentin matrix acidic phosphoprotein
                                              cg16043345
    CTGGAGGAAGTGTGGGTGTAC[CG]GGGTCCCGGTGACACCTTG
Y           MCJ, HSD18, DNAJD1DNAJ domain-containing subfamily C, member 15 (DNAJC15), mRNA.
                       Homo sapiens DnaJ (Hsp40) homolog,
                                              cg10157207
    CCTCAGGCACTACAGCTAGACTC[CG]AGCTTACTGGGCAGTCATCTGATTCGACCA
Y           MCJ, HSD18, DNAJD1DNAJ domain-containing subfamily C, member 15
                       Homo sapiens DnaJ (Hsp40) homolog,
                                              cg05035143
    GTGGTAGAACTGTGGCATTAAACAGAAGTG[CG]AACAGAAGTTGAGAGTGGGAAG (DNAJC15), mRNA.
Y           XIB, DNL1L, DNAS1L1deoxyribonuclease I-like 1 precursor
                       Homo sapiens deoxyribonuclease I-like 1 (DNASE1L1), transcript variant 4, mRNA.
                                              cg13544003
    CGCTCACCTGGACCCTGGCCAGCAGCGT[CG]TCATGGGCTTGGTGGGCAC
Y           XIB, DNL1L, DNAS1L1deoxyribonuclease I-like 1 precursor
                       Homo sapiens deoxyribonuclease I-like 1 (DNASE1L1),
                                              cg24108945
    CCAATCACCAGTCCTGCATGGA[CG]ACCCTCATCTCTGGGGTACCCGGG transcript variant 4, mRNA.
Y           XIB, DNL1L, DNAS1L1deoxyribonuclease I-like 1 precursor
                       Homo sapiens deoxyribonuclease I-like 1 (DNASE1L1), transcript variant 4, mRNA.
                                              cg18827179
    GACCGTGCACAACAGGGAGGTGCTGTA[CG]AGCTCATCGAGAAGCGAGGCCC
Y           DNMT, MCMT, CXXC9, MGC104992
                       Homo sapiens DNA (cytosine-5-)-methyltransferase 1 (DNMT1), mRNA.
                                 DNA (cytosine-5-)-methyltransferase 1
                                              cg15043801
    TTCAGGTGTGATGGGGATAAAGCAG[CG]AGAAGCCCCCAAGGGTTTGTGA
Y           PuMet, M.HsaIIP sapiens DNA (cytosine-5-)-methyltransferase 2 (DNMT2),
                       Homo      DNA methyltransferase 2 isoform a
                                              cg19579782
    ATGGCAGCCACTCTGTAGCCTGATTTA[CG]CTCCATTTCCTTCTTTGGTGTCAGGG transcript variant a, mRNA.
N           ICF, M.HsaIIIB sapiens DNA (cytosine-5-)-methyltransferase 3isoform 2
                       Homo      DNA cytosine-5 methyltransferase 3 beta beta
                                              cg14703690
    CTGCCCTCTCTGAGCCCC[CG]CCTCCAGGCCTGTGTGTGTGTCTCCGTTCG (DNMT3B), transcript variant 2, m
Y           DG2, DSC3, CDHF2, DGII/III, DKFZp686I11137 transcript variant Dsc2a, mRNA.
                       Homo sapiens desmocollin 2 (DSC2), preproprotein
                                 desmocollin 2 isoform Dsc2a
                                              cg08156793
    CTGCGCAAGGTGTTTCTCACCAG[CG]GACGCCACCTATAAGGCCCATCTC
N           DG2, DSC3, CDHF2, DGII/III, DKFZp686I11137 transcript variant Dsc2a, mRNA.
                       Homo sapiens desmocollin 2 (DSC2), preproprotein
                                 desmocollin 2 isoform Dsc2a
                                              cg20887958
    GGAATCAAGGCGACTGCAAAATAATAAAAT[CG]AGGGTGAGTTACTATAAGAAATGCATC
N           DG1, DSG,Homo sapiens desmoglein 1 (DSG1), mRNA.
                       CDHF4 desmogleincg20099449
                                               1 preproprotein
    GAGTGGATTCTGGTAAAAGTCCTTCATAAT[CG]TGCCCATTGTAAACAAGTGAAAACTTT
N           DG1, DSG,Homo sapiens desmoglein 1 (DSG1), mRNA.
                       CDHF4 desmogleincg13834042
                                               1 preproprotein
    CCCATCACCTGTATAACCCT[CG]GTATTTCTGTTCACTTTAAGAGCCTGCCAC
Y           DPI, DPII Homo sapiens desmoplakin (DSP), transcript variant 1, mRNA.
                                 desmoplakin isoform I
                                              cg13855473
    AAGAAACCGGCCAGGTGTGGCCTAGG[CG]CCCAGTGCCAGCGGGGAGGA
Y           DPI, DPII Homo sapiens desmoplakin (DSP), transcript variant 1, mRNA.
                                 desmoplakin isoform I
                                              cg11661951
    CCTCCTCACTGTGGTCCTAGTCAATG[CG]TGGTAGGTAGCGTTTCCAGTGATCAACAA
Y           BPA, BP240, BPAG1, MACF2, CATX-15, KIAA0465,variant 1eB, mRNA.
                       Homo sapiens dystonin (DST), transcript KIAA1470
                                 dystonin isoform 1eB precursor
                                              cg26669318
    GCGCTGCCTTCACCGGGGATGCTG[CG]CGGCGCATCTGCGGCATTTCCTGGCC
Y           BPA, BP240, BPAG1, MACF2, CATX-15, KIAA0465,variant 1eB, mRNA.
                       Homo sapiens dystonin (DST), transcript KIAA1470
                                 dystonin isoform 1eB precursor
                                              cg12152867
    GGACCGTGCGGCCAAGCACGCCCACCCC[CG]GACACTGGCTGCCCGGTCCC
Y           TYP, HVH2, MKP2, MKP-2 specificity phosphatase 4 isoform 1
                       Homo sapiens dual specificity phosphatase 4 (DUSP4), transcript variant 1, mRNA.
                                 dual         cg13071058
    CCTCCCGTGTATTTTTGCCGGT[CG]CGCGGCTCCTGTCGCCACTGGCGCC
Y           TYP, HVH2, MKP2, MKP-2 specificity phosphatase 4 isoform 1
                       Homo sapiens dual specificity phosphatase 4 (DUSP4),
                                 dual         cg24336078
    GGCATTAATTGCCGGAATGGTGTTC[CG]AGGGAGGAGAGCAGGCTGC transcript variant 1, mRNA.
Y           E2F-3, KIAA0075,sapiens E2F transcription factor 3 (E2F3), mRNA.
                       Homo MGC104598, DKFZp686C18211
                                 E2F transcription factor 3
                                              cg20252430
    CCTTTTGCACCTGCCAGACAT[CG]TCCGCATGGTCCAACTTGCCTTTGGCA
Y           E2F-5      Homo sapiens E2F transcription factor 5, p130-binding (E2F5), mRNA.
                                 E2F transcription factor 5
                                              cg04207142
    TGAGCAGTCAACCAACTTCAC[CG]CTCACAAACGTTTGGCCGCTAGGCATT
Y           ET1        Homo sapiens endothelin 1 (EDN1), mRNA.
                                 endothelin 1 cg02061638
    TCGCTGCCTTCTCTCCTGGCAGG[CG]CTGCCTTTTCTCCCCGTTAAAAGG
Y           ET1        Homo sapiens endothelin 1 (EDN1), mRNA.
                                 endothelin 1 cg21719114
    GCGCCTCTGCATCTGCGCCAGG[CG]AACGGGTCCTGCGCCTCCTGCAGTC
N           ETB, ETRB, HSCR, ABCDS, HSCR2 receptor type B (EDNRB), transcript variant
                       Homo sapiens endothelin
                                 endothelin receptor type B isoform 1
                                              cg20257673
    ATACCGAATTAAAGAAAGAAGAGGTTTATT[CG]GCCAGAAGCATCGGCAAGACTCCTG 1, mRNA.
N           ETB, ETRB, HSCR, ABCDS, HSCR2 receptor type B (EDNRB), transcript variant
                       Homo sapiens endothelin
                                 endothelin receptor type B isoform 1
                                              cg10792120
    GCAGACAGTGAACTGCTAAGATGGAATGTT[CG]TGCCTTATCCGAGAAATGTCCAAGTC 1, mRNA.
Y           B61, EFL1, Homo sapiens ephrin-A1 (EFNA1), transcript variant 2, mRNA.
                       ECKLG, EPLG1, LERK1, TNFAIP4
                                 ephrin A1 isoform b precursor
                                              cg19540825
    TTACACACTCGATCACACAAAG[CG]TTGCACTTTATTCCCGGCATCTAGGCG
Y           B61, EFL1, Homo sapiens ephrin-A1 (EFNA1), transcript variant 2, mRNA.
                       ECKLG, EPLG1, LERK1, TNFAIP4
                                 ephrin A1 isoform b precursor
                                              cg16016389
    CGGCCCAAAAGGCGGAGTCGCTAGG[CG]AAGGGGCCAGATCTGTGAGCC
Y           CFND, CFNS, EFL3, EPLG2, Elk-L, LERK2, MGC8782
                       Homo sapiens ephrin-B1 (EFNB1), mRNA.
                                 ephrin-B1 precursor
                                              cg09459058
    ACAGCAGTGGGAGGTTTGTGAGGCT[CG]CACTGGCCGCAGACCCTCGGGC
Y           CFND, CFNS, EFL3, EPLG2, Elk-L, LERK2, MGC8782
                       Homo sapiens ephrin-B1 (EFNB1), mRNA.
                                 ephrin-B1 precursor
                                              cg14717445
    CACACTCAGATTGGTGCCATCGGG[CG]CGCGGCGTCCTTAAGAGCTCCCTGAA
Y           CFND, CFNS, EFL3, EPLG2, Elk-L, LERK2, MGC8782
                       Homo sapiens ephrin-B1 (EFNB1), mRNA.
                                 ephrin-B1 precursor
                                              cg22151131
    GGCTAAGAGAGCAGGGTTGGCCTTG[CG]TTCGCCTGAGCAAGGGAGTAGACAG
Y           EFL6, EPLG8, LERK8 ephrin-B3 precursor
                       Homo sapiens ephrin-B3 (EFNB3), mRNA.
                                              cg20221774
    GACTGGTTTCCTCCCTTAGCC[CG]CTGCCCTCAATCCCAGCGAGGC
Y           EFL6, EPLG8, LERK8 ephrin-B3 precursor
                       Homo sapiens ephrin-B3 (EFNB3), mRNA.
                                              cg00000794
    ACAGGTAGTCGTGACGATCAGCTC[CG]CCGCACTTTGTAAAGCGCCAAGCCTTC
N           URG        Homo sapiens epidermal growth factor (beta-urogastrone) (EGF), mRNA.
                                 epidermal growth factor (beta-urogastrone)
                                              cg02437921
    AAAGATGCCCCAGGGCTGAGGCCTC[CG]CTCAGGCAGCCGCATCTGGGGTC
N           URG        Homo sapiens epidermal growth factor (beta-urogastrone) (EGF), mRNA.
                                 epidermal growth factor (beta-urogastrone)
                                              cg13379236
    CATAGCCAATATTTAGCAGTTCC[CG]CCATTCACCATGAGCACCTCCAC
N           URG        Homo sapiens epidermal growth factor (beta-urogastrone) (EGF), mRNA.
                                 epidermal growth factor (beta-urogastrone)
                                              cg12981092
    CCTGGAATGTGCACTGGTATTGACATTT[CG]TTCAAATAATGGGCTGAAGGTG
Y           ERBB, mENA, ERBB1 epidermal growth factor receptor isoform a
                       Homo sapiens epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) onco
                                              cg03543118
    GGGCAGCGCTCCTGGCGCTGCTGGCTG[CG]CTCTGCCCGGCGAGTCGGGCTCTGGA
Y           ERBB, mENA, ERBB1 epidermal growth factor receptor isoform a
                       Homo sapiens epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) onco
                                              cg24522859
    CAGTGCTGGGAACGCCCCTCT[CG]GAAATTAACTCCTCAGGGCACCCG
Y           NGFIC, NGFI-C, PAT133 early growth response 4 (EGR4), mRNA.
                      Homo sapiens growth response 4
                                 early        cg12688198
    GCGGTAGGGGTTCCCCGCAG[CG]CACAGACCTAGGCGCCCGGGCTCC
Y           NGFIC, NGFI-C, PAT133 early growth response 4 (EGR4), mRNA.
                      Homo sapiens growth response 4
                                 early        cg21111868
    TGACACTCAGTCCCCCTTAA[CG]TCAGTTTCTCACCTGTGCATTTCCTGTGGA
Y           PKR, PRKR, EIF2AK1,eukaryotic translation initiation factor 2-alpha kinase 2
                      Homo sapiens eukaryotic translation initiation factor
                                  MGC126524   cg23045112
    GGGACGCAGGATTGGCGAGTCC[CG]CCCCGGCTGGGCCTGCAGCC 2-alpha kinase 2 (EIF2AK2), mRNA.
Y           PKR, PRKR, EIF2AK1,eukaryotic translation initiation factor 2-alpha kinase
                      Homo sapiens eukaryotic translation initiation factor 2-alpha kinase
                                  MGC126524   cg01617117
    CTAGGGTTCTCCGCTGGCCTAGTC[CG]CTGGCCGCACTAGGTTCTCGAATCAAG 2 2 (EIF2AK2), mRNA.
Y           .         Homo sapiens ELK1, member of ETS oncogene family (ELK1), mRNA.
                                 ELK1 protein cg00983071
    CGGTGGCGTTGGCAATGTTGGCAGCTC[CG]GGGGGCGGGGGCTCCATACGCGGCC
Y           .         Homo sapiens ELK1, member of ETS oncogene family
                                 ELK1 protein cg12482901
    GCGGCGGCAGCACCTAGAAGC[CG]CCCCTGCGTTTCCCTACAGCTCAC (ELK1), mRNA.
Y           .         Homo sapiens ELK1, member of ETS oncogene family (ELK1), mRNA.
                                 ELK1 protein cg13072663
    TCCACGCCGATTGGCTCAAGGACTGA[CG]GACTGTGAGCAACTGAAAAGGC
Y           .         Homo sapiens ELK1, member of ETS oncogene family (ELK1),
                                 ELK1 protein cg11111083
    GAGGGCAGGATGGCTGTCAGGCACA[CG]AAAGAGCATTGAGTGGCAGAAACG mRNA.
Y           .         Homo sapiens ELK1, member of ETS oncogene family (ELK1),
                                 ELK1 protein cg15063983
    GAGGAGGAGGAGCCCAATGTCCCGC[CG]CTCGCTGATTGGCCAAAGCGCTAT mRNA.
Y           ERP, NET, Homo sapiens ELK3, ETS-domain protein (SRF accessory protein 2) (ELK3), mRNA.
                      SAP2       ELK3 protein cg11467837
    GGCCGAGGGCTGGCTTTTAAAACAC[CG]AAAACCCAGACAGGAACGGTGTCC
Y           Men, ELL1,Homo sapiens elongation DKFZp434I1916
                       C19orf17, ELL_HUMAN, factor RNA polymerase II (ELL), mRNA.
                                 elongation factor RNA polymerase II
                                              cg09597048
    ATCCCCACAGTCCCTGAG[CG]ATGGTGCAGTCCAGCTTCATTTTCCTATT
N           .         Homo sapiens egf-like cg15552238 mucin-like receptor 3
                                 egf-like module-containing
                                              module containing, mucin-like, hormone receptor-like 3 (EMR3), trans
    AGCAAACTGCTTCCCCTCTTT[CG]CCATCAGACTCATGGTTCTGCTTTTCGTTTisoform b
Y           .         Homo sapiens egf-like cg09872254 mucin-like receptor 3 isoform b
                                 egf-like module-containing
                                              module containing, mucin-like, hormone receptor-like 3 (EMR3), trans
    TGATTTACACAGGAACCGAGAGATTGGT[CG]GACTGGGTGTGCTGTTTG
N           .         Homo sapiens egf-like cg15746620 mucin-like receptor 3 isoform b
                                 egf-like module-containing
                                              module containing, mucin-like, hormone
    GGGATGATTGAGTTGGTAAACCCTAA[CG]AGGAAATGCCCTGAAAGTTACATCAC receptor-like 3 (EMR3), trans
Y           NRPB, CCL28, ENC-1,ectodermal-neural cortex (with BTB-like domain)
                      Homo sapiens ectodermal-neural cortex (with BTB-like domain) (ENC1), mRNA.
                                  PIG10, TP53I10
                                              cg27345700
    ATGCTCTAAAAAGGGCTGCAAGGGG[CG]AGCTGGGTATCCGCAGGACAGG
Y           EPH, EPHT, EPHT1 ephrin receptor EphA1
                      Homo sapiens EPH receptor A1 (EPHA1), mRNA.
                                              cg14407047
    GGGACAGTGGCCCGGATGGCAG[CG]CCAGGTTGCAAGGGACTAGGAGA
Y           EPH, EPHT, EPHT1 ephrin receptor EphA1
                      Homo sapiens EPH receptor A1 (EPHA1), mRNA.
                                              cg22178045
    AGACTGGTAATCAAATTCAAGAACCGGAGG[CG]TCTTGACCCGAATGAGACTGCG
Y           ECK       Homo sapiens EPH receptor A2 (EPHA2), mRNA.
                                 ephrin receptor EphA2
                                              cg15146752
    TCCAAAGTTTGAGCGTCTCAAAG[CG]CCAGCGCCCCTACGGATTAGCCC
N           ECK       Homo sapiens EPH receptor A2 (EPHA2), mRNA.
                                 ephrin receptor EphA2
                                              cg20350808
    GAGACTGAGCTCAATGCGACTGAGCTCAA[CG]CTGGCCTGAAGGTCTGAGCT
Y           ETK, HEK, Homo sapiensTYRO4 cg22619563
                      ETK1, HEK4, EPH receptor A3 (EPHA3), a precursor
                                 ephrin receptor EphA3 isoform transcript variant 1, mRNA.
    GGTAACTTCTCCAGCAATCAGAG[CG]CTCCCCCTCACATCAGTGGCATG
Y           ETK, HEK, Homo sapiensTYRO4 cg10315231
                      ETK1, HEK4, EPH receptor A3 (EPHA3), a precursor
                                 ephrin receptor EphA3 isoform transcript variant
    GGAGCATTTTTCTCAGCACCG[CG]GCCTCATCACATCTTCTGTGTTTCCTGTC 1, mRNA.
Y           CEK7, EHK1, HEK7, TYRO4 receptor EphA5 isoform b
                      Homo sapiens EPH receptor A5 (EPHA5), transcript variant 2, mRNA.
                                 ephrin       cg25798792
    GAGAAGGCACGTCCAGAGGGGAGCC[CG]TCGAGGTGCAGAGTAGCAGCCGGCC
Y           CEK7, EHK1, HEK7, TYRO4 receptor EphA5 isoform b
                      Homo sapiens EPH receptor A5 (EPHA5), transcript
                                 ephrin       cg02463418
    TGTCCCCCCTTGGGGTCCTA[CG]CCTTCTGGCACGCGGCTCCTCCAA variant 2, mRNA.
Y           EHK3, HEK11
                      Homo sapiens EPH receptor A7 (EPHA7), mRNA.
                                 ephrin receptor EphA7
                                              cg20253378
    ACCGTGTTTGCTGCCTGCAAGTCTC[CG]ACTGCAGACCGGCCGCTTGCTCCAC
Y           EHK3, HEK11
                      Homo sapiens EPH receptor A7 (EPHA7), mRNA.
                                 ephrin receptor EphA7
                                              cg24188617
    GTCCGAGGCAGGAGCCAATCGGTGC[CG]AGCGGAGTCAGGTTGCTGGT
Y           EEK, HEK3, KIAA1459EPH receptor A8 isoform 1 precursor
                      Homo sapiens EPH receptor A8 (EPHA8), transcript
                                              cg06991945
    GGACGTCCCGATGGTGGCTTCG[CG]CACTGGGGCCCTGAGCCCTG variant 1, mRNA.
Y           EEK, HEK3, KIAA1459EPH receptor A8 isoform 1 precursor
                      Homo sapiens EPH receptor A8 (EPHA8), transcript variant 1, mRNA.
                                              cg00665502
    TCACCTAAAAGTGCCTCTGAGTTTGC[CG]CTGAGCCCATCTCTGAGCCTCTGCCC
Y           ELK, NET, Hek6, EPHT2 EPH receptor B1 (EPHB1), mRNA.
                      Homo sapiens
                                 ephrin receptor EphB1 precursor
                                              cg23448029
    GGCTTGGTCTCGGCCTGCGGGC[CG]TCGGCCGGCGATGGCCCTGGATTATCTAC
Y           ELK, NET, Hek6, EPHT2 EPH receptor B1 (EPHB1), mRNA.
                      Homo sapiens
                                 ephrin receptor EphB1 precursor
                                              cg24704286
    TCTTGTCACAGAGAAGATGAACGAAGGCT[CG]TTTGATCATTTAAAGCGGATCCAGTCC
Y           DRT, ERK, Homo sapiens EPH receptor B2 (EPHB2), 2 precursor
                      Hek5, EPHT3, Tyro5, MGC87492 isoform transcript variant 2, mRNA.
                                 ephrin receptor EphB2
                                              cg18504545
    GCTGATTGACTGTGCCAGGAGGAGG[CG]AAGGGACCATCTTGCCGAGGC
Y           DRT, ERK, Homo sapiens EPH receptor B2 (EPHB2), 2 precursor
                      Hek5, EPHT3, Tyro5, MGC87492 isoform transcript variant 2, mRNA.
                                 ephrin receptor EphB2
                                              cg09003739
    AGGTGGGCCGTGCCCAGCGCTGG[CG]GAGCCCGGGTCCCCGTTCTGC
Y           ETK2, HEK2, TYRO6 ephrin receptor EphB3 precursor
                      Homo sapiens EPH receptor B3 (EPHB3), mRNA.
                                              cg08726111
    AGCGCTGGGGACAGCAGAAGTGAGTA[CG]TGAGCGGCGCAGCAAGATCCCAGCTC
Y           ETK2, HEK2, TYRO6 ephrin receptor EphB3 precursor
                      Homo sapiens EPH receptor B3 (EPHB3), mRNA.
                                              cg03013719
    ACACAAGCCTCTGTCTTGTCCATTG[CG]GTAGCACCCGCAGGTACTACAGTCTGACA
Y           HTK, MYK1, TYRO11 ephrin receptor EphB4 precursor
                      Homo sapiens EPH receptor B4 (EPHB4), mRNA.
                                              cg23143416
    CCGGAGCTCCATGGCGCCGCCTCACT[CG]GGTAGGATCCGAACTGAGTTT
Y           HTK, MYK1, TYRO11 ephrin receptor EphB4 precursor
                      Homo sapiens EPH receptor B4 (EPHB4), mRNA.
                                              cg22614265
    GGACCCCCGGGACAGGCCCGAACC[CG]GCTGGCACCAGGGAGCAGAGAA
Y           HEP       Homo sapiens EPH receptor B6 (EPHB6), mRNA.
                                 ephrin receptor EphB6 precursor
                                              cg22195019
    GGGGGCGCAGACCTGCAGAGACTG[CG]GCCAACGGGAAGGTGAGCC
Y           HEP       Homo sapiens EPH receptor B6 (EPHB6), mRNA.
                                 ephrin receptor EphB6 precursor
                                              cg01125514
    CTCAACCCTGCCTCCAGG[CG]CCAGCTGAGAGCACCTTGCACCGCC
N           MEH, EPHX, EPOX epoxide hydrolase 1, microsomal (xenobiotic)
                      Homo sapiens epoxidecg12837712 microsomal (xenobiotic) (EPHX1), mRNA.
                                               hydrolase 1,
    TCCCAAGGAGTAATCAGAGGGTGAGAA[CG]TGGAGCCTGGTGGACAGGT
N           MEH, EPHX, EPOX epoxide hydrolase 1, microsomal (xenobiotic)
                      Homo sapiens epoxidecg12786690 microsomal (xenobiotic) (EPHX1), mRNA.
                                               hydrolase 1,
    CAGAGTGGTGCCCTCTTGACTGAGCCT[CG]AGCCTTTGCTTTCCCCTTACTCCA
N           MEH, EPHX, EPOX epoxide hydrolase 1, microsomal (xenobiotic)
                      Homo sapiens epoxidecg23096144 microsomal (xenobiotic) (EPHX1),
                                               hydrolase 1,
    GCTGTGCAGAGTCCAGGGGAGATAACCA[CG]CTGTGCACACATGAGATTGGCTGACT mRNA.
Y           EPM2, MELFHomo sapiens epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) (EPM2A), t
                                 laforin isoform b
                                              cg04891988
    GAAGATCTTGGACCTGGTCTCTGGAG[CG]CTCCCTATCTTAACCAAGTCACTTACTC
Y           EPM2, MELFHomo sapiens epilepsy, progressive myoclonus type 2A, Lafora
                                 laforin isoform b
                                              cg17971650
    TCATAAGGAAGGGAATGACCTCTAGACAGC[CG]CCTTCTAATTGTGAAACGGGG disease (laforin) (EPM2A), t
Y           EP        Homo sapiens erythropoietin (EPO), mRNA.
                                 erythropoietin precursor
                                              cg13036038
    CGCCCGGGTCCCTGTTTGAG[CG]GGGATTTAGCGCCCCGGCTATTGGCC
Y           EP        Homo sapiens erythropoietin (EPO), mRNA.
                                 erythropoietin precursor
                                              cg18996250
    CCTGCCCCTGCTCTGACCC[CG]GGTGGCCCCTACCCCTGGCGACC
Y           .         Homo sapiens epidermal growth factor receptor pathway substrate
                                 epidermal growth factor receptor pathway
                                              cg20552127
    CAAGGGGCTCTTACCTCGGATC[CG]CCCTCGGGGCCACGGCTTTCC substrate 8 8 (EPS8), mRNA.
Y           .         Homo sapiens epidermal growth factor receptor pathway substrate
                                 epidermal growth factor receptor pathway
                                              cg15143831
    CACCCAGTCTGGCTGCACAGCT[CG]TAACCCCTGCCCTTTGGCGGCAAsubstrate 8 8 (EPS8), mRNA.
Y           ER, ESR, Era, ESRA, NR3A1, major ORF, DKFZp686N23123
                      Homo sapiens estrogen receptor 1 (ESR1), mRNA.
                                 estrogen receptor 1
                                              cg16246567
    CCCCCTGGAGCGGCCCCTGGG[CG]AGGTGTACCTGGACAGCAGCAAGCCCG
Y           NEU, NGL, Homo sapiens HER-2, c-erb B2, HER-2/neu
                      HER2, TKR1, v-erb-b2 erythroblastic leukemia viral oncogene
                                 erbB-2 isoform b
                                              cg18160059
    AGCTTCCACTTCCGGAGTAAC[CG]GAAGTTCCTGTGTTCTTTATTCTACTCTCC homolog 2, neuro/glioblastom
Y           HER3, ErbB-3, c-erbB3, erbB3-S, MDA-BF-1, MGC88033, c-erbB-3, p180-ErbB3, p45-sErbB3, p85-sEr
                      Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) (ERBB3),
                                 erbB-3 isoform 1 precursor
                                              cg04858169
    GCACCTGGGAGCCGGAACCCAGTGCG[CG]CAGCCTCGGAGGGTATGGGCA
Y           HER3, ErbB-3, c-erbB3, erbB3-S, MDA-BF-1, MGC88033, c-erbB-3, p180-ErbB3, p45-sErbB3, p85-sEr
                      Homo sapiens v-erb-b2 erythroblastic leukemia viral
                                 erbB-3 isoform 1 precursor
                                              cg24592193
    GGACGCAGTCTCTAGTGTCCTCTC[CG]CGTCCCACTTCACTGCCCCAToncogene homolog 3 (avian) (ERBB3),
Y           HER4, MGC138404 v-erb-a erythroblastic leukemia viral oncogene
                      Homo sapiens v-erb-a erythroblastic leukemia viral oncogene homolog
                                              cg08649550
    CGGACTGTGCAGCTATTTCCCCG[CG]TGAGCCTTCGCTTGCTCGCTCCCTC homolog 4 4 (avian) (ERBB4), m
Y           HER4, MGC138404 v-erb-a erythroblastic leukemia viral oncogene homolog 4
                      Homo sapiens v-erb-a erythroblastic leukemia viral oncogene
                                              cg12482802
    CCTCACACTTGTCCGGCGGCTG[CG]GTAATTAAAGCTCCGAGCGTCATTTCC homolog 4 (avian) (ERBB4), m
Y           UV20       Homo sapiens excisioncg12291729
                                 excision repair cross-complementing 1 isofrom 2
                                               repair cross-complementing rodent repair deficiency, complementati
    TCCTCTCTTCCCGGTCCTGTG[CG]AGTCCGTGCTGGTGACACAGCAGTGACCA
Y           UV20       Homo sapiens excisioncg13282827
                                 excision repair cross-complementing 1 isofrom 2
                                               repair cross-complementing rodent repair deficiency, complementati
    GAGCTTACGGTTCAGTAAGGGACACAGACA[CG]TTCCCAGTGCTGACCCAGAATGGG
N           XPB, BTF2, GTF2H, RAD25, TFIIHrepair cross-complementing rodent repair deficiency, complementati
                       Homo sapiens excisioncg13587811
                                 excision repair cross-complementing rodent
    GGGCATTAAAGGTGATTCTGGTGA[CG]GCTCAGATGGAAAGGAGAAATA repair deficiency, complementation g
Y           CSB, CKN2, COFS, RAD26
                       Homo sapiens excisioncg05380429
                                 excision repair cross-complementing rodent repair deficiency, complementation g
                                               repair cross-complementing rodent
    AGAACAATGGGAGGAAGTTGAGCTT[CG]CCTGGGGAAAGAAGCAGCCCACG repair deficiency, complementati
Y           p55, erg-3 Homo sapiens v-ets erythroblastosis virus E26 oncogene isoform 2
                                 v-ets erythroblastosis virus E26 oncogene
                                              cg12571150
    AAAATCCAGCTTACCTGAGCGC[CG]CTCCTCTTCTCTCATGTCCCTCGGlike like (avian) (ERG), transcript varian
Y           IRE1, IRE1P, FLJ30999 endoplasmic reticulum to nucleus signalling 1 (ERN1),
                       Homo sapiens
                                 endoplasmic reticulum to nucleus signalling
                                              cg13884260
    GGATGTGAAGTTTGAGATGGTCTG[CG]TCACAACTCGTTGGAGGGAGTG 1 isoform 1 transcript variant 1, mR
Y           ER, ESR, Era, ESRA, NR3A1, major ORF, DKFZp686N23123
                       Homo sapiens estrogen receptor 1 (ESR1), mRNA.
                                 estrogen receptor 1
                                              cg17191385
    GGCTGTGCTCTTTTTCCAGGTGGCC[CG]CCGGTTTCTGAGCCTTCTGCCCTGCGG
Y           ER, ESR, Era, ESRA, NR3A1, major ORF, DKFZp686N23123
                       Homo sapiens estrogen receptor 1 (ESR1), mRNA.
                                 estrogen receptor 1
                                              cg05171584
    GGCCCCTGGATCCGTCTTT[CG]CGTTTATTTTAAGCCCAGTCTTCCCT
Y           Erb, ESRB,Homo sapiens estrogen receptor 2 (ER beta) (ESR2), mRNA.
                       5p152, NR3A2, ER-BETA, ESR-BETA
                                 estrogen receptor 2
                                              cg25497024
    GGCAGTTATTTCTCGCAGCCTC[CG]CGCTTGCAACTGCCTCCTGGCGGGGGA
Y           Erb, ESRB,Homo sapiens estrogen receptor 2 (ER beta) (ESR2),
                       5p152, NR3A2, ER-BETA, ESR-BETA
                                 estrogen receptor 2
                                              cg09233462
    AAGTGGGAGCACCCTCGAAC[CG]ACTCCTGGTCCACCCACAAGGATA mRNA.
Y           ETS-1, EWSR2, FLJ10768 erythroblastosis virus E26E26 oncogene
                       Homo sapiens v-ets erythroblastosis virus oncogene homolog 1
                                 v-ets        cg14998713
    CATGGTGCCAGGAGTGGGGGA[CG]TACGGGATGGTAGCAAGTTTGCAGT homolog 1 (avian) (ETS1), mRNA.
Y           ETS-1, EWSR2, FLJ10768 erythroblastosis virus E26E26 oncogene
                       Homo sapiens v-ets erythroblastosis virus oncogene homolog 1
                                 v-ets        cg22707588
    GGATGAAGGCGAGCGTGCAGGCAGG[CG]CAGGGGATTCGTGAGCCCGT homolog 1 (avian) (ETS1), mRNA.
Y           .          Homo sapiens v-ets erythroblastosis virus E26 oncogene homolog
                                 v-ets erythroblastosis virus E26 oncogene homolog 2
                                              cg03690837
    GCTTCCCGGGAGCAGCGCGATCAGCACCA[CG]ACTCGGGGACACAGCCAGGGCC 2 (avian) (ETS2), mRNA.
Y           .          Homo sapiens v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) (ETS2), mRNA.
                                 v-ets erythroblastosis virus E26 oncogene homolog 2
                                              cg06712947
    TGTGTAAAGTGGGAGCCGCAAGTCCTC[CG]AGAGTGACGATGATGTGCGTG
N           ER81, MGC104699, MGC120533,gene 1 1 (ETV1), mRNA.
                       Homo sapiens ets variant gene
                                 ets variant cg01267644 DKFZp781L0674
                                               MGC120534,
    TTTATTTACACTCTCGATGTTTCCCTG[CG]CGGTCGGTGTACCCCGGGCAGCTCTGA
Y           ER81, MGC104699, MGC120533,gene 1 1 (ETV1), mRNA.
                       Homo sapiens ets variant gene
                                 ets variant cg24347887 DKFZp781L0674
                                               MGC120534,
    CACTTCCCCCTTGGAAGC[CG]AAAGCGCCTCTGACAGAGCTCAATTCG
Y           TEL        Homo sapiens ets variant gene 6 (TEL oncogene) (ETV6),
                                 ets variant gene 6
                                              cg01434690
    TCTGTTCGCAGGAAATTATTTGGGG[CG]AGAGGGAAAGAGATGCAGCTCG mRNA.
Y           EVI-1, PRDM3, MDS1-EVI1, AML1-EVI-1integration site 1 (EVI1), mRNA.
                       Homo sapiens ecotropic viral
                                 ecotropic viral integration site 1
                                              cg26718709
    GCCAAAGGGTCCGAATGTGACTTTCT[CG]CGAAGCAGCACACGATGTTGGACAGCA
Y           EVI-1, PRDM3, MDS1-EVI1, AML1-EVI-1integration site 1 (EVI1), mRNA.
                       Homo sapiens ecotropic viral
                                 ecotropic viral integration site 1
                                              cg14228238
    AACTCGGCCGAGAGCGGCTCCAAAGT[CG]CGTGGCCAGTGCCAGGAATTCAGA
N           EVDA, EVI2 Homo sapiens ecotropic viral integration site isoform 1
                                 ecotropic viral integration site 2A 2A (EVI2A), transcript variant 1, mRNA.
                                              cg14414427
    AGGAAACCAAACTTAGATCCTT[CG]TAATCCTAATTTAAAACTCCATGGCGATGG
N           EVDA, EVI2 Homo sapiens ecotropic viral integration site isoform 1
                                 ecotropic viral integration site 2A 2A (EVI2A), transcript
                                              cg23352695
    CATGACAGGAGGCTTTGTAGAACCAATCCC[CG]CCTCCAGAGCAGGGAGGGTTTT variant 1, mRNA.
Y           EXT        Homo sapiens exostoses (multiple) 1 (EXT1), mRNA.
                                 exostosin 1cg27085164
    ATCTCTCTTTATTCCCTTCTGCAG[CG]GCTCCAAGACTCCGGCGGTGTTTACTC
Y           CMD1J, DFNA10 sapiens eyes absent homolog 4 (Drosophila) (EYA4),
                       Homo      eyes absent 4 isoform a
                                              cg23916819
    GAGGCACAGCGCGAAGGGGAAACTT[CG]ACACTGGAAGGAACGAGAATAAA transcript variant 1, mRNA.
Y           CMD1J, DFNA10 sapiens eyes absent homolog 4 (Drosophila)
                       Homo      eyes absent 4 isoform a
                                              cg19148393
    AAAGGAGTCCGGCAGGGGGCC[CG]CAGTGGCCTGCACAGGGGAACT(EYA4), transcript variant 1, mRNA.
Y           CMD1J, DFNA10 sapiens eyes absent homolog 4 (Drosophila) (EYA4), transcript variant 1, mRNA.
                       Homo      eyes absent 4 isoform a
                                              cg24842760
    TCAGCAATGTGCCTAGAGAAGCTCTGACGC[CG]CCTTGGAAGTAAGTCGTTGCTG
Y           TR, HTR, CF2R, PAR1coagulationcg03231644 (thrombin) receptor (F2R), mRNA.
                       Homo sapiens coagulation factor II
                                               factor II receptor precursor
    CCAGGTAATCCGGAGGCTGGGG[CG]AAAGGGTGGCCTGAGCCAGG
Y           TR, HTR, CF2R, PAR1coagulationcg11627632 (thrombin) receptor (F2R),
                       Homo sapiens coagulation factor II
                                               factor II receptor precursor
    TGTGAGTCACTGACAGCTTCGCGAATCAA[CG]GTGCCCAGAGGAAAAAACTTCT mRNA.
Y           MDGI, FABP11, H-FABP, O-FABPcg03365882 3 3, muscle and heart (mammary-derived growth inhib
                       Homo sapiens fatty acid binding protein
                                 fatty acid binding protein
    CTCACCGAGTGACTTCATGTAGTCAT[CG]AAATTCTTGCTGTCCACTAGCTTCCAGGT
Y           MDGI, FABP11, H-FABP, O-FABPcg22966997 3 3, muscle and heart
                       Homo sapiens fatty acid binding protein
                                 fatty acid binding protein
    CCCTTCACTCTCACTGCCTGGTGG[CG]GAGACAGTCACCAGCGGCTCGGTCT (mammary-derived growth inhib
Y           FA, FA1, FAA, FAH, FA-H,Fanconicg23604467
                       Homo sapiens FACA, FANCH, MGC75158 group A A (FANCA), transcript variant 2, mR
                                 Fanconi anemia, complementation
                                               anemia, complementation group
    CCTCTGGCAGTGGCCTTGGAACCAC[CG]AAGGGATTCAGCCGAAGGGC isoform b
Y           FAE, FACEHomo sapiens Fanconicg04035266
                                 Fanconi anemia, complementation group E E (FANCE), mRNA.
                                               anemia, complementation group
    CATGACAAGCAACATGCCGTCAG[CG]TAAATACAGCGCGGGTCCTCTAGCACA
Y           FAF        Homo sapiens Fanconicg11500391
                                 Fanconi anemia, complementation group F F (FANCF), mRNA.
                                               anemia, complementation group
    CCGCTTTCACCTTGGAGACGG[CG]ACTCTCTGCGTACTGATTGGAACATCCGCG
Y           FAG, XRCC9 Homo sapiens Fanconicg01889055
                                 Fanconi anemia, complementation group G G
                                               anemia, complementation group
    TGAAGAGTTAGTTCCCGCGGGAAACT[CG]GGGAGGAAACGAGTCAGCAACC (FANCG), mRNA.
N           APT1, CD95, FAS1, APO-1, FASTM,receptorreceptor superfamily,Fas (FAS), transcript precursor
                       Homo sapiens Fas (TNF ALPS1A, TNFRSF6, membermember 6 isoform
                                 tumor necrosis factor superfamily, Apo-1 6)
                                              cg15774510
    CATATGGTTAACTGTCCATTCCAGAAA[CG]TCTGTGAGCCTCTCATGTTGCAGCCACAAC 1 variant 1, mRNA
Y           APT1, CD95, FAS1, APO-1, FASTM,receptorreceptor superfamily,Fas (FAS), isoform 1 precursor
                       Homo sapiens Fas (TNF ALPS1A, TNFRSF6, membermember
                                 tumor necrosis factor superfamily, Apo-1 6)
                                              cg13757224
    GTGAGCATGCCAGCCACTGCAGGAACGCCC[CG]GGACAGGAATGCCCATTTGTG 6 transcript variant 1, mRNA
Y           FAST       Homo sapiens Fas-activated serine/threonine kinase (FASTK), transcript variant 4, mRNA.
                                 Fas-activated serine/threonine kinase isoform
                                              cg01139039
    ACAGTTACTTTAATCTGCACGGGTTC[CG]GGGAACTCCTCTGCCCCTCCC 4
Y           FAST       Homo sapiens Fas-activated serine/threonine kinase (FASTK), transcript variant 4, mRNA.
                                 Fas-activated serine/threonine kinase isoform
                                              cg22085103
    GGGAAGAGGCAGGCCGGAGAGG[CG]GGCCTGGGCAGGCAGCAGCTCC 4
Y           ME5, FAT1, CDHF7, hFat1 tumor suppressor 1 precursor 1 (Drosophila)
                       Homo sapiens FAT tumor suppressor homolog
                                 FAT          cg06830038
    AGGCTTGTGATGCCGAGGTTAGTTA[CG]GCCAGCCACAGGCGCTGTGCAAGGA (FAT), mRNA.
Y           ME5, FAT1, CDHF7, hFat1 tumor suppressor 1 precursor 1 (Drosophila) (FAT), mRNA.
                       Homo sapiens FAT tumor suppressor homolog
                                 FAT          cg08953122
    GGACAAGAGGGCGGACTTGATCT[CG]GAAAGTTTGTGGGACTCAGG
N           TYK3       Homo sapiens (fps/fes related) tyrosine kinase (phosphoprotein
                                 fer fer (fps/fes related) tyrosine kinase (phosphoprotein NCP94) (FER), mRNA.
                                              cg08035146
    CTTTTGGTGAAGGACGCTTCAGAAA[CG]GCCATCACTGAAGAGCAGACCCGTTTGNCP94)
N           TYK3       Homo sapiens (fps/fes related) tyrosine kinase (phosphoprotein NCP94)
                                 fer fer (fps/fes related) tyrosine kinase (phosphoprotein NCP94) (FER), mRNA.
                                              cg20922596
    CTTTATGACGGAAGGTAGTTTTGCAACA[CG]GAGCAAGTTGCTCACCGAAGTTACGCT
Y           FPS        Homo sapiens feline sarcoma oncogene (FES), mRNA.
                                 V-FES feline sarcoma viral/V-FPS fujinami
                                              cg10886497
    GCACCGGGCCTGAGTCGGTC[CG]AGGCCGTCCCAGGAGCAGCTGCC avian sarcoma viral oncogene homolo
Y           FPS        Homo sapiens feline sarcoma oncogene (FES), mRNA.
                                 V-FES feline sarcoma viral/V-FPS fujinami avian sarcoma viral oncogene homolo
                                              cg04362933
    CGCTGCCGGGCCCTGGGGCCTG[CG]GGGCGCGGGCGGCTCTTGGCTGGGCCATT
N           AFGF, ECGF, FGFA, ECGFA, ECGFB, factor 1 (acidic) isoform 2 precursor variant 2, mRNA.
                       Homo sapiens fibroblast growth factorGLIO703, ECGF-beta, FGF-alpha
                                 fibroblast growth HBGF1, 1 (acidic) (FGF1), transcript
                                              cg02259548
    CTTGGTGTCTTCTTCTCAGAGTAGCC[CG]GCTCTCTGAACCTCCAGGCTACTGCAGCT
N           AFGF, ECGF, FGFA, ECGFA, ECGFB, factor 1 (acidic) isoform 2 precursor variant 2, mRNA.
                       Homo sapiens fibroblast growth factorGLIO703, ECGF-beta, FGF-alpha
                                 fibroblast growth HBGF1, 1 (acidic) (FGF1), transcript
                                              cg05353098
    AGCCAGGAGGGAGGTAGAGACAGAAGA[CG]GTGGCAGCAGCTACCCTGGGTG
Y           FHF1, FGF12B sapiens fibroblast growth factor isoform 1
                       Homo      fibroblast growth factor 12 12 (FGF12), transcript variant 1, mRNA.
                                              cg09801174
    AGCTGCAGGCAGGAGCTGTCCTCCGAG[CG]TGGTGCTGCAGGTGTAGTGACAG
Y           FHF1, FGF12B sapiens fibroblast growth factor isoform 1
                       Homo      fibroblast growth factor 12 12 (FGF12), transcript variant
                                              cg22069098
    AAACTAGAAAATGGATTGGACTAGTACTG[CG]TGCATCAGGACGAATTACTGAAGTCT 1, mRNA.
Y           BFGF, FGFB, HBGH-2fibroblast growth factor 2 2 (basic)
                       Homo sapiens fibroblast growth factor
                                              cg06431235
    TGACTTTTGGGGGATAAGGGG[CG]GTGGAGCCCAGGGAATGCCA(FGF2), mRNA.
Y           BFGF, FGFB, HBGH-2fibroblast growth factor 2 2 (basic) (FGF2), mRNA.
                       Homo sapiens fibroblast growth factor
                                              cg03941587
    GTCACGGCTGGTTGCGCAGCAAAAGCCC[CG]CAGTGTGGAGAAAGCCTAAACGTG
Y           INT2, HBGF-3
                       Homo sapiens fibroblast growth factor 3 (murine mammary
                                 fibroblast growth factor 3 precursor
                                              cg12845334
    CAAAGCGCTGAAAGAAAGGACGGTT[CG]CCAACAAAAGGCCGACGTGGTCC tumor virus integration site (v-int-
Y           INT2, HBGF-3
                       Homo sapiens fibroblast growth factor 3 (murine mammary
                                 fibroblast growth factor 3 precursor
                                              cg15119027
    GATGACTGATGTCCGTGAAAACAACTTG[CG]GGGAAGTCGAGCTGACAAAC tumor virus integration site (v-int-
Y           HBGF-5, Smag-82
                       Homo sapiens fibroblast growth factor 5 (FGF5), transcript
                                 fibroblast growth factor 5 isoform 1 precursor
                                              cg08153517
    GGGTGAGGGGAAGCTTCGCAGG[CG]TGCACGGAGCAGTGAGATCACTGG variant 1, mRNA.
Y           HBGF-5, Smag-82
                       Homo sapiens fibroblast growth factor 5 (FGF5), transcript variant
                                  fibroblast growth factor 5 isoform 1 precursor
                                                cg23520103
    AGGACTCAGCTGCTAACGCCGAGCT[CG]TTTCCACGCGGCTCTGGTCCTAGTCG 1, mRNA.
Y           HST2, HBGF-6 sapiens fibroblast growth factor 6 (FGF6), mRNA.
                       Homo       fibroblast growth factor 6 precursor
                                                cg10815012
    CGTTGCAGTAGAGCCTCCGCTGC[CG]CTTGATCCCCACCAAATAGCCA
Y           HST2, HBGF-6 sapiens fibroblast growth factor 6 (FGF6), mRNA.
                       Homo       fibroblast growth factor 6 precursor
                                                cg01392242
    GAGAGCAGAGGGACCCAGGCTGAGCCG[CG]GCCGGTAGAGACCATGGCTCG
N           KGF, HBGF-7Homo sapiens fibroblast growth factor 7 (keratinocyte growth factor) (FGF7), mRNA.
                                  fibroblast growth factor 7 precursor
                                                cg26070824
    GCTTCCAATGAGGTCAGCAAAGGTATTTAT[CG]AAAAGCCCTGAATAAAAGGCTCACAC
N           KGF, HBGF-7Homo sapiens fibroblast growth factor 7 (keratinocyte growth factor) (FGF7), mRNA.
                                  fibroblast growth factor 7 precursor
                                                cg18689733
    TGAGACTCTGGAACAGCAGGTAACTTGCC[CG]AAGTCATACTGGTCATTAGTGGTCCAA
Y           AIGF, HBGF-8 sapiens fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant B, mR
                       Homo       fibroblast growth factor 8 isoform B precursor
                                                cg02429245
    CACAGGCAGCTCAGCGCGGAG[CG]GGGGCTGCCCATGGCGCGCGGCCC
Y           AIGF, HBGF-8 sapiens fibroblast growth factor 8 (androgen-induced) (FGF8), transcript variant B, mR
                       Homo       fibroblast growth factor 8 isoform B precursor
                                                cg15208541
    GCCTGGAGCGCCCGAGTCTGG[CG]GGTCTGGGTCTCCGCCTCCGGGCC
Y           GAF, HBFG-9, MGC119914, MGC119915 factor 9 (glia-activating factor)
                       Homo sapiens fibroblast growth 9 precursor
                                  fibroblast growth factor
                                                cg18000242
    TCGTCCTAAGCAGCGTGGTTTGAGGG[CG]AGAAGACGCCTACTGGAGCGCTC (FGF9), mRNA.
Y           GAF, HBFG-9, MGC119914, MGC119915 factor 9 (glia-activating factor) (FGF9), mRNA.
                       Homo sapiens fibroblast growth 9 precursor
                                  fibroblast growth factor
                                                cg02259997
    GACTCAGGGTTTCTTCCTCC[CG]CCTCTCGCAGTGCATCTTTCATTTGCTTTT
Y           H2, H3, H4,Homo sapiens fibroblast growth factor receptor CD331, precursor
                        H5, CEK, FLG, FLT2, cg05405947receptor 1 isoform
                                  fibroblast growth factor
                                                KAL2, BFGFR, C-FGR, 1 (fms-related tyrosine kinase 2, Pfeiffer synd
    GCCTCACTTTCCTTGCAGAC[CG]GGCTCCATCGCCCTGCGGAGGCC 1 N-SAM
Y           H2, H3, H4,Homo sapiens fibroblast growth factor receptor CD331, N-SAM
                        H5, CEK, FLG, FLT2, cg20658205receptor 1 isoform 1 precursor
                                  fibroblast growth factor
                                                KAL2, BFGFR, C-FGR, 1 (fms-related
    CTACAGCCTGGTCTCCTTTGGCGTTTG[CG]CCCCTGCATCTGAGCACGTCCCA tyrosine kinase 2, Pfeiffer synd
Y           BEK, JWS, Homo sapiens ECT1, growth factor receptor 2 isoform 12 precursor
                       CEK3, CFD1, fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte g
                                  fibroblast KGFR, TK14, TK25, BFR-1, CD332,
                                                cg02179499
    GCGATGCGGCCGTAGGGATGCAG[CG]ACAGCCTCCGAATAAGGCCTGGTC K-SAM
Y           BEK, JWS, Homo sapiens ECT1, growth factor receptor 2 isoform 12 precursor
                       CEK3, CFD1, fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte g
                                  fibroblast KGFR, TK14, TK25, BFR-1, CD332,
                                                cg04640037
    GAGACTTTAAAATGCGCCTGCTTGATACTG[CG]GGGAGGGTTGCCAGGCAG K-SAM
Y           ACH, CEK2, JTK4, CD333, HSFGFR3EX factor receptor 3 (achondroplasia,
                       Homo sapiens fibroblast growth receptor 3 isoform 2 precursor
                                  fibroblast growth factor
                                                cg02183613
    CGCTGCCTCCTTGCCGGAGAG[CG]CGGCCAGAGCTAGCGCGGCGACTTGTGGTG thanatophoric dwarfism) (
Y           ACH, CEK2, JTK4, CD333, HSFGFR3EX factor receptor 3 (achondroplasia, thanatophoric dwarfism) (
                       Homo sapiens fibroblast growth receptor 3 isoform 2 precursor
                                  fibroblast growth factor
                                                cg12221596
    GCGGGGCTCTCAGGCGGCTTAGCTG[CG]TGCGGCCCCAGGTCAGTCAACG
N           TKF, JTK2,Homo sapiens fibroblast growth factor receptor 4 (FGFR4), transcript variant 3, mRNA.
                       CD334, MGC20292 growth factor receptor 4 isoform 1 precursor
                                  fibroblast cg13847825
    GAGTAGCAGGGTGGGAGCCAGGAGG[CG]TGGGTCATGGCAATCTATGTATAAAG
N           SRC2, c-fgr, p55c-fgr Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog
                       Homo sapiens Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog (FGR), mRN
                                                cg13164743
    GGCGGAACTGGGCCACCTACTGTAC[CG]TTCAGTCTGCCTCACAGTATGTCCCC
Y           FRA3B, AP3Aase sapiens fragile histidine triad gene (FHIT), mRNA.
                       Homo       fragile histidine triad gene
                                                cg16465895
    GGAACAGAGGGCAAAAAGTCCTGTGAC[CG]GACAGAGCAGAGCGGGGACTG
Y           FRA3B, AP3Aase sapiens fragile histidine triad gene (FHIT), mRNA.
                       Homo       fragile histidine triad gene
                                                cg24504954
    GGAGCGGAGGCCAATACGCGCAGAGCATG[CG]CCTACGCCGGGCCAATTGAAAGC
Y           FHL1B, KYO-T, SLIM1, MGC111107,half LIM domains 1 (FHL1),
                       Homo sapiens four and a LIM domains 1
                                  four and a half bA535K18.1
                                                cg01116435
    GCCGCTCGGGGCTGGTCCCTG[CG]GTCCCGGCTGCCTGGCCTTCCA mRNA.
Y           FHL1B, KYO-T, SLIM1, MGC111107,half LIM domains 1 (FHL1), mRNA.
                       Homo sapiens four and a LIM domains 1
                                  four and a half bA535K18.1
                                                cg01707211
    AGAGCCCGGCACTGAGCTTGGCACATGG[CG]AGGGCTCAGTAAACTGAATGCTG
Y           EWSR2, SIC-1 sapiens Friend leukemia virus integration 1 (FLI1), mRNA.
                       Homo       Friend leukemia virus integration 1
                                                cg20448922
    TGCACAGGGGAGTGAGGGCAGGG[CG]CTCGCAGGGGGCACGCAGGG
Y           EWSR2, SIC-1 sapiens Friend leukemia virus integration 1 (FLI1), mRNA.
                       Homo       Friend leukemia virus integration 1
                                                cg26979016
    GAGTCTTCCCCGGCAGTAGG[CG]CTGGGTTACCCGCAGCCCTAGCCA
N           .          PREDICTED: Homo sapiens hypothetical protein FLJ20712
                                  hypothetical protein LOC55025
                                                cg05794098
    ACTGCTTTGTTGAGCCCCAGAAC[CG]GCAGCGGATACTCCCTGCCAATCAC (FLJ20712), mRNA.
Y           FLT, VEGFR1Homo sapiens fms-related tyrosine kinase 1 (vascular endothelial
                                  fms-related cg15601306
                                                tyrosine kinase 1 (vascular endothelial growth factor/vascular permea
    CGCTGCAACTAGTGTCCCAGGTTCT[CG]CCGTAGCCAGCTTCTCCGGGCTACAG growth factor/vascular per
Y           FLT, VEGFR1Homo sapiens fms-related tyrosine kinase 1 (vascular
                                  fms-related cg21787743
                                                tyrosine kinase 1 (vascular endothelial growth factor/vascular permea
    GCAGGTTCAGGGTCTTTGCTCCG[CG]CCCTCTTGCCCTTGCCCCTCC endothelial growth factor/vascular per
Y           FLT, VEGFR1Homo sapiens fms-related tyrosine kinase 1 (vascular endothelial
                                  fms-related cg26282369
                                                tyrosine kinase 1 (vascular endothelial growth factor/vascular permea
    GAAGTCTAGGAAGGCACCGGAGACCCT[CG]GCACAAGGCACTGAACCTGGAGCG growth factor/vascular per
Y           FLK2, STK1, CD135 fms-related cg18969328 kinase 3 (FLT3), mRNA.
                       Homo sapiens fms-related tyrosine
                                                tyrosine kinase 3
    CGCGGCCCGAGCCAGAGGAGAGACTT[CG]GAGAAGAGGGAAGAGGAC
Y           FLK2, STK1, CD135 fms-related cg23603794 kinase 3 (FLT3), mRNA.
                       Homo sapiens fms-related tyrosine
                                                tyrosine kinase 3
    AGTTGCACTGGCTCCGCGGCTCTGC[CG]CCTTGCTGCCCCTGTGAGTCCCCGA
Y           PCL, FLT41, VEGFR3 fms-related cg17414561 kinase 4 (FLT4),
                       Homo sapiens fms-related tyrosine
                                                tyrosine kinase 4 isoform
    CGTGCTCCCCTCAGGCGTC[CG]CGCACCAGGGCCACCGTGTCCC 2 transcript variant 2, mRNA.
Y           PCL, FLT41, VEGFR3 fms-related cg20020551 kinase 4 (FLT4), transcript
                       Homo sapiens fms-related tyrosine
                                                tyrosine kinase 4 isoform 2
    GGCGTCCGGTGCACCCGAGCAGTGCG[CG]CTCCGCACCACAGGGTCCGGGCC variant 2, mRNA.
Y           FMRP, FRAXA, MGC87458 X mental retardation 1 1 (FMR1),
                       Homo sapiens fragile X mental retardation
                                  fragile       cg03303288
    CCTCCCGCTCAGTCAGACTG[CG]CTACTTTGAACCGGACCAAACCAA mRNA.
Y           FMRP, FRAXA, MGC87458 X mental retardation 1 1 (FMR1), mRNA.
                       Homo sapiens fragile X mental retardation
                                  fragile       cg26857803
    GGGGGTTCGGCCTCAGTCAGG[CG]CTCAGCTCCGTTTCGGTTTCACTTC
Y           FN, CIG, MSF, FINC, LETS, DKFZp686H0342, DKFZp686I1370, mRNA.
                       Homo sapiens fibronectin 1 (FN1),preproprotein
                                  fibronectin 1 isoform 7 transcript variant 7,
                                                cg01966735
    AACTTCAGCCCCAACTTTGGT[CG]GCTTTAGGGTCCCATCCCTGAGGCADKFZp686F10164, DKFZp686O13149
Y           FN, CIG, MSF, FINC, LETS, DKFZp686H0342, DKFZp686I1370, DKFZp686F10164, DKFZp686O13149
                       Homo sapiens fibronectin 1 (FN1),preproprotein
                                  fibronectin 1 isoform 7 transcript variant 7, mRNA.
                                                cg21634861
    GCAGCGAACAAAAGAGATGCTGATGGCC[CG]CCAGGACTGGGGCAAGACAACTT
N           FBP, FOLR, MOv18, FR-alpha receptor 1 (adult) (FOLR1), transcript variant
                       Homo sapiens folate cg15274870
                                  folate receptor 1 precursor
    CCAGAGTGTGGCCTGCTCAAGGTTAAA[CG]ACAAGTTAGTGTTCATCCCCCTGAAC 2, mRNA.
Y           FRA2, FLJ23306 sapiens FOS-like antigen 2 (FOSL2), mRNA.
                       Homo       FOS-like antigen 2
                                                cg26791128
    CGCCTTTTTGGCCCTGTCTGAAAT[CG]GGGGTCCCCAGGGCTGGCAGGCC
N           GTK, RAK, Homo sapiens fyn-related kinase (FRK), mRNA.
                       PTK5       fyn-related kinase
                                                cg26557270
    CCTTTACCAAACTGTTAAAGCAGC[CG]CTAAAATCTATATTCCTTTTGTTTCATCCT
N           GTK, RAK, Homo sapiens fyn-related kinase (FRK), mRNA.
                       PTK5       fyn-related kinase
                                                cg18764771
    CCTGTTTCAAGTCTGTTCCTGTCTTT[CG]ACCAGTCCGGATCTGGACGGCTCTCT
Y           FRE, FZRB, hFIZ,sapiens FRP-3, FRZB1,protein (FRZB), mRNA.
                       Homo FRITZ, frizzled-related SFRP3, SRFP3, FRZB-1,
                                  frizzled-related protein
                                                cg01872931
    CAGGATGGGGCAGGGTGCAGCCG[CG]CAGTGGACGCCAAAAGGCCCGCT FRZB-PEN
Y           FRE, FZRB, hFIZ,sapiens FRP-3, FRZB1,protein (FRZB), mRNA.
                       Homo FRITZ, frizzled-related SFRP3, SRFP3, FRZB-1, FRZB-PEN
                                  frizzled-related protein
                                                cg25188149
    GGGACGTCTGTGCCTCTGCCCGGG[CG]GCTCTGCACTTTCCTACCTCCCGC
Y           .          Homo sapiens follicularcg25427220variant translocation
                                  follicular lymphoma variant translocation
                                                 lymphoma
    CAGCCTCTCCCGTGGAAAC[CG]GGCCTCCCGTCCCTGTGCGTCGC 1 1 (FVT1), mRNA.
Y           SLK, SYN, MGC45350protein-tyrosine kinase fyn to SRC, c
                       Homo sapiens FYN oncogene related isoform FGR, YES (FYN), transcript variant 3, mRNA
                                                cg23412550
    AGAGCGGAGAGTGTGAACTGCAGTTTC[CG]CTTTGCGGAAGGTTGCAGCTG
Y           FzE3       Homo sapiens frizzled homolog 7 (Drosophila) (FZD7), mRNA.
                                  frizzled 7 cg18631360
    TGCTGGGCCACACGAACCAAGAGGACG[CG]GGCCTCGAGGTGCACCAGTTCT
Y           FZD3       Homo sapiens frizzled homolog 9 (Drosophila) (FZD9), mRNA.
                                  frizzled 9 cg25707686
    GCGGCTGCCGAGCTAGCGGAGTTCG[CG]CCGCTGGTGCAGTACGGCTGCC
Y           FZD3       Homo sapiens frizzled homolog 9 (Drosophila) (FZD9), mRNA.
                                  frizzled 9 cg27059250
    GGGGCTGGTAGCCTCGGCCC[CG]GGAGGTTGCGCCGGCTCTGGCTCAGCGG
Y           FZD3       Homo sapiens frizzled homolog 9 (Drosophila) (FZD9), mRNA.
                                  frizzled 9 cg01706139
    CAGGCAGCAAGGGAAGGGAAGAAAC[CG]AGTGTAAGCGGAGGGCAAGCG
Y           G6PD1      Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), nuclear gene encoding mitoch
                                  glucose-6-phosphate dehydrogenase
                                                cg10661350
    CGCCGGCTGCCTGCCATACC[CG]CTGCCGCTGCTCTGCATCCCCAATT
Y           G6PD1      Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), nuclear gene encoding mitoch
                                  glucose-6-phosphate dehydrogenase
                                                cg26368202
    CCGTTGTAGGGAGATTGGCTTTTA[CG]CAGAAGGCAACGGGGATCCATG
Y           G6PD1      Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), nuclear gene encoding mitoch
                                  glucose-6-phosphate dehydrogenase
                                                cg27592930
    GGCGGTGACGCCCTGCAAAGTGGC[CG]GCGTGCTTATCATTACCGAGCTTCCGC
Y           G6PD1      Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), nuclear gene encoding mitoch
                                  glucose-6-phosphate dehydrogenase
                                                cg26178557
    CTTTTTTGGGCCCCAGCC[CG]TTCCTGCTCCGCGCTTCTGGAGCACTGG
N           .          Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 5 (GABRA5), mRNA.
                                  gamma-aminobutyric acid (GABA) A receptor, alpha
                                                cg17525249
    CCCATGCAGCTTGAGGACTTCC[CG]ATGGATGCGCACGCTTGCCCTCTGAAATTT 5 precursor
N           .          Homo sapiens gamma-aminobutyric acid (GABA) A receptor, 5 precursor
                                 gamma-aminobutyric acid (GABA) A receptor, alpha
                                                cg02225257
    TGGTAGAGAAATGAAAGCACCACAGTGTGG[CG]GCTCTGGGAGTGCACTGGC alpha 5 (GABRA5), mRNA.
N           .          Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 5 (GABRA5), mRNA.
                                 gamma-aminobutyric acid (GABA) A receptor,
                                                cg20051555
    AGCAGCTCTGCATTCTAGGCCC[CG]AATTCCTTAATATCCGCACCTCACTT alpha 5 precursor
Y           MGC9051 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, 3 isoform 2 precursor
                                 gamma-aminobutyric acid (GABA) A receptor, beta
                                                cg20421990
    CGGAGCACATGGCGCTGTTCCTC[CG]GCCTAACCTGCTGGGATCCGCTCTCC beta 3 (GABRB3), transcript va
Y           MGC9051 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 3 (GABRB3), transcript va
                                 gamma-aminobutyric acid (GABA) A receptor,
                                                cg16084228
    CTTCCAGCCCCTGCCGTGG[CG]GCCCTATTTTTCATTTATACAATTGGACCT beta 3 isoform 2 precursor
N           .          Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma
                                 gamma-aminobutyric acid (GABA) A receptor, gamma
                                                cg16701428
    CCGTACAACTCCCCTGGGAGA[CG]ACAGCTGGAGGCCCCTGGCTTGTTGACTGC 3 3 (GABRG3), mRNA.
N           .          Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma
                                 gamma-aminobutyric acid (GABA) A receptor, gamma
                                                cg27592112
    TTCAGAGCATAGCAGGGGCCTAGGGCCATG[CG]ATATCAGCTTGACCTCTGGAGGG3 3 (GABRG3), mRNA.
N           DDIT1, GADD45 sapiens growth arrest and DNA-damage-inducible, alpha (GADD45A), mRNA.
                       Homo      growth arrest and DNA-damage-inducible, alpha
                                                cg09664591
    ATGTGGTCACCAGCTCCCCA[CG]CAGACCAGCTCACGATTTCCCA
Y           GALNR, GALNR1 sapiens galanin cg15343119
                       Homo      galanin receptor 1 1 (GALR1), mRNA.
                                                receptor
    GCTCGCGCACCGTGACTTCTAAGGGG[CG]CGGATTTCAGCCGAGCTGTTTTC
Y           GALNR, GALNR1 sapiens galanin cg00530755
                       Homo      galanin receptor 1 1 (GALR1), mRNA.
                                                receptor
    CCTGGCCCGCGGCATCCGGCAGCCC[CG]CCTTCAGCCCGCCGGGCAGGTCC
Y           .          Homo sapiens growth arrest-specific 1 (GAS1), mRNA.
                                 growth arrest-specific 1
                                                cg27043343
    GCCTGCAGATCCGTTGTGCGGC[CG]GCTGTCCCCGTGCCGGCTGCTCGC
Y           .          Homo sapiens growth arrest-specific 1 (GAS1), mRNA.
                                 growth arrest-specific 1
                                                cg25746229
    AAGGAGGCTCGGATATGCAGCCCCAGCT[CG]CGCACAGAACCAGCGGGCAGGGCT
Y           MGC1348, Homo sapiens growth arrest-specific 7 (GAS7), transcript variant a, mRNA.
                       KIAA0394 growth arrest-specific 7 isoform a
                                                cg20649212
    CCGGACATGGCCTTGGCGCC[CG]GGTTCACAGCGCAGCCTGCATTCC
Y           MGC1348, Homo sapiens growth arrest-specific 7 (GAS7), transcript variant a, mRNA.
                       KIAA0394 growth arrest-specific 7 isoform a
                                                cg10250043
    AACCTGGGGTTGAACTTGTCTCAC[CG]GAAACTGAACAATGGGTGAA
Y           .          Homo sapiens GATA binding protein 6 (GATA6), mRNA.
                                 GATA binding protein 6
                                                cg03473387
    CAGCGCCCAGCTGCTCGCTGAG[CG]CAGTTCCGACCCACAGCCTGGC
Y           .          Homo sapiens GATA binding protein 6 (GATA6), mRNA.
                                 GATA binding protein 6
                                                cg24306655
    GGGACATCAAAAGTTGGAGAGCGTCCT[CG]GACACGACTGATGTGGAAGCC
Y           BMP3B, BMP-3b sapiens growth differentiation factor precursor
                       Homo      growth differentiation factor 10 10 (GDF10), mRNA.
                                                cg16738009
    GACCTCTGGGGCTGCAGCTGACAGGGT[CG]TCCCTGGCCCGGCTGCCGTGTGCGTGC
Y           BMP3B, BMP-3b sapiens growth differentiation factor precursor
                       Homo      growth differentiation factor 10 10 (GDF10), mRNA.
                                                cg03251024
    CTCCCCAGCCGAGAGCCCGAGACCCAGCCC[CG]CAGCCGGCTCCTGTGTGTCGG
N           FLJ45472 Homo sapiens glial fibrillary acidic protein (GFAP), mRNA.
                                 glial fibrillary acidic protein
                                                cg15193977
    CCTGGAGACTTCAGGTCCATCTA[CG]CCCTCCACTCTGGTCCCACAGG
N           FLJ45472 Homo sapiens glial fibrillary acidic protein (GFAP), mRNA.
                                 glial fibrillary acidic protein
                                                cg03383006
    GAGTGGGCTAGACTGGCGATGCC[CG]GGTGCCCCTGGCAACACCCCCT
Y           ZNF163 Homo sapiens growth factor independent 1 (GFI1), mRNA.
                                 growth factor independent 1
                                                cg25402655
    AAAATACCTTGACACCCAATC[CG]AGAGGTTTGCTCATTTCCCTTCGGATT
Y           ZNF163 Homo sapiens growth factor independent 1 (GFI1), mRNA.
                                 growth factor independent 1
                                                cg20125091
    GAGGTCATACCCAGGCACTGGGTGTTGG[CG]GGAGCAGTAAAGCGCCATAAAAGCACC
Y           ZNF163 Homo sapiens growth factor independent 1 (GFI1), mRNA.
                                 growth factor independent 1
                                                cg07499339
    GCTCTCGACCGGGTCCGCTCAGCCTT[CG]ACTAATTTCCGGTGGTCGGA
Y           HID, KID, PPK, CX26, DFNA3, junction protein, beta 2, 26kDa (connexin 26) (GJB2), mRNA.
                       Homo sapiens gap DFNB1, NSRD1 2, 26kDa (connexin 26)
                                 gap junction protein, beta
                                                cg11172038
    GTTGGGGTCTCTGCGCTGGGGCTCCTG[CG]CTCCTAGGCGGGTCCTGGGCCGGGC
Y           HID, KID, PPK, CX26, DFNA3, junction protein, beta 2, 26kDa (connexin 26) (GJB2), mRNA.
                       Homo sapiens gap DFNB1, NSRD1 2, 26kDa (connexin 26)
                                 gap junction protein, beta
                                                cg20193013
    GTGCCAAGGACTAAGGTTGGGGG[CG]GTGGGAGAGACAAGCCTCGTT
Y           HID, KID, PPK, CX26, DFNA3, junction protein, beta 2, 26kDa (connexin 26) (GJB2), mRNA.
                       Homo sapiens gap DFNB1, NSRD1 2, 26kDa (connexin 26)
                                 gap junction protein, beta
                                                cg09195389
    GGAACTGCAAGGAGGTGACTCCTTT[CG]GGGTGAGGAGGCCCAGAC
Y           GALA       Homo sapiens galactosidase, alpha (GLA), mRNA.
                                 galactosidase, alpha
                                                cg15481221
    CGAGGGCCAGGAAGCGAAGCGCAAG[CG]CGCAGCCCAGATGTAGTTCTGGGTT
Y           GALA       Homo sapiens galactosidase, alpha (GLA), mRNA.
                                 galactosidase, alpha
                                                cg20747453
    AATAATCAGTCACGTAAGACGTTC[CG]CTAACCAATCACCCTCTTCCTTT
Y           GALA       Homo sapiens galactosidase, alpha (GLA), mRNA.
                                 galactosidase, alpha
                                                cg24484149
    GAGGGAAGAAGGAGGAAAATTACC[CG]GTATCGTTAGAGGTTGGTGTG
N           THP2       Homo sapiens GLI-Kruppel family member GLI2 (GLI2), transcript
                                 GLI-Kruppel family member GLI2 isoform alpha
                                                cg16619328
    AAGAAAGTGATGATGCGATGTCTAAAA[CG]TTCAAGGCACCGCATCTGTGATCAAGA variant 1, mRNA.
Y           THP2       Homo sapiens GLI-Kruppel family member GLI2 (GLI2), transcript variant 1, mRNA.
                                 GLI-Kruppel family member GLI2 isoform alpha
                                                cg24008711
    GGGTCCTGGGCACGCATGCCGCA[CG]ACTGAGATCACAGCAGAGGTGAGAAC
N           PHS, ACLS, GCPS, PAPA, PAPB,cg12211443
                       Homo sapiens GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome) (G
                                 GLI-KruppelPAP-A,member GLI3
                                                  family PAPA1, PPDIV
    CAGACGGCCAGGGTGCAGGCCCCCCACC[CG]CCATGCCCAATGCGCTCAAGCTGAAAC
Y           PHS, ACLS, GCPS, PAPA, PAPB,cg23194824
                       Homo sapiens GLI-Kruppel family member GLI3 (Greig
                                 GLI-KruppelPAP-A,member GLI3
                                                  family PAPA1, PPDIV
    GAAGCCTGGGGTGCAGCGCCTCT[CG]GGGGACGGCATCTTACAGAAG cephalopolysyndactyly syndrome) (G
Y           LY6DL      Homo sapiens GPI anchored molecule like protein (GML),
                                 GPI anchored molecule like protein
                                                cg21475536
    AGGGGCCCAGCTGAGGCAGCCTCCT[CG]TCAGCTGCTTGGGCCGCCAGGA mRNA.
N           LY6DL      Homo sapiens GPI anchored molecule like protein (GML), mRNA.
                                 GPI anchored molecule like protein
                                                cg20178722
    CCTGGGCGGTGCCAACAGGCTGC[CG]AGGGTGGCTGCTGTCCCGTTTCTCCAGC
Y           XL, AHO, GSA, GSP, POH, XL2, complex binding protein,PHP1A, PHP1B, GNASXL, NESP55, C20orf45
                       Homo sapiens GNAS GPSA, NESP, GNAS1, transcript variant 4, mRNA.
                                 guanine nucleotide locus (GNAS), alpha stimulating activity polypeptide 1 isoform
                                                cg02859712
    GAGGACCGGCGGAGGCACCTCTCT[CG]AGTCTTAGGCTGCGGAATCTAAGA
Y           XL, AHO, GSA, GSP, POH, XL2, complex binding protein,PHP1A, PHP1B, 4, mRNA.
                       Homo sapiens GNAS GPSA, NESP, GNAS1, transcript variant activity polypeptide 1 isoform
                                 guanine nucleotide locus (GNAS), alpha stimulating
                                                cg14432005
    GCCACAGGCTCGGCGCCACCACGCAGCTCG[CG]GGGAGGTGGCCCCCACCT GNASXL, NESP55, C20orf45
Y           FLJ00058 Homo sapiens guaninecg13502721
                                 guanine nucleotide binding protein (G protein), gamma 7
                                                 nucleotide binding protein (G protein), gamma
    AGGCCAGACGCTGAGAGAGAAAAACACTG[CG]TAATCCCACGTATTGTGGAGTCCAAAA7 (GNG7), mRNA.
N           FLJ00058 Homo sapiens guaninecg18559504
                                 guanine nucleotide binding protein (G protein), gamma 7
                                                 nucleotide binding protein (G
    GGGGGCCCCCCTGGTTTATAC[CG]TCTTCCCCATCAGGAGTTTATCC protein), gamma 7 (GNG7), mRNA.
Y           .          Homo sapiens glycine N-methyltransferase (GNMT), mRNA.
                                 glycine N-methyltransferase
                                                cg27591592
    TGGCAGCTGTATATCGGAGACACCCGCAGC[CG]CACCGCCGAGTACAAGGCATGGCTGC
Y           .          Homo sapiens glycine N-methyltransferase (GNMT), mRNA.
                                 glycine N-methyltransferase
                                                cg04013093
    GGGATTGCACAGAGGGCTGGGTC[CG]CAGGCTGGCTAAAAGGACCTAGCCC
Y           CD42c      Homo sapiens glycoprotein Ib (platelet), beta polypeptide
                                 glycoprotein Ib beta polypeptide precursor
                                                cg12271202
    GCAGAGTAAGCCGGGCTGCCGTCTTCT[CG]CCATGGGCTCCGGTGAGTCT(GP1BB), mRNA.
Y           CD42c      Homo sapiens glycoprotein Ib (platelet), beta polypeptide (GP1BB), mRNA.
                                 glycoprotein Ib beta polypeptide precursor
                                                cg19755554
    ACACGATGCTCCGTTTTCTTC[CG]TTGTGAATGCCGCGTCCTGTCCTGGTGACA
N           FLJ12455 Homo sapiens G patchcg18665535
                                 G patch domain containing 3 3 (GPATC3), mRNA.
                                                 domain containing
    GGTAGAAAAATGGGCCGAAGATACTT[CG]CAAAAGAGGAAACACGCAGGTCCAATT
Y           SGB, DGSX, SDYS, SGBS, SGBS1 (GPC3), mRNA.
                       Homo sapiens glypicancg27496708
                                 glypican 3 3
    CAAGAGACGTGCTGCTACCCAGC[CG]CTGCAAAAGTTTCCTCGCAGCTACCTGG
Y           SGB, DGSX, SDYS, SGBS, SGBS1 (GPC3), mRNA.
                       Homo sapiens glypicancg07504028
                                 glypican 3 3
    TCCCGGCAGCCGAGCCCAGCTGCCCGCT[CG]CAGCCGCTCTACACAGGGCGCTCTGG
N           KPG_001, KIAA0758, DKFZp564O1923 receptor 116116 (GPR116),
                       Homo sapiens G protein-coupled receptor
                                 G-protein coupled
                                                cg07914934
    AATGCCCAGGGGTGCATTCCAATTGCAGA[CG]GAGGGAAGCCCTGTGGAA mRNA.
N           KPG_001, KIAA0758, DKFZp564O1923 receptor 116116 (GPR116), mRNA.
                       Homo sapiens G protein-coupled receptor
                                 G-protein coupled
                                                cg18891510
    TTTCCTGGTTCTCAAGGCTCC[CG]AGCTTATGCCTTTTCTCCTTCTATGCTCCC
Y           GSHPX1, MGC14399, glutathione cg07274523 isoform 1 transcript variant 1,
                       Homo sapiens glutathione peroxidase 1 (GPX1),
                                 MGC88245peroxidase 1
    GCAATTGTCCAAGAAGCCAGCGGAGCGCCC[CG]AACAAGCACTGTAAGGGGAGGCC mRNA.
Y           GSHPX1, MGC14399, glutathione cg08539067 isoform 1 transcript variant 1, mRNA.
                       Homo sapiens glutathione peroxidase 1 (GPX1),
                                 MGC88245peroxidase 1
    TGGTCTGGCCCAGGCAACCAGG[CG]GCAGCGGTCCAGGTTACCCTTCC
Y           .          Homo sapiens glutathione peroxidase 3 (plasma) (GPX3), mRNA.
                                 plasma glutathione peroxidase 3 precursor
                                                cg02982825
    GCTGCAAGGGTCTCGGCTTGGC[CG]CGGATTGGTCACACCCGAGGG
Y           RSS, IRBP,Homo sapiens growth factor receptor-bound protein isoform c
                        MEG1, GRB-IR, KIAA0207
                                 growth factor receptor-bound protein 10 10
                                                cg15683318
    GCGCTGCCGCCACCCAGGGGCTGCG[CG]GAAACTTTGGGCTCCACCGG (GRB10), transcript variant 4, mRNA
Y           RSS, IRBP,Homo sapiens growth factor receptor-bound protein isoform c
                        MEG1, GRB-IR, KIAA0207
                                 growth factor receptor-bound protein 10 10
                                                cg20651681
    GGTTCCTGCCCCGGGCTGCTGAG[CG]GGTTCCCCCCTCCTGCTGTCCT (GRB10), transcript variant 4, mRNA
Y           RSS, IRBP,Homo sapiens growth factor receptor-bound protein 10 (GRB10), transcript variant 4, mRNA
                        MEG1, GRB-IR, KIAA0207
                                 growth factor receptor-bound protein 10
                                             cg19392396
    TACTCTGTCGTGGGCTGAAGGCACC[CG]GCCTGGGAAAAGGAAACC isoform c
N           .          Homo sapiens growth factor receptor-bound protein 7 (GRB7), transcript variant 2, mRNA.
                                 growth factor receptor-bound protein 7
                                             cg23836594
    GCCTCTGACTTCTCTGTCCGAAGT[CG]GGACACCCTCCTACCACCTGTAGAG
N           .          Homo sapiens growth factor receptor-bound protein 7 (GRB7), transcript variant 2, mRNA.
                                 growth factor receptor-bound protein 7
                                             cg08284496
    GGTACTGTCTGTTCGGCTGTCTTCCC[CG]CCTCTCCCCAGGCACCTGCATC
N           .          Homo sapiens gastrin-releasing peptide receptor (GRPR), mRNA.
                                 gastrin-releasing peptide receptor
                                             cg26196133
    CACATGGACACCCTGTGCATCAGTGTG[CG]TTTAATTCAAAGACAGACCTCATTTGATAG
Y           MU, H-B, GST1, GTH4, GTM1, MU-1,S-transferase M1 (GSTM1), transcript variant 2, mRNA.
                       Homo sapiens glutathione GSTM1-1,M1 isoform 2 GSTM1a-1a,
                                 glutathione cg19763514 MGC26563,
                                             S-transferase
    TGGCTGGTGTCTCAAGCGCACAGCCAAGT[CG]CTGTGGACCTAGCAAGGGCTG GSTM1b-1b
Y           MU, H-B, GST1, GTH4, GTM1, MU-1,S-transferase M1 (GSTM1),
                       Homo sapiens glutathione GSTM1-1,M1 isoform 2 GSTM1a-1a, variant 2, mRNA.
                                 glutathione cg17452244 MGC26563,
                                             S-transferase
    CCCAGAGCCCTTGGGAACTCGGCAG[CG]GAGAGAAGGCTGAGGGACAC transcript GSTM1b-1b
Y           GST4, GSTM, GTHMUS, GSTM2-2 S-transferase M2 (muscle) (GSTM2), mRNA.
                       Homo sapiens glutathione
                                 glutathione cg07246306 M2
                                             S-transferase
    GGGAAGTGTGGAGCAGCTGCAGGA[CG]GGCTCTAGGGACGGTTCC
N           GST4, GSTM, GTHMUS, GSTM2-2 S-transferase M2 (muscle)
                       Homo sapiens glutathione
                                 glutathione cg25855733 M2
                                             S-transferase
    ATCCTACTCCTAGCCCCATGAG[CG]CGCTCCAGGCCTCCAGATTGGCC (GSTM2), mRNA.
N           GST4, GSTM, GTHMUS, GSTM2-2 S-transferase M2 (muscle) (GSTM2), mRNA.
                       Homo sapiens glutathione
                                 glutathione cg11063364 M2
                                             S-transferase
    CCTTGCCTGTGTTGTCCTTCCCA[CG]TTAGGTCTGTCATGCCACGTATGTCCGCAG
Y           PI, DFN7, GST3, FAEES3 glutathione S-transferase pi (GSTP1), mRNA.
                       Homo sapiens
                                 glutathione cg09038676
                                             transferase
    CAAACTTTTCTTTGTTCGCTGCAGTGC[CG]CCCTACACCGTGGTCTATTTCCCAG
Y           PI, DFN7, GST3, FAEES3 glutathione S-transferase pi (GSTP1), mRNA.
                       Homo sapiens
                                 glutathione cg10783184
                                             transferase
    GGGACCCTCCAGAAGAGCGGCCGG[CG]CCGTGACTCAGCACTGGGGCG
Y           PI, DFN7, GST3, FAEES3 glutathione S-transferase pi (GSTP1), mRNA.
                       Homo sapiens
                                 glutathione cg16488483
                                             transferase
    CCGTGACTCAGCACTGGGGCGGAG[CG]GGGCGGGACCACCCTTATAAGGCTCG
Y           LCA, CYGD, LCA1, CORD6, GUC2D, retGC,2D, membrane (retina-specific) (GUCY2D), mRNA.
                       Homo sapiens guanylate cyclase membraneRETGC-1, ROS-GC1
                                 guanylate cyclase 2D, GUC1A4, (retina-specific)
                                             cg13065528
    CGGGTGGGCTTCCGGACCC[CG]GGCTCTGCGGTCCCGCGTGGTGGGCTCC
Y           LCA, CYGD, LCA1, CORD6, GUC2D, retGC,2D, membrane (retina-specific) (GUCY2D), mRNA.
                       Homo sapiens guanylate cyclase membraneRETGC-1, ROS-GC1
                                 guanylate cyclase 2D, GUC1A4, (retina-specific)
                                             cg18094470
    AGGGCTCTGGCCGGCTGTACCCA[CG]CCCCCGCCCTGGCCTGGGCTGGC
N           CYGF, GC-F, GUC2F, guanylate cyclase 2F ROS-GC2 (GUCY2F), mRNA.
                       Homo sapiens guanylate cyclase 2F, retinal
                                 GUC2DL, RETGC-2,
                                             cg24286301
    CCATTCTGTCTAATAACCACCAAT[CG]CCCTTTCTCCAGGACAGTTCTAAATGC
Y           ASM, BWS, ASM1, MGC4485, PRO2605,maternally expressed untranslated mRNA (H19) on chromoso
                       Homo sapiens H19, imprinted D11S813E
                                 .           cg25583987
    TGTGGGAGGGGCTAGCACAGGATC[CG]GTCGTGCTGCCAGCAATGCGCAGG
Y           ASM, BWS, ASM1, MGC4485, PRO2605,maternally expressed untranslated mRNA (H19) on chromoso
                       Homo sapiens H19, imprinted D11S813E
                                 .           cg15886040
    CGATTCCCATCCAGTTGAC[CG]AGCTTGTGCTGGTCACCGCGGTTTCCGC
Y           DTR, DTS, Homo sapiens heparin-binding EGF-like growth factor
                       HEGFL     heparin-binding EGF-like growth factor
                                             cg13470461
    GCCGAATGAGCGCTGCCCGGCTCG[CG]GCCGGGAATAAGGCTCCAGG (HBEGF), mRNA.
N           .          Homo sapiens HBII-13 cg18488946
                                 .            snoRNA (HBII-13) on chromosome 15.
    GTTTACTGAGCATGATGAAGTAAAGCTCAA[CG]TGATTACTCTGAAGTCCAGCCTTACTG
N           .          Homo sapiens HBII-13 cg26410550
                                 .            snoRNA (HBII-13) on chromosome 15.
    TTTGCTGAGCCGATTCAACTTAAAAAG[CG]AGGTCCATACTAAGTGCCCAAGAATCA
N           RNHBII52 Homo sapiens HBII-52 cg24301180
                                 .            snoRNA (HBII-52) on chromosome
    GGCCCCCGACGGGGCCACTGTATTT[CG]GGCTGCAGACCTAGAGGCCCTG 15.
Y           RNHBII52 Homo sapiens HBII-52 cg21361081
                                 .            snoRNA (HBII-52) on chromosome 15.
    GCCCAGGGGCAGGCTATGTGACTGCC[CG]GTCTGCAGCTGTAAGTGGTTTCT
Y           RNHBII52 Homo sapiens HBII-52 cg18037269
                                 .            snoRNA (HBII-52) on chromosome
    GTTGGGGATCCGCCGCAGAAATCA[CG]TGGCGCCCAGGCCAAGGCTGCAA 15.
Y           JTK9       Homo sapiens hemopoietic cell kinase (HCK), mRNA.
                                 hemopoietic cell kinase isoform p61HCK
                                             cg15382497
    GGCGGAGTTAGCCTCGCTCAGGG[CG]CGGCTAAGGCGCCCAGATGGCCTGCGG
Y           JTK9       Homo sapiens hemopoietic cell kinase (HCK), mRNA.
                                 hemopoietic cell kinase isoform p61HCK
                                             cg04775393
    TGGTGTCTGAATGGAGCAGGCCTG[CG]GAAGAGAAACCGCTGACCACAGACC
Y           HD1, RPD3, GON-10, RPD3L1, DKFZp686H12203
                       Homo sapiens histone cg24468890 1 (HDAC1), mRNA.
                                 histone deacetylase 1
                                             deacetylase
    CCTCCTTTGCGGCCACAAACT[CG]CTTTCTAACCCAGGTTCAGCCCT
Y           FLJ22237 Homo sapiens histone cg07719569 11 (HDAC11), mRNA.
                                 histone deacetylase 11
                                             deacetylase
    GTCTTCGCCGGGAGTGCTTGTCC[CG]GAGCTGCTCGCAGACTGGGC
Y           HD5, NY-CO-9 sapiens histone cg08753986 5 (HDAC5), transcript
                       Homo      histone deacetylase 5 isoform 1
                                             deacetylase
    GGCTGCCGATGCTCCCGGGGGG[CG]CCGGCTGGCTCCCAGGGCCGGGA variant 1, mRNA.
Y           HD6, JM21Homo sapiens histone cg20277806 6 (HDAC6), mRNA.
                                 histone deacetylase 6
                                             deacetylase
    GATAAGGGGTGGAGTTAAGTGAAT[CG]TTAAGGGTGGAGTCGAAACC
Y           HD6, JM21Homo sapiens histone cg16009023 6 (HDAC6), mRNA.
                                 histone deacetylase 6
                                             deacetylase
    CGGAGTTTGAGAAAGGGGCTG[CG]TCCAATGAGTGGAGCGGTGAG
N           HDAC7, DKFZP586J0917 histone cg25755806isoform a
                       Homo sapiens
                                 histone deacetylase 7A 7A (HDAC7A),
                                             deacetylase
    AGCCTCACAGGCCCTCTGGGT[CG]CCACCCTCCCATGCTCTATCCC transcript variant 1, mRNA.
N           HD7, HDAC, HDRP, MITR, HDAC7, HDAC7B, 9 (HDAC9), transcript KIAA0744, DKFZp779K1053
                       Homo sapiens histone cg25620356 HDAC9B, HDAC9FL, variant 3,
                                 histone deacetylase 9 isoform 3
                                             deacetylase
    GAGGCACAGACACAGATAGGAGAAGGGCAC[CG]GCTGGAGCCACTTGCAGGACTG mRNA.
N           HD7, HDAC, HDRP, MITR, HDAC7, HDAC7B, 9 (HDAC9), transcript KIAA0744, DKFZp779K1053
                       Homo sapiens histone cg08146609 HDAC9B, HDAC9FL, variant 3,
                                 histone deacetylase 9 isoform 3
                                             deacetylase
    GCATTAATGCAGGCTCCAATCACT[CG]GCCATGCTTGACCTATTTTTGGCTCAGGCC mRNA.
Y           HH, HFE1, Homo sapiens hemochromatosis (HFE), transcript variant 10, mRNA.
                       HLA-H, MGC103790, dJ221C16.10.1 isoform 10 precursor
                                 hemochromatosis protein
                                             cg13740565
    TCCTCCTGATGCTTTTGCAGACCG[CG]GTCCTGCAGGGGCGCTTGCTGCGTGAGTCC
N           SF, HGFB, Homo sapiens hepatocyte growth factor (hepapoietin A; scatter
                       HPTA, F-TCF
                                 hepatocyte cg08988647 isoform 4 precursor
                                             growth factor
    ATGCCTGGGTGAAAGAATCCTGTT[CG]GAGTCAGTGCCTAAAAGAGCCAGTCG factor) (HGF), transcript vari
N           SF, HGFB, Homo sapiens hepatocyte growth factor (hepapoietin A; scatter factor) (HGF), transcript vari
                       HPTA, F-TCF
                                 hepatocyte cg14690980 isoform 4 precursor
                                             growth factor
    AGGCCAAATGTGGGAATGACTAGAG[CG]GTGGGTAGCTGTACAGAAGTGAT
Y           HIP, FLJ20992, FLJ90230 hedgehog interacting protein (HHIP), mRNA.
                       Homo sapiens
                                 hedgehog-interacting protein
                                             cg21706827
    GGGGCGCGCTGTGGCAGCACCTCCC[CG]CGCGCTAGTTAAAAAGAAGAAGAAAAG
Y           HIP, FLJ20992, FLJ90230 hedgehog interacting protein (HHIP), mRNA.
                       Homo sapiens
                                 hedgehog-interacting protein
                                             cg20605716
    GGCCCACTCTTACTTACTTTCTTT[CG]GAGCCTCAGCTTGGCCGCCTTTAGCC
Y           HIP, FLJ20992, FLJ90230 hedgehog interacting protein (HHIP), mRNA.
                       Homo sapiens
                                 hedgehog-interacting protein
                                             cg02524475
    AAACCATCTCAGCCTACTCAA[CG]GCATCTGGGATGTCCCCCTGCCTCTA
Y           hic-1, ZBTB29
                       Homo sapiens hypermethylated in cancer 1 (HIC1),
                                 hypermethylated in cancer 1
                                             cg14023313
    GGGGCTGAGACGCGACCAGGACG[CG]GGGAGGACGGACCAGCAGG mRNA.
Y           hic-1, ZBTB29
                       Homo sapiens hypermethylated in cancer 1 (HIC1), mRNA.
                                 hypermethylated in cancer 1
                                             cg22934970
    GCTGTCCAGCCACTTCCAGT[CG]CCCTGATGACTCGTCGTGGGTTCCTTTAGG
Y           hic-1, ZBTB29
                       Homo sapiens hypermethylated in cancer 1 (HIC1), mRNA.
                                 hypermethylated in cancer 1
                                             cg20066299
    TAGTCTCCTCTATCGCTGGATGAAGCA[CG]AGCCGGGCCTGGGTAGCTATGGCGACGAGC
Y           HRG22, ZBTB30, sapiens hypermethylated in cancer 2 (HIC2), mRNA.
                       Homo KIAA1020
                                 hypermethylated in cancer 2
                                             cg21597330
    TGAGCCTCGGGCAACCGCAGGGAG[CG]TCGAGCAGGGGTCGCAAAGG
Y           HRG22, ZBTB30, sapiens hypermethylated in cancer 2 (HIC2), mRNA.
                       Homo KIAA1020
                                 hypermethylated in cancer 2
                                             cg21212889
    CCCGAGCTTGCAGTCACTGCTGGCTG[CG]CCTTTGAGCCTCGGGCAACCGCAG
Y           MOP1, PASD8, HIF-1alpha, HIF1-ALPHA factor 1, alpha subunit (basic helix-loop-helix transcription f
                       Homo sapiens hypoxia-inducible 1, alpha subunit isoform 1
                                 hypoxia-inducible factor
                                             cg05426380
    GGCGGCAATCGTGCCCAGCACTGAGGC[CG]AGGAGAAAGAGAGCAGGAGCATTACAT
N           HLADZ, HLA-DNA, HLA-DZAhistocompatibility complex, class II, DO DO precursor
                       Homo sapiens major histocompatibility complex, class II, alpha
                                 major       cg23794671
    GGAGGGGCTTGGACCAACTATTACCA[CG]TCCTCCAAGAAGGGACCCCCTGA alpha (HLA-DOA), mRNA.
N           HLADZ, HLA-DNA, HLA-DZAhistocompatibility complex, class
                       Homo sapiens major histocompatibility complex, class II, alpha precursor
                                 major       cg17313945
    CTGTTGGTCCCTCCAGGACC[CG]GGCACCTCCTCCAGGCTGACACA II, DO DO alpha (HLA-DOA), mRNA.
N           DOB        Homo sapiens major histocompatibility complex, class II, DO beta
                                 major histocompatibility complex, class II, DO beta precursor
                                             cg23791206
    AGGCTCGAACCCAAGCCAAGGCCTTCAACA[CG]CCCAGGCACTGACTGAGGTTGAT(HLA-DOB), mRNA.
N           DOB        Homo sapiens major histocompatibility complex, class II, DO beta
                                 major histocompatibility complex, class II, DO beta precursor
                                             cg09734481
    AAAAAGTTGACCTCATCGAAGTAAAGAGTA[CG]TTAGGAGTTACCAGAGGCTGGG (HLA-DOB), mRNA.
N           DOB        Homo sapiens major histocompatibility complex, class II, DO beta (HLA-DOB), mRNA.
                                 major histocompatibility complex, class II, DO beta
                                             cg17103109
    CCTTCTTATTGGGTGTTGACATTGC[CG]ACAGGCAGTGTGTAAATTAAGAAGGAAprecursor
N           HLADP, HLASB, HLA-DP1A histocompatibility complex, class II, DP DP alpha 1 (HLA-DPA1), mRNA.
                       Homo sapiens major histocompatibility complex, class II, alpha
                                 major       cg09321817
    CTCTGATATGGAACATTCTGTCTTCAGGG[CG]CATGTTGTGGGGTCTATAATTGA 1 precursor
N           HLADP, HLASB, HLA-DP1A histocompatibility complex, class II, DP DP alpha 1
                       Homo sapiens major histocompatibility complex, class II, alpha 1 precursor
                                 major       cg11451043
    GAAGAGATGGGAGAATTTTAGGTACCAG[CG]TGGTCAAGAGAGCTCCAGTTCACAGTT (HLA-DPA1), mRNA.
N           HLADP, HLASB, HLA-DP1A histocompatibility complex, class II, DP alpha 1 precursor
                      Homo sapiens major histocompatibility complex, class
                                major         cg13031167
    GGAACAGTGATGAGGAACTGAGGC[CG]AGTGGAGGCAGATGAGACTGA II, DP alpha 1 (HLA-DPA1), mRNA.
N           DPB1, HLA-DP1B, MHC DPB1 histocompatibility complex, class II, DP 1 precursor
                      Homo sapiens major cg12899649 complex, class II, DP beta
                                major histocompatibility
    TTCAAACAGGAGCTCCCTTTAG[CG]AGTCCTTCTTTTCCTGACTGCAGCTCTTT beta 1 (HLA-DPB1), mRNA.
N           DPB1, HLA-DP1B, MHC DPB1 histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA.
                      Homo sapiens major cg21151963 complex, class II, DP beta 1
                                major histocompatibility
    GTGGAAGAACCTGGTAACTCCTGCACAT[CG]CAGGACTCACAGACCTCTGGGAGAprecursor
N           HLA-DXA, DQ alpha major histocompatibility complex, class
                      Homo sapiens major histocompatibility complex, class II, alpha 2
                                              cg15869057
    AGCTCTGCTGCTGGGGGCCCT[CG]CCCTGACTGCCGTGATGAGCCCII, DQ DQ alpha 2 (HLA-DQA2), mRNA.
N           HLA-DXA, DQ alpha major histocompatibility complex, class II, DQ DQ alpha
                      Homo sapiens major histocompatibility complex, class II,
                                              cg09782137
    TATTATTGATGACCTTACCTATCCAAG[CG]GCTGCTCAGAAATTCCCGCCCCalpha 2 2 (HLA-DQA2), mRNA.
N           HLA-DRA1 Homo sapiens major histocompatibility complex, class II, DR alpha (HLA-DRA), mRNA.
                                major histocompatibility complex, class II, DR alpha precursor
                                              cg18576604
    AAGAACTTTACTTCTTTATCCAATGAA[CG]GAGTATCTTGTGTCCTGGACCCTTTGCAAG
N           HLA-DRA1 Homo sapiens major histocompatibility complex, class II, DR precursor
                                major histocompatibility complex, class II, DR alpha
                                              cg25258233
    CCTTCCCCTAGCAACAGATG[CG]TCATCTCAAAATATTTTTCTGATTGGCCAA alpha (HLA-DRA), mRNA.
Y           HLAF, HLA-5.4, HLA-CDA12 histocompatibility complex, class I, F I, F (HLA-F),
                      Homo sapiens major histocompatibility complex, class precursor
                                major         cg19070841
    GAGTGGACCACAGGGTACGCCAAGGCCAA[CG]CACAGACTGACCGAGTGGCCCTGA mRNA.
Y           .         Homo sapiens hepatic cg05876326
                                hepatic leukemia factor
                                              leukemia factor (HLF), mRNA.
    TGAACATTTTGCAAAACGAGGGGTT[CG]AGGCAGGTGAGAGCATCCTGCACGT
Y           HOX1, HOX1I
                      Homo sapiens homeo box A11 (HOXA11), mRNA.
                                homeobox protein A11
                                              cg08479590
    ACCTTGGGCTCTCCGCAGTAGC[CG]AGCTTAACATGATTCTCCACTGCAGCTGCC
Y           HOX1, HOX1I
                      Homo sapiens homeo box A11 (HOXA11), mRNA.
                                homeobox protein A11
                                              cg17466857
    TCATTCATGGTCACTTCCGAAG[CG]CTTTAGTGCCTTCCGTCCCTAAACC
Y           HOX1, HOX1I
                      Homo sapiens homeo box A11 (HOXA11), mRNA.
                                homeobox protein A11
                                              cg18977999
    CAGGGAGGTGCTGGTCATGTGACC[CG]ATGTTGAAATTGACAAGCTGCTAGCT
Y           HOX1, HOX1C, HOX1.3, MGC9376 A5 (HOXA5), mRNA.
                      Homo sapiens homeobox
                                homeobox A5   cg12041264
    CATTGTAGCCGTAGCCGTACCTGC[CG]GAGTGCATGCTCGCCGAGTCCCTGAATT
Y           HOX1, HOX1C, HOX1.3, MGC9376 A5 (HOXA5), mRNA.
                      Homo sapiens homeobox
                                homeobox A5   cg05640017
    CCGGGCTGTAATGTTCCACCCG[CG]CCCAGGTTAACTCGCCTCGGCTGAGGC
Y           HOX1, HOX1C, HOX1.3, MGC9376 A5 (HOXA5), mRNA.
                      Homo sapiens homeobox
                                homeobox A5   cg27409178
    TACAACAACTTTATTTCCCC[CG]TTTTGCAGCCCCTCTTATTTTTGTGTCGA
Y           HOX1, ABD-B, HOX1G, HOX1.7, MGC1934 isoformtranscript variant 2,
                      Homo sapiens homeo box A9 A9
                                homeobox protein (HOXA9), b
                                              cg10604830
    TGGGTTCCACGAGGCGCCAAACACCGT[CG]CCTTGGACTGGAAGCTGCACG mRNA.
Y           HOX1, ABD-B, HOX1G, HOX1.7, MGC1934 isoformtranscript variant 2,
                      Homo sapiens homeo box A9 A9
                                homeobox protein (HOXA9), b
                                              cg15262939
    CTACAAGTGGCATGAATGGAAGGCAAGTT[CG]GTTTGGGAAAAGGCAGCCTC mRNA.
Y           HOX1, ABD-B, HOX1G, HOX1.7, MGC1934 isoformtranscript variant 2, mRNA.
                      Homo sapiens homeo box A9 A9
                                homeobox protein (HOXA9), b
                                              cg03715906
    CCCCATACACACACTTCTTAAG[CG]GACTATTTTATATCACAATTAATCACGCCA
Y           .         Homo sapiens homeo box B13 (HOXB13), mRNA.
                                homeo box cg21160992
                                               B13
    GCGTTTTAAATCGCTCCCAGCT[CG]CAAGTCGCCTGCATTCGCTCAGCACG
Y           .         Homo sapiens homeo box B13 (HOXB13), mRNA.
                                homeo box cg20726134
                                               B13
    CTGCATTCGCTCAGCACGGCCGTCTTGA[CG]CAAGAGACGCAGGGGCCCGG
N           K8, HOX2, HOX2H, Hox-2.8 boxbox B2 (HOXB2), mRNA.
                      Homo sapiens homeo cg06811494
                                homeo          B2
    AGGAAAAGATGAGTGAGGATCTCCG[CG]TTGGAGGAAGAGGGAGTC
Y           K8, HOX2, HOX2H, Hox-2.8 boxbox B2 (HOXB2), mRNA.
                      Homo sapiens homeo cg09313705
                                homeo          B2
    TCTATTAAACCCAGGACTCCAG[CG]AAATTACAGGGAATTCGTGGTCACGGGACC
Y           CP25, HOX3, HOX3C, homeobox C6 isoform 2
                      Homo sapiens homeobox C6 (HOXC6), transcript variant
                                 HHO.C8 cg02491017
    GTCCGCCCTCAGCTCTTTCTG[CG]CTCGCCTGCAGCAGCCTGGCCCGTG 2, mRNA.
Y           CP25, HOX3, HOX3C, homeobox C6 isoform 2
                      Homo sapiens homeobox C6 (HOXC6), transcript variant
                                 HHO.C8 cg22198132
    ACAAATCTTTGCAAAGCTTTGAATTC[CG]CCTGATCCAACCTTAATGCCCCC 2, mRNA.
N           TMPRSS1 Homo sapiens hepsin (transmembrane protease, serine 1) (HPN), transcript variant 1, mRN
                                hepsin (transmembrane protease, serine 1)
                                              cg03537100
    CTCCTTGCTGATTTGCACACATTGGC[CG]CTTCAGACACGCACTTCTGGGGCCA
N           TMPRSS1 Homo sapiens hepsin (transmembrane protease, serine 1) (HPN), transcript variant 1, mRN
                                hepsin (transmembrane protease, serine 1)
                                              cg00566101
    CCTCTGAAAGCAAAGAGAACTGCACGGG[CG]TCCAGGTGGCCGAATAGCCCTG
Y           HPA, HPR1, HSE1, HPSE1
                      Homo sapiens heparanase (HPSE), mRNA.
                                heparanase    cg01935492
    CGGACCAGGCTTCCTGACGCA[CG]TGTTCTGCGCGCTCTCGTGGGAACCCA
Y           HPA, HPR1, HSE1, HPSE1
                      Homo sapiens heparanase (HPSE), mRNA.
                                heparanase    cg09221015
    CAGATCCCATTCTGATGGCGC[CG]GGTATCCCTCTGACCCTCGAGTAAAAC
Y           A-C1, HSD28, HRASLS1, H-REV107 suppressor (HRASLS), mRNA.
                      Homo sapiens HRAS-like
                                HRAS-like suppressor
                                              cg06932759
    GACTGTGCCCCGCCTCCTGGG[CG]GAGCGGGCGGCTCCCCATGGTCA
Y           A-C1, HSD28, HRASLS1, H-REV107 suppressor (HRASLS), mRNA.
                      Homo sapiens HRAS-like
                                HRAS-like suppressor
                                              cg14777903
    TTAGGGCCAGTCCTTCCTC[CG]CCACTTTGCTGACTCAAAGACCCAGA
Y           30ST2, 3OST2 sapiens heparan sulfate (glucosamine) 3-O-sulfotransferase
                      Homo      heparan sulfate D-glucosaminyl 3-O-sulfotransferase
                                              cg22228897
    CGCAGGCTGCTCTTCGCCTTCA[CG]CTCTCGCTCTCCTGCACTTACCTGTGTTAC 2 2 (HS3ST2), mRNA.
Y           30ST2, 3OST2 sapiens heparan sulfate (glucosamine) 3-O-sulfotransferase 2 (HS3ST2), mRNA.
                      Homo      heparan sulfate D-glucosaminyl 3-O-sulfotransferase 2
                                              cg03823653
    GCCGCCCGGCTGCCCGGAGCCCCAT[CG]CCTAGGACCGGGAGATGCTG
Y           30ST2, 3OST2 sapiens heparan sulfate (glucosamine) 3-O-sulfotransferase 2 (HS3ST2), mRNA.
                      Homo      heparan sulfate D-glucosaminyl 3-O-sulfotransferase 2
                                              cg23911889
    GCCCCAAAGCTGGCCTGGGGCTC[CG]TAGGGAGTGGCCTGCATGG
Y           KAR       Homo sapiens hydroxysteroid (17-beta) dehydrogenase 12
                                steroid dehydrogenase homolog
                                              cg23745162
    CACCGTGGCCTACCTAGCCCTG[CG]TATTTCGTACTCGCTCTTCACGGCCC (HSD17B12), mRNA.
Y           KAR       Homo sapiens hydroxysteroid (17-beta) dehydrogenase 12 (HSD17B12), mRNA.
                                steroid dehydrogenase homolog
                                              cg12574690
    GCTGACGCACTACGCGCAGAGGGAAAGA[CG]GGTCACCAATAGCGACACGGATATGG
N           .         Homo sapiens heat shock 70kDa protein 2 (HSPA2), mRNA.
                                heat shock cg05316932 2
                                              70kDa protein
    GGCTGGCCTGTCGGCCTCTGATGCACT[CG]AACTTCCAGCCCTTGGAGCAGACA
Y           S12, 5-HT1B, HTR1D2, HTR1DB, cg26034501 (serotonin) receptor 1B
                      Homo sapiens 5-hydroxytryptamine
                                5-hydroxytryptamine (serotonin) receptor 1B
                                              5-HT1DB
    GGTAGTTAGCCGGGGTGTGCAGTTTC[CG]GGTCCGGTACACTGTGGCAATC (HTR1B), mRNA.
Y           S12, 5-HT1B, HTR1D2, HTR1DB, cg23424273 (serotonin) receptor
                      Homo sapiens 5-hydroxytryptamine
                                5-hydroxytryptamine (serotonin) receptor 1B
                                              5-HT1DB
    GGTTTGTCCCCAGTTGATAGTTC[CG]TGAGTTCCTCAATTATTCCTCCGC 1B (HTR1B), mRNA.
Y           S12, 5-HT1B, HTR1D2, HTR1DB, cg06824029 (serotonin) receptor 1B (HTR1B), mRNA.
                      Homo sapiens 5-hydroxytryptamine
                                5-hydroxytryptamine (serotonin) receptor 1B
                                              5-HT1DB
    CTTCCAGAGCGCCTAGCTAAGC[CG]CCGCGTCTGTGGTTGTTCCTCTCCACAC
N           HTR2, 5-HT2A sapiens 5-hydroxytryptamine (serotonin) receptor
                      Homo      5-hydroxytryptamine (serotonin) receptor
                                              cg05011937
    TGAGGCTGGTGTACATGCTGTTCTCC[CG]GGGCTGGATTTTTGTCTT 2A 2A (HTR2A), mRNA.
N           HTR2, 5-HT2A sapiens 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), mRNA.
                      Homo      5-hydroxytryptamine (serotonin) receptor 2A
                                              cg15268261
    CCTGTTGGCTTCCTCTGGCACGGCT[CG]GCTGGGTTCCTCCCTCCCTGTGCGG
N           DAP, IAP, AMYLIN
                      Homo sapiens islet amyloid polypeptide (IAPP), mRNA.
                                islet amyloid polypeptide precursor
                                              cg18727468
    GAAGGAAATTGGGAAAGTAAAAATCT[CG]AAATTACTTGAAAAGTGGACAATATTA
Y           ICA69, ICAp69 sapiens islet cellcg18085299 1, 69kDa (ICA1), transcript
                      Homo      islet cell autoantigen 1 isoform 2
                                               autoantigen
    CTGCTCTCCGGCAGGTGTTCCA[CG]TGGCCATAGCGTTTGCGTCACAATGACC variant 2, mRNA.
Y           ICA69, ICAp69 sapiens islet cellcg20977170 1, 69kDa (ICA1), transcript
                      Homo      islet cell autoantigen 1 isoform 2
                                               autoantigen
    CTCCGGCAGGTGTTCCACGTGGCCATAG[CG]TTTGCGTCACAATGACCTGGCGG variant 2, mRNA.
Y           BB2, CD54,Homo sapiens intercellular adhesion molecule 1 (CD54), human rhinovirus receptor (ICAM1)
                       P3.58    intercellularcg20539223
                                               adhesion molecule 1 precursor
    GGGAAGGAGGGGCTAGAGACAG[CG]ATTGAAAGGCAACAGCCAGTAGGTTCG
Y           BB2, CD54,Homo sapiens intercellular adhesion molecule 1 (CD54), human rhinovirus receptor (ICAM1)
                       P3.58    intercellularcg03117925
                                               adhesion molecule 1 precursor
    GAGGATGACCCTCTCGGCC[CG]GGCACCCTGTCAGTCCGGAAATAACT
Y           BB2, CD54,Homo sapiens intercellular adhesion molecule 1 (CD54), human rhinovirus receptor (ICAM1)
                       P3.58    intercellularcg05106269
                                               adhesion molecule 1 precursor
    GACTTGAGTTCGGACCCCCT[CG]CAGCCTGGAGTCTCAGTTTACCGCTTTGT
Y           ID        Homo sapiens inhibitorcg09569033 1 isoform a
                                inhibitor of DNA binding
                                               of DNA binding 1, dominant negative helix-loop-helix protein (ID1), tr
    CGAATGCAGCCTCACTCCACTG[CG]CTCTATCTAGTTCACTTCCCAGCCA
Y           ID        Homo sapiens inhibitorcg22503909 1 isoform a
                                inhibitor of DNA binding
                                               of DNA binding 1, dominant negative
    CTAACGGTCTGAGCCGCTGGTTCAGA[CG]CTGACACAGACCGGCCCGGGA helix-loop-helix protein (ID1), tr
N           IFG, IFI  Homo sapiens interferon, gamma (IFNG), mRNA.
                                interferon, gamma
                                              cg23001963
    AGCCTATCAGAGATGCTACAGCAAGT[CG]ATATTCAGTCATTTTCAACCACAAA
N           IFG, IFI  Homo sapiens interferon, gamma (IFNG), mRNA.
                                interferon, gamma
                                              cg09711238
    CCTTTAGACTCCTTGGGTCCTTTGA[CG]ATGAGACAGACCCATTATGCCCACC
N           IFG, IFI  Homo sapiens interferon, gamma (IFNG), mRNA.
                                interferon, gamma
                                              cg03628117
    TGCAAATGACCAGAAAGCAAGGAAAGAATG[CG]GTTAAAAGAACAATTTGGTGAGG
Y           CD119, IFNGR sapiens interferon gamma receptor 1 (IFNGR1), mRNA.
                         Homo       interferon gamma receptor 1
                                                 cg26668632
    GCAAGTTTGCATTAGGCCACAGC[CG]AGCCACAATCCTTATTTTACTAACTCTTGG
Y           AF-1, IFGR2, IFNGT1 interferon-gamma receptor beta chain precursor
                         Homo sapiens interferon gamma receptor 2 (interferon gamma
                                                 cg23375271
    ACATTTCGACTAAAGGGGCGAATCCT[CG]AATTGTGCGATCAAGCACCCGAGAG transducer 1) (IFNGR2), mR
Y           AF-1, IFGR2, IFNGT1 interferon-gamma receptor beta chain precursor
                         Homo sapiens interferon gamma receptor 2 (interferon gamma
                                                 cg21449657
    CTATGTTGCAAAACCCATTTTTGCTAA[CG]TGTCCAGTGGGCTCCCGGGACGAC transducer 1) (IFNGR2), mR
N           IGFI         Homo sapiens insulin-like growth factor 1 (somatomedin C) (IGF1), mRNA.
                                    insulin-like growth factor 1 (somatomedin C)
                                                 cg17084217
    TGTGCAAATGCATCCATCTCCC[CG]AGCTATTTTTCAGATTCCACAGAATTGCA
N           IGFI         Homo sapiens insulin-like growth factor 1 (somatomedin C) (IGF1),
                                    insulin-like growth factor 1 (somatomedin C)
                                                 cg20581381
    ACCAGCTGGCTAGCAATACCCTCT[CG]AGGGTTATGATGTCATTCAAATCCCTCAA mRNA.
Y           CD221, JTK13 sapiens insulin-like growth factor 1 receptor (IGF1R),
                         Homo       insulin-like growth factor 1 receptor precursor
                                                 cg20742855
    CCACTGCGGGAACTTTTCCTC[CG]AGGGGCTGCGCCCTGTTTGCGAAACCC mRNA.
Y           CD221, JTK13 sapiens insulin-like growth factor 1 receptor (IGF1R),
                         Homo       insulin-like growth factor 1 receptor precursor
                                                 cg19714640
    CAGGGCCGGGCTTGTTTTTCCT[CG]CCTAGGCAGATTTGGGCTTTGCCCCCT mRNA.
Y           FLJ44734 Homo sapiens insulin-like growth factor 2 (somatomedin A) (IGF2), mRNA.
                                    insulin-like growth factor 2
                                                 cg10649864
    GGCAGGCGCACAGCGGGAGAGAACAGCA[CG]GAGAGAAACAGAAAGCGTGTAATTAA
Y           FLJ44734 Homo sapiens insulin-like growth factor 2 (somatomedin A) (IGF2), mRNA.
                                    insulin-like growth factor 2
                                                 cg04741015
    CCACCAGGAGGCTGCACTGCGGGTG[CG]CCCCGTCTGAGTGCAGATGCAGGT
Y           FLJ44734 Homo sapiens insulin-like growth factor 2 (somatomedin A) (IGF2), mRNA.
                                    insulin-like growth factor 2
                                                 cg17626526
    GGGGCCAGACGCCAAGAGGGGCG[CG]GGGAGCACAGAGAAGCGGAG
Y           PEG8         Homo sapiens insulin-like growth factor 2 antisense (IGF2AS), mRNA.
                                    insulin-like growth factor 2 antisense
                                                 cg16130058
    CGCCTCCCGGCGGAGTCCTAGGCC[CG]CGGGCTAGAGGCACTTTACCGCC
Y           PEG8         Homo sapiens insulin-like growth factor 2 antisense (IGF2AS), mRNA.
                                    insulin-like growth factor 2 antisense
                                                 cg14188639
    GGAAACCATCTCCTGGAGAGTTTGAA[CG]ATGTAAGAAAGCACTGTGATTTTTACC
Y           MPRI, CD222, CIMPR,insulin-like growth factor 2 receptor
                         Homo sapiens insulin-like growth factor 2 receptor (IGF2R), mRNA.
                                      M6P-R      cg10401981
    CACGGATCCGCTGCCACTAGGCTGTG[CG]AAGGCATTTACCTCCCTGGCACTTTGAT
Y           AFBP, IBP1, PP12, IGF-BP25, hIGFBP-1 factor binding protein 1 isoform b precursor
                         Homo sapiens insulin-like growth factor binding protein 1 (IGFBP1),
                                    insulin-like growth
                                                 cg20666158
    ATTTTGAACACTCAGCTCCTAGCGTG[CG]GCGCTGCCAATCATTAACCTCCTGGTGC transcript variant 2, mRN
Y           AFBP, IBP1, PP12, IGF-BP25, hIGFBP-1 factor binding protein 1 isoform b precursor
                         Homo sapiens insulin-like growth factor binding protein 1 (IGFBP1), transcript variant 2, mRN
                                    insulin-like growth
                                                 cg00110785
    CCTCCCACCAGCGGTTTG[CG]TAGGGCCTTGGGTGCACTAGCAAAACAAAC
Y           IBP2, IGF-BP53 sapiens insulin-like growth factor binding protein 2, 36kDa
                         Homo       insulin-like growth factor binding protein 2, 36kDa
                                                 cg20018535
    AGGGGAAGCGCGCAAACGAAGTCCT[CG]CGAACTGAACTGAGAGCAGACAAAAG (IGFBP2), mRNA.
Y           IBP2, IGF-BP53 sapiens insulin-like growth factor binding protein 2,
                         Homo       insulin-like growth factor binding protein 2, 36kDa
                                                 cg07828219
    GCCTTATGTCTTTTGTGTTCCCCAG[CG]GTTAGCCCAGTGCCGGCCACAGG36kDa (IGFBP2), mRNA.
Y           IBP3, BP-53  Homo sapiens insulin-like growth factor binding protein 3 (IGFBP3), transcript variant 2, mRN
                                    insulin-like growth factor binding protein 3 isoform
                                                 cg14625938
    GCAGGGATGGGGCGACAGTACACGG[CG]CGAAGCTGTGGAATCCAGGCAG b precursor
Y           IBP3, BP-53  Homo sapiens insulin-like growth factor binding protein 3 (IGFBP3), transcript variant 2, mRN
                                    insulin-like growth factor binding protein 3 isoform
                                                 cg05094933
    TCCTGTCGGCCTTCTCTGGCACT[CG]AGTTTCTTCAGTTTTGTCTGCGCACCC b precursor
Y           IBP3, BP-53  Homo sapiens insulin-like growth factor binding protein 3 (IGFBP3), transcript variant 2, mRN
                                    insulin-like growth factor binding protein 3 isoform
                                                 cg12826145
    GTCGGGGAAACTGGCATACAGCGCTC[CG]CATTCGTGTGTACCTCGTGGAGCTb precursor
Y           IBP5         Homo sapiens insulin-like growth factor binding protein
                                    insulin-like growth factor binding protein 5
                                                 cg05007802
    CCACTTTGCCACCTCCTCTT[CG]AAATTCGCAGGTTCTACGCGAAGTCC 5 (IGFBP5), mRNA.
Y           IBP5         Homo sapiens insulin-like growth factor binding protein 5 (IGFBP5), mRNA.
                                    insulin-like growth factor binding protein 5
                                                 cg20419545
    GAAGTTTCCAAAGAGACTACGGGGCTC[CG]GGAGAGCAGGCGCTTTTAAATAGC
N           IBP6         Homo sapiens insulin-like growth factor binding protein 6
                                    insulin-like growth factor binding protein 6
                                                 cg07927839
    CGACTGCTCTGGAAGGAGAGGA[CG]GGGCACAAACCCTGACCATGACCC (IGFBP6), mRNA.
Y           IBP6         Homo sapiens insulin-like growth factor binding protein 6
                                    insulin-like growth factor binding protein 6
                                                 cg00122038
    CGGGTCCCTGCATGCCCCT[CG]TCGTCCTACACATACACACTAAGTGGATT(IGFBP6), mRNA.
Y           PSF, FSTL2, MAC25, IGFBP-7 growth factor binding protein 7
                         Homo sapiens insulin-like growth factor binding protein
                                    insulin-like cg10799769
    CTCAGGGATCGCACCGCAGTG[CG]AGCGGCTCTTCCACCCTCTGGTTTC 7 (IGFBP7), mRNA.
Y           PSF, FSTL2, MAC25, IGFBP-7 growth factor binding protein 7 7 (IGFBP7), mRNA.
                         Homo sapiens insulin-like growth factor binding protein
                                    insulin-like cg16546204
    AAACTTCTTAACAACCACGGCTT[CG]AGACGATCCAGGGTTTCATCTATTAAATC
Y           BL2, ST17, Homo sapiens immunoglobulin superfamily, member 4 (IGSF4), mRNA.
                         NECL2, TSLC1, IGSF4A, SYNCAM, sTSLC-1, synCAM1, DKFZp686F1789
                                    immunoglobulin superfamily, member 4
                                                 cg05357252
    GCACACCGAGTGCATCTGGCCTAG[CG]AACCAGACGTTGCAAATTTCCGTCA
Y           BL2, ST17, Homo sapiens immunoglobulin superfamily, member 4 (IGSF4), mRNA.
                         NECL2, TSLC1, IGSF4A, SYNCAM, sTSLC-1, synCAM1, DKFZp686F1789
                                    immunoglobulin superfamily, member 4
                                                 cg21658836
    TGAGATGCTAATGACATGCGCTGGAGG[CG]GAGTCCGGGCAGACCAATCACAGCG
Y           TSLL2, synCAM4 sapiens immunoglobulin superfamily, member 4C
                         Homo       immunoglobulin superfamily, member 4C
                                                 cg11412242
    CAGCAGCAGCGGCCACTGGAAG[CG]CCGGGCCCGGCCCATGGTGCCG (IGSF4C), mRNA.
Y           TSLL2, synCAM4 sapiens immunoglobulin superfamily, member 4C
                         Homo       immunoglobulin superfamily, member 4C
                                                 cg22436852
    GCAGGTGGGTGTCTGGAGTCTAG[CG]AGAGGCTGTGAGCTGAGCCACCG (IGSF4C), mRNA.
Y           BDA1, HHG2   Homo sapiens Indian hedgehog homolog (Drosophila) (IHH),
                                    Indian hedgehog homolog
                                                 cg27171516
    TCTTGCCTTCATAGCGTCCGCTGG[CG]CCCAGGGTCTTCTCGGGCACATTGGGmRNA.
Y           BDA1, HHG2   Homo sapiens Indian hedgehog homolog (Drosophila) (IHH), mRNA.
                                    Indian hedgehog homolog
                                                 cg06266124
    CGACTCTGAGCTGCCGGGCTCGC[CG]GCCGCCAATAAATAGGCCGGCCC
Y           BDA1, HHG2   Homo sapiens Indian hedgehog homolog (Drosophila) (IHH), mRNA.
                                    Indian hedgehog homolog
                                                 cg11512176
    ACCCATGTCCCTGCCTCCTGTG[CG]CTCGACAGCGAACCTGCAGCAAGGG
N           CSIF, TGIF, IL-10,sapiens MGC126450, MGC126451
                         Homo IL10A, interleukin precursor mRNA.
                                    interleukin 10 10 (IL10),
                                                 cg14180511
    ATTCGCGTGTTCCTAGGTCACAGTGA[CG]TGGACAAATTGCCCATTCCAGAATAC
N           CSIF, TGIF, IL-10,sapiens MGC126450, MGC126451
                         Homo IL10A, interleukin precursor mRNA.
                                    interleukin 10 10 (IL10),
                                                 cg10978799
    AGCCACAATCAAGGTTTCC[CG]GCACAGGATTTTTTCTGCTTAGAGCTCCT
Y           AGIF, IL-11Homo sapiens interleukin precursor mRNA.
                                    interleukin 11 11 (IL11),
                                                 cg11932022
    CCTGTCTCCGGGTCCCTCTCTGTG[CG]ACTCAGCGGGGTCTGCTCCCACC
Y           AGIF, IL-11Homo sapiens interleukin precursor mRNA.
                                    interleukin 11 11 (IL11),
                                                 cg16546221
    GAGGCATGTGCCCTGAGCAGCAGGGCCG[CG]GCAGTGAGGGAGTGTGGAC
Y           CLMF, NFSK, NKSF1, interleukin 12A12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte m
                         Homo sapiens interleukin precursor
                                     IL-12A      cg03993981
    CACAGGTCTGCATCCAGCGGCT[CG]CCCTGTGTCCCTGCAGTGCCGGCTCAG
N           CLMF, NKSF, CLMF2, interleukin 12B12B (natural killer cell stimulatory factor
                         Homo sapiens interleukin precursor
                                     NKSF2, IL-12B
                                                 cg18307303
    GAAGTGCTTACCTTGCTCTGGGCAGGA[CG]GAGAGTCCAATGGCCCTGAAACAGAT2, cytotoxic lymphocyte m
Y           CLMF, NKSF, CLMF2, interleukin 12B12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte m
                         Homo sapiens interleukin precursor
                                     NKSF2, IL-12B
                                                 cg11461541
    AGACCTTACATCCAGCTCAGAG[CG]CCTCCTCCCATCCCCTGTGTC
N           CLMF, NKSF, CLMF2, interleukin 12B12B (natural killer cell stimulatory
                         Homo sapiens interleukin precursor
                                     NKSF2, IL-12B
                                                 cg22428246
    GTCAGACGGGAGGCTGAGTTCATGT[CG]GGATGGAACAACTGTATGCCCAA factor 2, cytotoxic lymphocyte m
N           ALRH, P600, IL-13, MGC116786, 13 precursor mRNA.
                         Homo sapiens interleukin 13 (IL13), MGC116789
                                    interleukin MGC116788,
                                                 cg20391122
    GGCCTCATGGCGCTTTTGTTGACCA[CG]GTCATTGCTCTCACTTGCCTTGGCGGCTTT
N           LCF, IL-16, Homo sapiens interleukin isoform 1 precursor
                         prIL-16, FLJ44234, HsT19289
                                    interleukin 16 16 (lymphocyte chemoattractant
                                                 cg12993983
    TCAAGGAGGGCAGGAGTTGGAAG[CG]ACCGTTGTGAAACGTTAAAGATTT factor) (IL16), transcript variant 1,
N           LCF, IL-16, Homo sapiens interleukin isoform 1 precursor
                         prIL-16, FLJ44234, HsT19289
                                    interleukin 16 16 (lymphocyte chemoattractant factor) (IL16), transcript variant 1,
                                                 cg13639030
    CTCATATTCAAATACTCCCAGC[CG]AGAAGCTGCCATCGATCCTCCCATG
Y           CRL4, EVI27, IL17BR, interleukin MGC5245
                         Homo sapiens interleukin 17 receptor B (IL17RB), transcript variant 1, mRNA.
                                    IL17RH1, 17B receptor isoform 1 precursor
                                                 cg26793386
    TCGAGCCCAGATCCTGACGT[CG]TCTGATCCGCCAGTCCAGGCTGCC
Y           CRL4, EVI27, IL17BR, interleukin MGC5245
                         Homo sapiens interleukin 17 receptor B (IL17RB), transcript variant 1, mRNA.
                                    IL17RH1, 17B receptor isoform 1 precursor
                                                 cg16868427
    CAGCTCCAAATCGCCAGTGCTGA[CG]GCTTCCGCTTTGGGAGCCCCAG
N           IL18BPa Homo sapiens interleukin binding protein isoform C
                                    interleukin 18 18 binding protein (IL18BP), transcript variant C, mRNA.
                                                 cg24976110
    TGGGAAAGGCCAGGATGTGGA[CG]GACTGGTATGGCATTGAGCCTG precursor
N           IL18BPa Homo sapiens interleukin binding protein isoform C precursor
                                    interleukin 18 18 binding protein (IL18BP), transcript variant
                                                 cg08430407
    CTTCCCTCCTGTTAGGGTTGGCTCT[CG]AGCTTGTGTGCCAGTTCCTGGGTTGGCCGT C, mRNA.
N           IL1, IL-1A, IL1F1, IL1-ALPHA
                         Homo sapiens interleukin 1, alpha (IL1A), mRNA.
                                    interleukin 1, alpha proprotein
                                                 cg03970341
    TTCTGTAGAAGAAGGTGTGTGCAAGCCC[CG]GGAGGTATGCGTAAGGCCTCAG
N           IL-1, IL1F2,Homo sapiens interleukin 1, beta (IL1B), mRNA.
                         IL1-BETA interleukin 1, beta proprotein
                                                 cg12992979
    TTCTTGGCTGGGGCAGAGAACATA[CG]GTATGCAGGGTTCAGGCTCCTG
N           IL-1, IL1F2,Homo sapiens interleukin 1, beta (IL1B), mRNA.
                         IL1-BETA interleukin 1, beta proprotein
                                                 cg14658384
    CAAGAGTTATCAGTTTCTCTTTAAC[CG]AGACACCAGCAAAGTGCCTGCTCCA
N           IRAP, IL1F3, IL1RA, IL-1ra3, ICIL-1RA,receptor antagonist (IL1RN), transcript variant 4, mRNA.
                         Homo sapiens interleukin 1 MGC10430
                                    interleukin 1 receptor antagonist isoform 4
                                                 cg17669033
    GAGGGACTGTGGCCCAGGTACTGCC[CG]GGTGCTACTTTATGGGCAGCAGCT
N           IRAP, IL1F3, IL1RA, IL-1ra3, ICIL-1RA,receptor antagonist (IL1RN), transcript variant 4, mRNA.
                       Homo sapiens interleukin 1 MGC10430
                                  interleukin 1 receptor antagonist isoform
                                               cg14497465
    CATCAAGTCAGCCATCAGC[CG]GCCCATCTCCTCATGCTGGCCAAC 4
N           IL-2, TCGF, lymphokine interleukin 2 (IL2), mRNA.
                       Homo sapiens
                                  interleukin 2 precursor
                                               cg24372185
    CACCTGGGACACTATGAATGTAACAATAAT[CG]TTATGAAATATGATCTTGTTTTTAGTC
N           IL-3, MCGF, MGC79398, MGC79399, MULTI-CSF
                       Homo sapiens interleukin 3 (colony-stimulating factor, multiple) (IL3),
                                  interleukin 3 precursor
                                               cg17175013
    CCAGAAACAAAGTGTCAAGGAGAAGCTGCC[CG]AAGCCCATGGGACAAACCACTGG mRNA.
N           BSF1, IL-4,Homo sapiens interleukin 4 (IL4), transcript variant 1, mRNA.
                       MGC79402   interleukin 4 isoform 1 precursor
                                               cg23943829
    CCCAAACTAGGCCTCACCTGATA[CG]ACCTGTCCTTCTCAAAACACCTAAA
N           HGF, HSF, Homo sapiens interleukin 6 (interferon, beta 2) (IL6), mRNA.
                       BSF2, IL-6,interleukin 6 (interferon, beta 2)
                                   IFNB2       cg05401786
    GTGTGGCCCAGGGAGGGCTGG[CG]GGCGGCCAGCAGCAGAGGCAGGC
N           HGF, HSF, Homo sapiens interleukin 6 (interferon, beta 2) (IL6), mRNA.
                       BSF2, IL-6,interleukin 6 (interferon, beta 2)
                                   IFNB2       cg13802710
    TCTGCTTCTTAGCGCTAGCCTCAATGA[CG]ACCTAAGCTGCACTTTTCCCCCTAG
N           HGF, HSF, Homo sapiens interleukin 6 (interferon, beta 2) (IL6), mRNA.
                       BSF2, IL-6,interleukin 6 (interferon, beta 2)
                                   IFNB2       cg26061582
    ACCTGGAGACGCCTTGAAGTAACTGCA[CG]AAATTTGAGGATGGCCAGGCAG
N           K60, NAF, GCP1, sapiens interleukin 8 (IL8), 3-10C, CXCL8, GCP-1, LYNAP,
                       Homo IL-8,interleukin 8 precursormRNA.
                                   LECT, LUCT, NAP1,
                                               cg01548201
    GTGTAAACATGACTTCCAAGCTGGC[CG]TGGCTCTCTTGGCAGCCTTCCTGATTTCTMDNCF, MONAP, NAP-1
N           K60, NAF, GCP1, sapiens interleukin 8 (IL8), 3-10C, CXCL8, GCP-1, LYNAP, MDNCF, MONAP, NAP-1
                       Homo IL-8,interleukin 8 precursormRNA.
                                   LECT, LUCT, NAP1,
                                               cg18302652
    AGGGGATGGGCCATCAGTTGCAAAT[CG]TGGAATTTCCTCTGACATAATGAAA
Y           MGC33718Homo sapiens Impact homolog (mouse) (IMPACT), mRNA.
                                  Impact homolog
                                               cg18332806
    CTCCGCCCTACGGGAGACAGTGAAGG[CG]GGAGCAAGGCCCCAACCGAGAA
Y           MGC33718Homo sapiens Impact homolog (mouse) (IMPACT), mRNA.
                                  Impact homolog
                                               cg26974425
    CGTGAGGGCCTCTGGCTGCAACTCG[CG]AGGGTCGGCTTTCCCTGGGTCTCCG
Y           .          Homo sapiens inhibin, alpha (INHA), mRNA.
                                  inhibin alpha subunit precursor
                                               cg01858402
    CGAGGCCGCCAGCTGCTGCC[CG]CCCTTCTCCCACACCACTACA
Y           .          Homo sapiens inhibin, alpha (INHA), mRNA.
                                  inhibin alpha subunit precursor
                                               cg16613202
    GGTCAGCAGCAGGCCGTGCTCCGCGC[CG]TCCGCCGGGAAGCTCAGGC
N           .          Homo sapiens insulin precursor
                                  proinsulin (INS), mRNA.
                                               cg24338752
    CATTAGAGTCTTAACCAGGGGCC[CG]GTGGCCAGACCTGTCCCTGCTCACA
N           .          Homo sapiens insulin precursor
                                  proinsulin (INS), mRNA.
                                               cg13349859
    CCCCAGTCCCGGATGGCCCAAGATGC[CG]CCATGGATGGGCCAAGGTG
Y           CD220      Homo sapiens insulin receptor (INSR), mRNA.
                                  insulin receptor
                                               cg19110381
    CCCGGTGGCCATGGCTGCGGGAG[CG]CGGGGTCTCCTCGGATCAGAGCGCG
Y           CD220      Homo sapiens insulin receptor (INSR), mRNA.
                                  insulin receptor
                                               cg00650214
    GACGCTTCTGAAAGGGCAAAGACGA[CG]CCAAAGAAGACGCCGGAGACCTC
Y           IUF1, PDX1, IDX-1, MODY4, PDX-1, STF-1 1, homeodomain transcription factor
                       Homo sapiens insulin promoter factor 1, homeodomain transcription
                                  insulin promoter factor
                                               cg20815612
    CCATTTTGGGGAGCACCGCCAGCTGCC[CG]TTCAGGAGTGTGCAGCAAACTCAGCTG factor (IPF1), mRNA.
Y           IUF1, PDX1, IDX-1, MODY4, PDX-1, STF-1 1, homeodomain
                       Homo sapiens insulin promoter factor 1, homeodomain transcription factor (IPF1), mRNA.
                                  insulin promoter factor
                                               cg14584091
    CCTCGCTGTATTGGGAAGCTACGTTC[CG]GGCTGGCCAAATGGGCCCtranscription factor
Y           IRAK, pelleHomo sapiens interleukin-1 receptor-associated kinase 1
                                  interleukin-1 receptor-associated kinase 1 isoform 1
                                               cg03050491
    AAAGCTCCTGGGCGGCCCTGC[CG]GAACCCTGCTCTCCACTGCGGCCTGC(IRAK1), transcript variant 1, mRN
Y           IRAK, pelleHomo sapiens interleukin-1 receptor-associated kinase 1 (IRAK1),
                                  interleukin-1 receptor-associated kinase 1 isoform 1
                                               cg15882145
    GTCCTGAAATATGCCGAGAACGCTGCC[CG]CCACAGCCGTGAGTGTATGCGTTGCT transcript variant 1, mRN
Y           IRAK-M     Homo sapiens interleukin-1 receptor-associated kinase 3 (IRAK3), mRNA.
                                  interleukin-1 receptor-associated kinase 3
                                               cg06323619
    GCACACGCTGCTGTTCGACCTGCCGCCCG[CG]CTGCTCGGAGAGCTCTGCGCT
Y           IRAK-M     Homo sapiens interleukin-1 receptor-associated kinase 3
                                  interleukin-1 receptor-associated kinase 3
                                               cg22778955
    TGCCGTCGTGGAAGCAGGATTTCCG[CG]GTTGTGTAACGGCCTGTCGCAG (IRAK3), mRNA.
Y           IRAK-M     Homo sapiens interleukin-1 receptor-associated kinase 3 (IRAK3), mRNA.
                                  interleukin-1 receptor-associated kinase 3
                                               cg24003063
    CCCCACCGCAGAGGTGTGAAGGGG[CG]CAAAGCCAGCGAAGGGAGAACCCG
Y           .          Homo sapiens interferon regulatory factor 5 (IRF5), transcript
                                  interferon regulatory factor 5 isoform b
                                               cg02343258
    TGCTCCCTGGCGCAGCCACGCAGGCGCAC[CG]CAGACAGGTGGGTCCCGGCCvariant 2, mRNA.
Y           .          Homo sapiens interferon regulatory factor 5 (IRF5), transcript
                                  interferon regulatory factor 5 isoform b
                                               cg20139768
    TGGGCCTGGCCCGAGGCTCAGCC[CG]GATCTGCAGTTGCCAGGTCAGTGCG variant 2, mRNA.
Y           IRF7A, IRF-7H sapiens interferon regulatory factor 7 (IRF7), transcript variant b, mRNA.
                       Homo       interferon regulatory factor 7 isoform b
                                               cg11519262
    CGTCAGGGGCGGGTCAGGCTCC[CG]GGAAAGCGAAACCTAAACAGTGG
Y           IRF7A, IRF-7H sapiens interferon regulatory factor 7 (IRF7), transcript variant b, mRNA.
                       Homo       interferon regulatory factor 7 isoform b
                                               cg01030720
    GTAATGGGAGGTGGACGTGCCT[CG]AAAAAGGGGCAGCTGCACCGTT
Y           Isl-1      Homo sapiens ISL1 transcription factor, LIM/homeodomain,
                                  islet-1      cg13836786
    TGGACTCCTAGATCCGCGAGGG[CG]CGGCGCAGCCGAGCAGCGGCTCTTT (islet-1) (ISL1), mRNA.
Y           Isl-1      Homo sapiens ISL1 transcription factor, LIM/homeodomain, (islet-1) (ISL1), mRNA.
                                  islet-1      cg14024101
    GCGGGGACCCCAGGAGCGCAGGG[CG]GAGGAGCAGCGCCACAGGAGGC
Y           Isl-1      Homo sapiens ISL1 transcription factor, LIM/homeodomain,
                                  islet-1      cg16203270
    CAGGCCCCGGGGATGTGCACCACGG[CG]TGGGGACCAAACCAAGCTGAAC (islet-1) (ISL1), mRNA.
Y           BR, GPIa, CD49B, VLA-2, integrin,cg02729277
                       Homo sapiens VLAA2 alpha 2 (CD49B, alpha 2 subunit
                                  integrin alpha 2 precursor
    CGCTCAGTCAAGGTAAGCGGGGATTT[CG]CTCTGCATCGGCTGCAGGAGGof VLA-2 receptor) (ITGA2), mRNA
Y           BR, GPIa, CD49B, VLA-2, integrin,cg15676241
                       Homo sapiens VLAA2 alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) (ITGA2), mRNA
                                  integrin alpha 2 precursor
    GAGTGTGCAGGTTCTCGTATCCCT[CG]GCCAAGGGTATCCTCTGCAAACCTCT
Y           CD49f      Homo sapiens integrin,cg11435793 6 mRNA.
                                  integrin alpha chain, (ITGA6),
                                                alpha 6 alpha
    GTAAAGTCTCCCTCGCTCTGTGCTACT[CG]GCAACCACAATTCTGTCCACAGAG
Y           CD49f      Homo sapiens integrin,cg03085296 6 mRNA.
                                  integrin alpha chain, (ITGA6),
                                                alpha 6 alpha
    TTAAACAACCCATCCTTGACTTG[CG]TGACTTCTTCCACAAGCTCTCCTGGT
Y           CD29, FNRB, MDF2, VLAB, GPIIA,beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes
                       Homo sapiens integrin,cg03222924
                                  integrin beta 1 isoform 1C-1 precursor
                                                 MSK12
    CGTTTGTCCACTGATGTCCCGTTT[CG]AGCCCGGGAGATCCTGCATCTCGG
Y           CD104      Homo sapiens integrin,cg25109886 precursor
                                  integrin betabeta 4 (ITGB4), transcript variant 1, mRNA.
                                                 4 isoform 1
    GCCCCGAGGTAGGTCCAGGACGGG[CG]CACAGCAGCAGCCGAGGCTGGCCGG
Y           CD104      Homo sapiens integrin,cg24018755 precursor
                                  integrin betabeta 4 (ITGB4), transcript variant 1, mRNA.
                                                 4 isoform 1
    GGTTGGAGGCTGAGAGGACCC[CG]TGAACTGCAGAGCAGAGCTGGGA
N           EMT, LYK, Homo sapiens IL2-inducible T-cell kinase (ITK), mRNA.
                       PSCTK2, MGC126257, MGC126258
                                  IL2-inducible T-cell kinase
                                               cg09489988
    TCTCCCTCGAACTTTAAAGTC[CG]CTTCTTTGTGTTAACCAAAGCCAGCCT
N           EMT, LYK, Homo sapiens IL2-inducible T-cell kinase (ITK), mRNA.
                       PSCTK2, MGC126257, MGC126258
                                  IL2-inducible T-cell kinase
                                               cg18953183
    GTGAATTTTGAAAGGATGTGGTTT[CG]GCCTTTGACATCAGAGGAGAAGCTC
Y           IP3R2      Homo sapiens inositol 1,4,5-triphosphate receptor, 2
                                  inositol 1,4,5-triphosphate receptor, type
                                               cg06767844
    CTGCGCTTCGTTAACTCCAAGC[CG]AGGTTAACCTTCCACCCCCAT type 2 (ITPR2), mRNA.
Y           IP3R3      Homo sapiens inositol 1,4,5-triphosphate receptor, type 3 (ITPR3), mRNA.
                                  inositol 1,4,5-triphosphate receptor, type 3
                                               cg26541279
    ATCGGGGACATCGTCTCCCTGTA[CG]CCGAGGGCTCCGTCAATGGCTTCATC
Y           IP3R3      Homo sapiens inositol 1,4,5-triphosphate receptor, type 3 (ITPR3), mRNA.
                                  inositol 1,4,5-triphosphate receptor, type 3
                                               cg25867695
    AGAACAGAAAGTAAGCGAGCCCGGGACG[CG]AATTTGAGGGCAGGACTTCG
Y           AGS, AHD,Homo sapiens jagged 1 (Alagille syndrome) (JAG1), mRNA.
                       AWS, HJ1,jagged 1 JAGL1, MGC104644
                                   CD339, precursor
                                               cg24801688
    GGAGAGCCCGTCTGGCAGCAG[CG]GCCGGGGCTGGCCACCTCTACCC
Y           HJ2        Homo sapiens jagged 2 (JAG2), transcript variant 2, mRNA.
                                  jagged 2 isoform b precursor
                                               cg05426823
    CGCAGCCAACAAGTTCGGAA[CG]AGACTGACAGCTCGCTCGCCCATTC
Y           HJ2        Homo sapiens jagged 2 (JAG2), transcript variant 2, mRNA.
                                  jagged 2 isoform b precursor
                                               cg11194060
    GGCTCCTGCCGGGTGTCAGAAAC[CG]GGGGTGGGGCGCCCCGAGGTTGCCG
Y           .          Homo sapiens Janus kinase 2 (a protein tyrosine kinase)
                                  Janus kinase 2
                                               cg25899328
    TCGCTAGGCCTTGTTGCCAACC[CG]CAGGCGGCTGGGCGCTTCATCCCAC (JAK2), mRNA.
Y           JAKL, LJAK, JAK-3, L-JAK, JAK3_HUMAN protein tyrosine kinase, leukocyte) (JAK3), mRNA.
                       Homo sapiens Janus kinase 3 (a
                                  Janus kinase 3
                                               cg05635754
    CCAGTGTCTGGGCCGAGCCCTG[CG]GCATCGCCAGCTCTTACCTAGCGGGC
N           JAKL, LJAK, JAK-3, L-JAK, JAK3_HUMAN protein tyrosine kinase, leukocyte) (JAK3), mRNA.
                       Homo sapiens Janus kinase 3 (a
                                  Janus kinase 3
                                               cg05244380
    GGACAGGCACAGACTGGAACTTGGACC[CG]AGGCAGGACAGGGAGCTGGC
N           JAKL, LJAK, JAK-3, L-JAK, JAK3_HUMAN protein tyrosine kinase, leukocyte)
                       Homo sapiens Janus kinase 3 (a
                                  Janus kinase 3
                                               cg02285920
    GCAGAAAGTTCCGGAAGCCTCTGCATCAGC[CG]CCCCGTTCAGACAGGCTGCTGGA (JAK3), mRNA.
Y           .          Homo sapiens jun B proto-oncogene (JUNB), mRNA.
                                  jun B proto-oncogene
                                               cg00546267
    GGCTGTTGCCACACTTCCTGCCTCTG[CG]CTCTTTCCCCAGCCTGTTTCTAAGG
Y           TRAAK, DKFZP566E164 potassium channel, subfamilymember 4 isoform 1
                       Homo sapiens
                                  potassium channel, subfamily K, K, member 4
                                               cg01352108
    GAGATGCCAGATTAGCGTGGTGCCTGTC[CG]GAGAGACGGGCCAGCTGATG(KCNK4), transcript variant 1, mR
N           TRAAK, DKFZP566E164 potassium channel, subfamilymember 4 isoform 1
                      Homo sapienspotassium channel, subfamily K, K,
                                                cg25881850
    AGGTGGGTCCCAACCTCCA[CG]TCGGCCAATTCCAGGTGGCCCC member 4 (KCNK4), transcript variant 1, mR
Y           LQT, RWS,Homo sapiensATFB1, voltage-gated channel, KQT-like subfamily,
                       WRS, LQT1, potassium voltage-gated Kv1.9, Kv7.1,
                                  potassium KCNA8, KCNA9, channel, KQT-like subfamily, member 1 (KCNQ1), t
                                                cg19576908
    AGTTGCCTCCGACCTTGGCC[CG]CGGCCGCCGGTGAGCCTAGACCC KVLQT1 member 1 isoform 3
Y           LQT, RWS,Homo sapiensATFB1, voltage-gated channel, KQT-like subfamily,
                       WRS, LQT1, potassium voltage-gated Kv1.9, KQT-like subfamily, member 1 (KCNQ1), t
                                  potassium KCNA8, KCNA9, channel,
                                                cg08511952
    TTACCCCTTCCTCCCTGG[CG]CAGCTGGGGTCCTCCTCCGGGCCKv7.1, KVLQT1 member 1 isoform 3
Y           FLK1, CD309, VEGFR,kinase insert domain receptor (a type III receptor tyrosine kinase)
                      Homo sapiens kinase insert domain receptor (a type III receptor
                                    VEGFR2 cg10740902
    AGGCTGCCAGACGGACTTTCTGCGG[CG]CGCAAGTGATGCCCGGCGCAGGCAGAtyrosine kinase) (KDR), mR
Y           FLK1, CD309, VEGFR,kinase insert domain receptor (a type III receptor tyrosine
                      Homo sapiens kinase insert domain receptor (a type III receptor tyrosine kinase) (KDR), mR
                                    VEGFR2 cg04695981
    TGCAGCAGTTTGGAGCCACAAGGGAGAAG[CG]GATACTCAGCCAAGTATGCCGGGTC kinase)
N           .         Homo sapiens KIAA0125 (KIAA0125), mRNA.
                                  hypothetical protein LOC9834
                                                cg02507952
    TTTCAAGTATGGCAGACAAAGGATGTTCTG[CG]TGGGGAAATGTGGTGACA
Y           MLK4, dJ862P8.3 sapiens mixed lineage kinase 4 (KIAA1804), mRNA.
                      Homo        mixed lineage kinase 4
                                                cg09524235
    GCACTGGCCCAGGTCTGGCAC[CG]CGCTACAATTTCTTCTGTAGCCCGTTCTGA
Y           PBT, SCFR, C-Kit, CD117 v-kit Hardy-Zuckerman 4 feline sarcoma viral
                      Homo sapiens Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog precursor
                                  v-kit         cg23927351
    GCGTGGTGCCCAGCTTCACAAAG[CG]AGCGGGCAGCACCTCCTTGGTCCG oncogene homolog (KIT), mRN
Y           PBT, SCFR, C-Kit, CD117 v-kit Hardy-Zuckerman 4 feline sarcoma oncogene homolog precursor
                      Homo sapiens Hardy-Zuckerman 4 feline sarcoma viral
                                  v-kit         cg27154163
    GAGCACCTGGCAGGTGGCGGGCC[CG]TGCCCTAACGTGTGCGTGGTG viral oncogene homolog (KIT), mRN
Y           CKLF, IKLF, BTEB2 Kruppel-like factor 5 5 (intestinal) (KLF5),
                      Homo sapiens Kruppel-like factor
                                                cg09984163
    GCGCCTTCGAAAACTGCCTGC[CG]CTGTCTGAGGAGTCCACCCGAAACCmRNA.
Y           CKLF, IKLF, BTEB2 Kruppel-like factor 5 5 (intestinal) (KLF5),
                      Homo sapiens Kruppel-like factor
                                                cg16541703
    AGTTGGGTGAAATAGAGGCGGG[CG]TCAAGTGTCAGTAGTCGCGGGGC mRNA.
N           NES1, PRSSL1 sapiens kallikrein precursor
                      Homo        kallikrein 10 10 (KLK10), transcript variant 1, mRNA.
                                                cg06130787
    AACAGAAACAAGGAAAAAGGGAAACCCA[CG]CCCACTCTGTGGCCGTGAGTGA
N           TLSP, PRSS20, MGC33060
                      Homo sapiens kallikrein isoform 2 precursor
                                  kallikrein 11 11 (KLK11), transcript variant 2, mRNA.
                                                cg09702010
    TGCAGTTGGCTAGTGGAAAGAATGCTA[CG]TTTTATGGACATTGGATTAAATGG
N           TLSP, PRSS20, MGC33060
                      Homo sapiens kallikrein isoform 2 precursor
                                  kallikrein 11 11 (KLK11), transcript variant 2, mRNA.
                                                cg09333109
    GGTCAGTTGTTCCTCATGATCATC[CG]GATCCAGTCCACATACTTGCAAATATAG
Y           KRAS1, KRAS2, RASK2, KI-RAS, cg26129757 sarcoma K-RAS2B, K-RAS4A, K-RAS4B
                      Homo sapiens v-Ki-ras2 Kirsten rat a
                                  c-K-ras2 protein isoform
                                                 C-K-RAS, K-RAS2A, viral oncogene
    TCGCTCCCAGTCCGAAATGG[CG]GGGGCCGGGAGTACTGGCCGAGCCGC homolog (KRAS), transcript vari
Y           KRAS1, KRAS2, RASK2, KI-RAS, cg14647765 sarcoma K-RAS2B, K-RAS4A, K-RAS4B transcript vari
                      Homo sapiens v-Ki-ras2 Kirsten rat a
                                  c-K-ras2 protein isoform
                                                 C-K-RAS, K-RAS2A, viral oncogene homolog (KRAS),
    CACACCGGGGCTGTCTGATCGC[CG]CCCCGATTATTATCAGCCTCAGCAC
N           K1, CK1, EHK1, KRT1A keratin 1 (epidermolytic hyperkeratosis) (KRT1), mRNA.
                      Homo sapienskeratin 1 cg06030058
    TTGAGTGAAAAAGCCCACAGAGCAGTGAGA[CG]AGTAAATAGAAGCTCTAGGACATTTTG
N           K13, CK13,Homo sapiens keratin isoform b
                       MGC3781 keratin 13 13 (KRT13), transcript variant
                                                cg16023337
    GCGGAGGCCTGCCAGGAGCTTCTG[CG]AGGAAAGTGGTGGGTGCA 2, mRNA.
N           K13, CK13,Homo sapiens keratin isoform b
                       MGC3781 keratin 13 13 (KRT13), transcript variant 2, mRNA.
                                                cg24851986
    GAAGTGGCCCTGTCCATTATCATAG[CG]AATATTCTCCGAGCCCTCACCATA
Y           K5, CK5, DDD, EBS2, KRT5A 5 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cock
                      Homo sapiens keratin cg04254916
                                  keratin
    GCGGTGCTGAAGCTACGACTGCCCC[CG]CTCCGGAAGGACACACTTGACTG
N           K5, CK5, DDD, EBS2, KRT5A 5 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cock
                      Homo sapiens keratin cg03540813
                                  keratin
    GAGTATTGACAACCATCCCAGTA[CG]GTACATGCTGAGCACCTGCCCTTCCAG
Y           S10, HSAS, MASA, MIC5,cell cell adhesion CD171, HSAS1, precursor
                      Homo sapiens L1 adhesion molecule isoform 2 N-CAML1
                                  L1 SPG1, CAML1, molecule (L1CAM), transcript variant 2, mRNA.
                                                cg23050981
    AAGAGAGACGAGAGAACGGAAGGA[CG]TTAGTGACTAACATCTGGGTAAGCCCG
Y           S10, HSAS, MASA, MIC5,cell cell adhesion CD171, HSAS1, precursor
                      Homo sapiens L1 adhesion molecule isoform 2 N-CAML1
                                  L1 SPG1, CAML1, molecule (L1CAM),
                                                cg12024667
    CAGCACAGCCAGCCGGGCT[CG]GTTCAGGCTCCGGCCGGAGGGG transcript variant 2, mRNA.
Y           CLM       Homo sapiens laminin,cg24971900
                                  laminin, beta 1 precursor
                                                 beta 1 (LAMB1), mRNA.
    GAACAGAGGGAGGCGCCTCTGCTCATG[CG]CATACGGAGAGCCGGGGCTG
Y           LAMB2, MGC87297 laminin, gamma 1 precursor
                      Homo sapiens laminin,cg21404959
                                                 gamma 1 (formerly LAMB2) (LAMC1), mRNA.
    GCTGCATGCCCGAGTTCGTCAA[CG]CCGCCTTCAACGTGACTGTGGTGGCCACC
Y           LAMB2, MGC87297 laminin, gamma 1 precursor
                      Homo sapiens laminin,cg26340246
                                                 gamma 1 (formerly LAMB2) (LAMC1), mRNA.
    ACACAGTGGAAGAATTTCGCAGTGGGT[CG]TGCGTACCCAAGGGAAAAATTCATT
N           LAT1, pp36Homo sapiens linker activation of Tof T cells (LAT),
                                  linker for for activation cells isoform
                                                cg03108875
    GGGTCCTGGATATGGAGGCCA[CG]GCTGCCAGCTGGCAGGTGGCa transcript variant 1, mRNA.
Y           .         Homo sapiens lymphocyte-specific protein tyrosine kinase (LCK), mRNA.
                                  lymphocyte-specific protein tyrosine
                                                cg05350315
    GTGAATGGGGCCAGAGGGCTCC[CG]GGCTGGGCAGGTAAGGAG kinase
N           NGAL      Homo sapiens lipocalincg14615559 24p3) (LCN2),
                                  lipocalin 2 (oncogene 24p3)
                                                  2 (oncogene
    AATGTCCCTCACTCTCCC[CG]TCCCTCTGTCTTGCCCAATCCTGAC mRNA.
N           NGAL      Homo sapiens lipocalincg24638195 24p3) (LCN2), mRNA.
                                  lipocalin 2 (oncogene 24p3)
                                                  2 (oncogene
    GCAGAAATCTTGCCAAGTGTTTC[CG]CAGGAGTTGCTGGCAATTGCCTCACATTCC
N           EBAF, LEFTA, TGFB4,endometrialcg22462235 factor factor preproprotein
                      Homo sapiens left-right determination
                                    LEFTYA, MGC46222
                                                  bleeding associated 2 (LEFTY2), mRNA.
    CCCATGACATCCTCTGTCTAGACA[CG]GTCAGGACACAAATCTGGCAGCTCTACTGT
N           EBAF, LEFTA, TGFB4,endometrialcg09540507 factor factor preproprotein
                      Homo sapiens left-right determination
                                    LEFTYA, MGC46222
                                                  bleeding associated 2 (LEFTY2), mRNA.
    CTCTCCCCAGTGAGCTGGCTGGC[CG]GTTCATGCCACCAGCACTCAGCTGG
Y           CDF, HILDA, D-FACTOR leukemia inhibitory factor (cholinergic differentiation factor) (LIF), mRNA.
                      Homo sapiensleukemia inhibitory factor (cholinergic differentiation
                                                cg10375298
    CCCAGCGCCTCCGGTGGCTG[CG]CGGGCGCCCCAAGTGTTCGTGTGTCTGCG factor)
N           CDF, HILDA, D-FACTOR leukemia inhibitory factor (cholinergic differentiation factor) (LIF), mRNA.
                      Homo sapiensleukemia inhibitory factor (cholinergic differentiation factor)
                                                cg26721064
    CACCTGGGTTTGGGGAGGTAG[CG]AGTCTGGACTAGCAGATGGAGACT
N           .         Homo sapiens ligase DNA, ATP-dependent isoform alpha precursor
                                  ligase III, III, DNA, ATP-dependent (LIG3), nuclear
                                                cg23104440
    ATCACACAGCACAGAATTCTCT[CG]GGAACCTGTTCTTTGCTTACCTAACAAGGC gene encoding mitochondrial
Y           .         Homo sapiens ligase IV, DNA, ATP-dependent (LIG4), transcript variant 1, mRNA.
                                  DNA ligase cg22492943
                                                 IV
    GAGTACACACGGCTCCTATTGGCCT[CG]GCAGCAGATGCTCTCTGCAAGCAGTTGATC
N           LIMK      Homo sapiens LIM domain kinase 1 (LIMK1), transcript variant 1, mRNA.
                                  LIM domaincg07053434
                                                  kinase 1 isoform 1
    ACCACCCAATTCCTTTGGA[CG]CTTGACTCAGCCCAAACCCGTGCT
Y           TTG1, RBTN1, RHOM1 LIM domain only 1 (rhombotin 1) (LMO1), mRNA.
                      Homo sapiens domaincg14911494
                                  LIM             only 1
    TGTGCCTCAGAATTGGAAGGAACTA[CG]AACTGCAATTTAGAGAGAGAGGGA
Y           TTG1, RBTN1, RHOM1 LIM domain only 1 (rhombotin 1) (LMO1), mRNA.
                      Homo sapiens domaincg18564041
                                  LIM             only 1
    CCTAGCTCGGTGAGCGTCTTTGCTC[CG]ATCCCAGGGTCGTGGTCTTCAATGATT
N           TTG2, RBTN2, RHOM2, RBTNL1 cg22902574
                      Homo sapiens LIM domain only 2 (rhombotin-like 1) (LMO2),
                                  LIM domain only 2
    CGGAGCCTTCACCCTTGCAG[CG]AGCTCTCTCACACCAGATGTGCTCTGCGT mRNA.
N           TTG2, RBTN2, RHOM2, RBTNL1 cg02028355
                      Homo sapiens LIM domain only 2 (rhombotin-like 1) (LMO2), mRNA.
                                  LIM domain only 2
    CTGTCTGCTGGGCAAGGCCCAATTC[CG]AGGTGACAGCTCACCGGGCCTC
N           KPI2, LMR2, cprk,sapiensKIAA1079 kinase 2 2 (LMTK2), mRNA.
                      Homo KPI-2, lemur tyrosine kinase
                                  lemur tyrosinecg09406250
    TCTGTGTGTCCAGTGCTGTGTTAACATCAT[CG]ACAGCTGGCATTTAGGATGGACATTT
Y           MGC105112 omo sapiens lysyl oxidase (LOX), mRNA.
                      H           lysyl oxidase preproprotein
                                                cg08623535
    AGGCGAAGGCAGCCAGGCCATGGGG[CG]ACGCCAAAATATGCACGAAGAAAAATG
Y           MGC105112 omo sapiens lysyl oxidase (LOX), mRNA.
                      H           lysyl oxidase preproprotein
                                                cg03619973
    AGTTACACAAGCCGTTCTGGCC[CG]GCCGCCCCTCAGCTATTTGTTCAC
Y           gp330     Homo sapiens low density lipoprotein-related protein 2 (LRP2), mRNA.
                                  low density cg10022744
                                                lipoprotein-related protein 2
    GCACCGGCAGCGCCTCTGCTAG[CG]AACGCTCCTTTAGGTCTGCACCTCCG
N           GARP, D11S833Esapiens leucine rich repeat containing precursor
                      Homo        leucine richcg24088597
                                                 repeat containing 32 32 (LRRC32),
    GTTTTCTCCAGCACATGCTGAGC[CG]ACTGCCCCCAATAGAACTGTCTTTTTT mRNA.
Y           GARP, D11S833Esapiens leucine rich repeat containing precursor
                      Homo        leucine richcg06412573
                                                 repeat containing 32 32 (LRRC32),
    GCGCCAGACCCCGGGGTCACGGCC[CG]AGGAGGAGCAGGCCGCTCAGCT mRNA.
N           FLJ23119, KIAA1790 leucine-richcg02770711 1 1 (LRRK1), mRNA.
                      Homo sapiens leucine-rich repeat kinase
                                                 repeat kinase
    TTACCTGCGTGCTCAGCTGCGGAAAG[CG]GAAAAGTGCAAGCTGATGAAGAT
N           FLJ23119, KIAA1790 leucine-richcg24824910 1 1 (LRRK1), mRNA.
                      Homo sapiens leucine-rich repeat kinase
                                                 repeat kinase
    GGGGAGGGGACTCAATTCTAAGC[CG]TGGGGATTTGCAGAAGACAGAG
N           LT, TNFB, TNFSF1 lymphotoxin alpha precursorsuperfamily, member 1)
                      Homo sapiens lymphotoxin alpha (TNF
                                                cg24216966
    CATCTCCTTGGGCTGCCCGTGCTT[CG]TGCTTTGGACTACCGCCCAGCAGTGTC (LTA), mRNA.
N           LT, TNFB, TNFSF1 lymphotoxin alpha precursorsuperfamily,
                      Homo sapiens lymphotoxin alpha (TNF
                                                cg20798246
    CCTTTCCCAGAACTCAGT[CG]CCTGAACCCCCAGCCTGTGGTTCTC member 1) (LTA), mRNA.
N           BLT1, BLTR, P2Y7, GPR16, LTBR1, P2RY7, CMKRL1, LTB4R1
                      Homo sapiens leukotriene receptor
                                  leukotriene cg07869853
                                                B4 B4 receptor (LTB4R), mRNA.
    CCTGAACTCTGACTTCAGTTCTTGCTG[CG]GTTTCTGCCCATTTTTTTCATATCCT
N           BLT1, BLTR, P2Y7, GPR16, LTBR1, P2RY7, CMKRL1, LTB4R1
                      Homo sapiens leukotriene receptor
                                  leukotriene cg14137885
                                              B4 B4 receptor (LTB4R), mRNA.
    GGGGAAGAAAGGCCATCAAGGTAGATG[CG]GGTGGGGAACAGCTTGAG
N           G6e, C6orf22
                      Homo sapiens lymphocyte antigen 6 complex, locus G6E
                                  lymphocyte cg26399860
                                              antigen 6 complex G6E
    AATCTGGGAGAGGTGATCTGCACCC[CG]AGATCCCGGGATTTGTAGAGTT (LY6G6E), mRNA.
Y           JTK8      Homo sapiens v-yes-1 cg07158612sarcoma viral related
                                  v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
                                              Yamaguchi
    GGGCAGTGGGTGCAGGGGCCG[CG]GCTGTGCCACCAGCCGGAGTCCC oncogene homolog (LYN), mRNA.
Y           JTK8      Homo sapiens v-yes-1 cg04283851sarcoma viral related oncogene homolog (LYN), mRNA.
                                  v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
                                              Yamaguchi
    GGAAAGGAGACGCGAGAGGTGTAGT[CG]ATGTGCCTGCGAAGCCCAGGCT
Y           MAD2, HSMAD2 sapiens MAD2 mitotic arrest deficient-like 1 (yeast)
                      Homo        MAD2-like 1 cg08483943
    CGCAGGGTGATTCCCTGCTCC[CG]GGAGAGCTGCAGCGCCATGGCCAGGG(MAD2L1), mRNA.
Y           MGC71685Homo sapiens v-maf musculoaponeurotic fibrosarcoma
                                  v-maf musculoaponeurotic fibrosarcoma oncogene homolog isoform a
                                              cg02881640
    AAAATAGCGAAGTCCTGGGGAAAGA[CG]AGGCAGAGAGCAAAGGGGG oncogene homolog (avian) (MAF), tr
Y           MGC71685Homo sapiens v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian)
                                  v-maf musculoaponeurotic fibrosarcoma oncogene
                                              cg24274831
    GTGCCCTTGGACAGAGCGAGCGCCTATG[CG]AGATAACTCCGGGGAAGCTCAA homolog isoform a (MAF), tr
N           MAGE1, MGC9326
                      Homo sapiens melanoma antigen family1A, 1 (directs
                                  melanoma antigen family A,
                                              cg24967982
    GGCCAGGGCTGGCAGCAAGGGCGG[CG]CTGGAATATTTGGGGCTCT expression of antigen MZ2-E) (MAGEA
N           MAGE1, MGC9326
                      Homo sapiens melanoma antigen family1A, 1 (directs expression
                                  melanoma antigen family A,
                                              cg03363189
    AATCTGGACACCCATATTCTCTGC[CG]ATTGTGTCTGCTTCTCTCCCACCAAGTC of antigen MZ2-E) (MAGEA
N           HCA2, MAGEC4, MAGE-C3, MGC119270, MGC119271 (MAGEC3),
                      Homo sapiens melanoma antigen family3 isoform 1
                                  melanoma antigen family C, C, 3
                                              cg02818322
    TCCCTTGGTTGCAGTAGCCTGTGGT[CG]CTCATGTCTGAATCTCCAGGGAA transcript variant 1, mRNA.
N           HCA2, MAGEC4, MAGE-C3, MGC119270, MGC119271 (MAGEC3), transcript variant 1, mRNA.
                      Homo sapiens melanoma antigen family3 isoform 1
                                  melanoma antigen family C, C, 3
                                              cg22177388
    TGCAGCCTGAGTTAGACTTCTGCAACGTCC[CG]TGAGGTGGGATCAGGAATG
N           nM15, NDNL1
                      Homo sapiens MAGE-like 2 (MAGEL2), mRNA.
                                  MAGE-like protein 2
                                              cg03672494
    GGGCTGGGCCTGCAAGACTGCAGG[CG]GTGCCTGCCAGGAAGGCTG
Y           nM15, NDNL1
                      Homo sapiens MAGE-like 2 (MAGEL2), mRNA.
                                  MAGE-like protein 2
                                              cg25417515
    AGATGATGGAAGGGCAGTGCACAGCCTG[CG]GGGCAGACAGTGGGGCAGACA
Y           MLT, MLT1, DKFZp434L132 associated lymphoid tissue lymphoma translocation protein 1 isoform a
                      Homo sapiens mucosacg22260834lymphoid tissue lymphoma
                                  mucosa       associated
    TGCCATACACATCTAACCCTAAAA[CG]AGGAAGCGTCCGCTGAGGTTGCCCAC translocation gene 1 (MALT1)
N           MEK6, MKK6, MAPKK6, PRKMK6, SAPKK3 protein kinase kinase 6 (MAP2K6), transcript variant 1, mR
                      Homo sapiens mitogen-activated
                                  mitogen-activated protein kinase kinase 6 isoform
                                              cg09190049
    AAGGAAAGGGGAAAATGTCTCAGT[CG]AAAGGTAAGAGGCTGTTTGCATTAG 1
Y           MEK6, MKK6, MAPKK6, PRKMK6, SAPKK3 protein kinase kinase 6
                      Homo sapiens mitogen-activated
                                  mitogen-activated protein kinase kinase 6 isoform 1
                                              cg23296889
    ACTCCCAAACAGACCTTCT[CG]ACAAGCCAAAAGCTCTTTAGCTAACCTAA (MAP2K6), transcript variant 1, mR
Y           .         PREDICTED: Homo sapiens mitogen-activated protein kinase
                                  mitogen-activated protein kinase kinase
                                              cg00468724
    CTGCAGGGAAGAAGGACGTGCGG[CG]AGAAGCATCGGATTCGGGG kinase 1 kinase kinase 1 (MAP3K1), m
Y           .         PREDICTED: Homo sapiens mitogen-activated protein kinase kinase
                                  mitogen-activated protein kinase kinase kinase 1
                                              cg06448700
    GTAGAGTCCAGGGACTAGGAGGACTCACAA[CG]CAGCGATGGGCAGCCAGGCCCTG kinase 1 (MAP3K1), m
Y           COT, EST, Homo sapiens mitogen-activated protein kinase kinase kinase
                       ESTF, TPL2, Tpl-2, c-COT, FLJ10486
                                  mitogen-activated protein kinase kinase
                                              cg21555918
    ACCTGGGCACTGGGAAGAATAGGG[CG]TGGACTTGGAGTGTGACCG kinase 8 8 (MAP3K8), mRNA.
Y           MLK1, PRKE1
                      Homo sapiens mitogen-activated protein kinase kinase kinase
                                  mitogen-activated protein kinase kinase
                                              cg09337038
    GGCGCTCGCTAGGCAGCCGAGAAG[CG]CTCTGGAGGGCTCCATGGAkinase 9 9 (MAP3K9), mRNA.
N           JNK3, JNK3A, PRKM10, p493F12,cg26029835MGC50974, isoform
                      Homo sapiens mitogen-activated protein kinase p54bSAPK
                                  mitogen-activated protein kinase 10 10 (MAPK10), transcript variant 2, mRNA.
                                               FLJ12099,
    AGCGGCAAAATCCCTCTGGGCT[CG]CTGGGTCCCCTGCCACGCCATTT 2
Y           ERK3, ERK6, SAPK3, PRKM12, SAPK-3,protein kinase 12 12 (MAPK12), mRNA.
                      Homo sapiens mitogen-activated protein kinase
                                  mitogen-activated P38GAMMA
                                              cg06544203
    CGGTAAAAGCCACTGCGGGCGGG[CG]GCGGAGAGCTCATGGCAGGCC
Y           ERK3, ERK6, SAPK3, PRKM12, SAPK-3,protein kinase 12 12 (MAPK12),
                      Homo sapiens mitogen-activated protein kinase
                                  mitogen-activated P38GAMMA
                                              cg26416296
    GCCCATCCTTGACAGCCTGAG[CG]CTGACTTCTATGGCAGCCGCAAGTCGGGC mRNA.
Y           RK, p38, EXIP, Mxi2, CSBP1, CSBP2, CSPB1, PRKM14, PRKM15,3SAPK2A, p38ALPHA 3, mRNA.
                      Homo sapiens mitogen-activated protein kinase isoform
                                  mitogen-activated protein kinase 14 14 (MAPK14), transcript variant
                                              cg18213931
    AAGATCTTTTGACTCTTTCCC[CG]ACACGCTATTTGTCAGTGTCGTTTTCCAC
N           ERK3, Erk4, PRKM4, p63MAPK cg21612229 kinase 4 4
                      Homo sapiens mitogen-activated protein kinase
                                  mitogen-activated protein
    CCCTCCCAATGCAGGTTAAGA[CG]ACAGCCTGCGCCCCCAACTAGC(MAPK4), mRNA.
N           JNK2, JNK2A, JNK2B, mitogen-activated JNK2BETA, p54aSAPK, JNK2ALPHA variant 4, mRNA.
                      Homo sapiens mitogen-activated protein kinase 9 (MAPK9), transcript
                                   PRKM9, JNK-55, protein kinase 9 isoform
                                              cg05023457
    CCAAGTGACCACTGCCCCA[CG]GTCTTCTCCCCGTCCTCTGGGTGGT 4
N           MAS       Homo sapiens MAS1 oncogene (MAS1), mRNA.
                                  MAS1 oncogene
                                              cg04134973
    CAGTGGCAGCATTGCCCAGACATG[CG]TTTTGTCATCAAGTCTTAATGCAGTCCAC
N           MAS       Homo sapiens MAS1 oncogene (MAS1), mRNA.
                                  MAS1 oncogene
                                              cg13390345
    CCACACATCAATGGCTTGCCTGGCTTA[CG]TAGTCTGAGCAGGTGCCCAGCTTTGTCGC
Y           CHK, CTK, HomoLsk, HYLTK, HHYLTK, MGC1708, MGC2101, DKFZp434N1212
                       HYL, sapiens megakaryocyte-associated tyrosine
                                  megakaryocyte-associated tyrosine kinase isoform a
                                              cg21380287
    CTCCCGGGGCATAAGGAAGGAAG[CG]GGGCTGCAGGTACCGCCTG kinase (MATK), transcript variant 1, mRN
Y           CHK, CTK, HomoLsk, HYLTK, HHYLTK, MGC1708, MGC2101, DKFZp434N1212
                       HYL, sapiens megakaryocyte-associated tyrosine kinase (MATK),
                                  megakaryocyte-associated tyrosine kinase isoform
                                              cg02798144
    GGCCGACTTAACTCTTTGTCAGC[CG]GGCTGGTTTTCACCCACCTGGTGGCAG a transcript variant 1, mRN
N           DMTase, NY-CO-41, DKFZp586O0821binding domain protein 2 (MBD2),
                      Homo sapiens methyl-CpG
                                  methyl-CpG binding domain protein 2 isoform
                                              cg15090185
    GGGGTGATAGCCCCTTTTCC[CG]CCCCTCTGCACAAAGCTTGCAGGGGA 1 transcript variant 1, mRNA.
N           ACTHR, MGC125798 melanocortin 2 receptor
                      Homo sapiens melanocortin 2 receptor (adrenocorticotropic hormone) (MC2R), mRNA.
                                              cg21266195
    GCCGCATGCCCACGTCTTTGTGG[CG]CTAAAACCCCCGCACTCTTACAC
N           ACTHR, MGC125798 melanocortin 2 receptor
                      Homo sapiens melanocortin 2 receptor (adrenocorticotropic hormone) (MC2R), mRNA.
                                              cg00358505
    AACATGCCCTGCAGCTGAAACC[CG]GCGTTCCACAGGCCTCTTTCC
Y           CD146, MUC18 sapiens melanoma cell adhesion molecule (MCAM),
                      Homo        melanoma cell adhesion molecule
                                              cg13567839
    GGGAGCTGCGCCTAGGAGCGCTGC[CG]GAGGTAGGCCAGAGCCGGACTC mRNA.
Y           CD146, MUC18 sapiens melanoma cell adhesion molecule
                      Homo        melanoma cell adhesion molecule
                                              cg19017850
    GTCTGACTGGCCGAGGTGGCAG[CG]AGGAGAAGCTGTCCCGGATG(MCAM), mRNA.
Y           FLJ46755 Homo sapiens mutatedcg10599443 cancers (MCC), mRNA.
                                  mutated in colorectal cancers
                                               in colorectal
    AAAAGAGCAGCCGTGGCTCGCGTTTCA[CG]GACGAGCCATTGCTGCAGGAGG
Y           FLJ46755 Homo sapiens mutatedcg19728002 cancers (MCC), mRNA.
                                  mutated in colorectal cancers
                                               in colorectal
    AGCACGAGCCGACACCCTAGAGGGCACCGG[CG]AGCTCCCGAAAAAACTAGGGCG
N           DBL       Homo sapiens MCF.2 cell line derived transforming sequence (MCF2), mRNA.
                                  MCF.2 cell line derived transforming sequence
                                              cg20900840
    TCTGAACCTCATCTTGCCTCTC[CG]GGGATTTGCTTCTGCCATTTCGCCTGTACG
N           DBL       Homo sapiens MCF.2 cell line derived transforming sequence (MCF2),
                                  MCF.2 cell line derived transforming sequence
                                              cg13637055
    TGGGAATACAGAAAGAGGAGTATCACTCCC[CG]GTAGACAAGTAATTACCCTCTGTTGAC mRNA.
N           DBL       Homo sapiens MCF.2 cell line derived transforming sequence (MCF2), mRNA.
                                  MCF.2 cell line derived transforming sequence
                                              cg17051630
    AGAATAGAACATGCAAACTTTCTAAGA[CG]GATACAATTCTCTCCCAAATTAACCTT
Y           BM28, CCNL1, CDCL1, cdc19, D3S3194, MITOTIN, KIAA0030, MGC10606 mitotin (S. cerevisiae) (MC
                      Homo sapiens MCM2 minichromosome maintenance deficient 2,
                                  minichromosome maintenance protein 2
                                              cg19254115
    CACGCAGCCAGCAAGTGTCGT[CG]GGTCCCCTGGAGCCTCAGCTTCTAC
Y           BM28, CCNL1, CDCL1, cdc19, D3S3194, MITOTIN, KIAA0030, MGC10606 mitotin (S. cerevisiae) (MC
                      Homo sapiens MCM2 minichromosome maintenance deficient 2,
                                  minichromosome maintenance protein 2
                                              cg10691006
    GGCCCTGGTGTGACCGAGGTCA[CG]CAGCCAGCAAGTGTCGTCGGGTCCC
Y           Mis5, P105MCM, MCG40308
                      Homo sapiens MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe)
                                  minichromosome maintenance protein 6
                                              cg15058178
    TCTGGCACTTCTCGGCCACCT[CG]TCGCGGACCTCCAGGTGCTGGCTGCCG
Y           CLCS, MDR1, P-gp, PGY1, ABC20,cassette GP170
                      Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 1 (ABCB1), mRNA.
                                  ATP-binding CD243, sub-family B member
                                              cg25735094
    CGGATTGACTGAATGCTGATTCCT[CG]AGAAACTGCGAAACAGGTTGAAT 1
Y           PRDM3, MDS1-EVI1 myelodysplasia syndrome protein 1
                      Homo sapiens myelodysplasia syndrome 1 (MDS1), mRNA.
                                              cg03078689
    CCTTTCTCTCAATCCACACT[CG]CTATCTCTCCAGCATTGTCAGTTTGGACA
Y           RTS, RTT, Homo sapiens methyl CpG binding DKFZp686A24160
                      PPMX, MRX16, MRX79, AUTSX3, protein 2 (Rett syndrome) (MECP2), mRNA.
                                  methyl CpGcg23611509
                                               binding protein 2
    GCCCCCCGGCAAGGGTCCCCGCCCG[CG]GCCACGGCGGTCCCACTCACAGTCT
Y           RTS, RTT, Homo sapiens methyl CpG binding DKFZp686A24160
                      PPMX, MRX16, MRX79, AUTSX3, protein 2 (Rett syndrome) (MECP2), mRNA.
                                  methyl CpGcg04941592
                                               binding protein 2
    TGAATGTTAAGGATTAATGGACCCTTG[CG]GATGCTGGGGCAAGTGAA
Y           .         PREDICTED: Homo sapiens maternally expressed 3, transcript variant 10 (MEG3), misc RN
                                  .           cg27191825
    GGGCGCCCACGAGAGGATCCCTCACC[CG]GTGAGTGGTTGGCCATCCT
Y           .         PREDICTED: Homo sapiens maternally expressed 3, transcript
                                  .           cg24336658
    CGGGCTCACGCAGGGAAAAAGCACCCG[CG]ACCACAGGGTGTTGGTCATGGC variant 10 (MEG3), misc RN
Y           PEG1, MGC8703,sapiens mesoderm specific transcript homolog (mouse) (MEST), transcript variant 1,
                      Homo MGC111102, DKFZp686L18234 isoform a
                                  mesoderm specific transcript
                                              cg05241978
    TCAGGAAGCGCATGCGCAACCGGTTCTC[CG]AAACATGGAGTCCTGTAGGCAAGG
Y           PEG1, MGC8703,sapiens mesoderm specific transcript homolog
                      Homo MGC111102, DKFZp686L18234 isoform a
                                  mesoderm specific transcript
                                              cg20632786
    GCTGACGCCTGGCAGGGAGAAGG[CG]GCAGCACATGCTGGGCTCGGG(mouse) (MEST), transcript variant 1,
Y           PEG1, MGC8703,sapiens mesoderm specific transcript homolog (mouse) (MEST), transcript variant 1,
                      Homo MGC111102, DKFZp686L18234 isoform a
                                  mesoderm specific transcript
                                              cg07409197
    GCCGGAGGCTATTGTCGAAGCCA[CG]GCCTGCCATTTCATACCCTTTGCAA
Y           HGFR, RCCP2 sapiens met proto-oncogene (hepatocyte growth
                       Homo      met proto-oncogene precursor
                                              cg24548568
    GGAAACTGAAGAGACGTGGCCACGG[CG]AGGACGAAACTAGAATGGGG factor receptor) (MET), mRNA.
N           .          Homo sapiens microfibrillar-associated protein 4 (MFAP4), mRNA.
                                 microfibrillar-associated protein 4
                                              cg07727884
    TGCTCAGAGTGGCTGGGTGTCTG[CG]GCCCCAGACTGCAACCGCCCAGAGTT
N           .          Homo sapiens microfibrillar-associated protein 4 (MFAP4), mRNA.
                                 microfibrillar-associated protein 4
                                              cg10351914
    GACCACCTGTGTCTCATTAGTCCTGT[CG]GGCAAAGTACTGCAGACGTTAACTCCCTGC
Y           .          Homo sapiens O-6-methylguanine-DNA methyltransferase
                                 O-6-methylguanine-DNA methyltransferase
                                              cg01900912
    GAAGGGCCATCCGGGTCAGG[CG]CACAGGGCAGCGGCGCTGCCGGAGG (MGMT), mRNA.
Y           .          Homo sapiens O-6-methylguanine-DNA methyltransferase
                                 O-6-methylguanine-DNA methyltransferase
                                              cg17480470
    GGCTTGTACCGGCCGAAGGGCCATC[CG]GGTCAGGCGCACAGGGCAGCGG(MGMT), mRNA.
Y           D15S9, RNF63, ZFP127, ZNF127,cg15423863protein, 3 (MKRN3), mRNA.
                       Homo sapiens makorin,MGC88288
                                 makorin, ringring finger
                                                 finger protein, 3
    GTGAGAAGGGACTTAGGGACTGC[CG]GAACACAGCGAAGCAGAGGCAGAAGG
N           D15S9, RNF63, ZFP127, ZNF127,cg19407225protein, 3 (MKRN3), mRNA.
                       Homo sapiens makorin,MGC88288
                                 makorin, ringring finger
                                                 finger protein, 3
    AAGACCAAAAGAAACGGCGCCTTGTCAAC[CG]AACGAATTGAAAAAAGCTTCCTG
Y           .          .         .            cg04842271
    GGGTCCTTTGGCCCTATATGATCC[CG]GAAGTTCCGGGGCTTTTGGACCTCTGTGAT
Y           .          .         .            cg07053858
    CAGCTGCTGCATCTCCCTCTCTTT[CG]CTTCTAGTCGCTCAGTAAGCCTCTCAATT
Y           .          Homo sapiens myeloid cg11432768 1 1 (MLF1), mRNA.
                                 myeloid leukemia factor
                                               leukemia factor
    AGGGAAAAGAGCGAGTTTTAGAGGG[CG]AGAGAGAATTCGGAGTAACTCTG
Y           .          Homo sapiens myeloid cg21767902 1 1 (MLF1), mRNA.
                                 myeloid leukemia factor
                                               leukemia factor
    TGCCAGGGCAGCGGCGCATTGCTCCC[CG]CCTCGTCCTGGTGACGTCACAGAG
Y           FCC2, COCA2, HNPCC, hMLH1, HNPCC2, colon cancer, nonpolyposis
                       Homo sapiens mutL homolog 1, MGC5172
                                 MutL protein homolog 1
                                              cg04807499
    GCGGGAGGCCACAAGAGCAGGGCCAA[CG]TTAGAAAGGCCGCAAGGGGAG type 2 (E. coli) (MLH1), mRNA.
Y           HNPCC, HNPCC7, S240II117 homolog 3 (E. coli) (MLH3),
                       Homo sapiens mutL cg16617972
                                 mutL homolog 3
    CCCGGCATCATCTTTTCGT[CG]CGTGCTTCCCCCAGAGTCACCTG mRNA.
Y           HNPCC, HNPCC7, S240II117 homolog 3 (E. coli) (MLH3), mRNA.
                       Homo sapiens mutL cg11770975
                                 mutL homolog 3
    GCGCGCACCTTGGATCTTGAGGCT[CG]TGCGTGCCCACGAGCATGCGCTTC
Y           AF9, YEATS3, FLJ2035 myeloid/lymphoidmixed-lineage leukemia (trithorax homolog, Drosophila); tran
                       Homo sapiens
                                 myeloid/lymphoid or or mixed-lineage leukemia
                                              cg18264687
    TGAAGAGGCTGCTATGAATGAGAGCG[CG]CCCAGGAGCGGAGGGTAGATG (trithorax homolog, Drosophila);
Y           AF6, AF-6, Homo sapiens myeloid/lymphoidmixed-lineage leukemia
                       AFADIN, FLJ34371, RP3-431P23.3mixed-lineage leukemia (trithorax homolog, Drosophila);
                                 myeloid/lymphoid or or
                                              cg05462092
    GCGGAAGAAAACAGCTTGAAAAGGT[CG]GCTTTGAAGTGACCCAGCGGA (trithorax homolog, Drosophila); tran
Y           AF17, FLJ23480 sapiens myeloid/lymphoidmixed-lineage leukemia (trithorax homolog, Drosophila); tran
                       Homo      myeloid/lymphoid or or mixed-lineage leukemia
                                              cg12475291
    TGTCTGTGAACCCGACAGGAAGCTCCC[CG]AGGGCAGGAATATGTTTTGCTC (trithorax homolog, Drosophila);
Y           NEP, CD10, CALLA, MGC126681,cg20228377
                       Homo sapiens membrane metallo-endopeptidase (neutral endopeptidase, enkephalinase, C
                                 membrane metallo-endopeptidase
                                                MGC126707
    AGATGTGCAAGTGGCGAAGCTTGAC[CG]AGAGCAGGCTGGAGCAGCCGCCCAA
Y           NEP, CD10, CALLA, MGC126681,cg10427866
                       Homo sapiens membrane metallo-endopeptidase
                                 membrane metallo-endopeptidase
                                                MGC126707
    GGATTCAGGGAGGAAAGGGAG[CG]GGAAAGAGAGCGAAAGAAGAG(neutral endopeptidase, enkephalinase, C
N           CLG, CLGN  Homo sapiens matrix metallopeptidasepreproprotein collagenase) (MMP1), mRNA.
                                 matrix metalloproteinase 1 1 (interstitial
                                              cg16575408
    AGGGCAGAGGGTGGAATTACTAACACTG[CG]CACCTGATGGCTGTTCGGCACC
N           CLG, CLGN  Homo sapiens matrix metallopeptidasepreproprotein collagenase) (MMP1), mRNA.
                                 matrix metalloproteinase 1 1 (interstitial
                                              cg18733315
    CCCCCAGCACTCACTTTA[CG]GTGGCTCTTCGGGGTTCTCTGAGGTTCCC
N           SL-2, STMY2Homo sapiens matrix metallopeptidase 10 (stromelysin 2) (MMP10),
                                 matrix metalloproteinase 10 preproprotein
                                              cg02061229
    GAGCTGGCCAGTAGCTGCAATAGATGCCAC[CG]TTAATTACCTGGGCAAGATCCTTGT mRNA.
Y           MMP-X1, MTMMP1, MT1-MMP metallopeptidase 14 (membrane-inserted) (MMP14), mRNA.
                       Homo sapiens matrix cg09208010 14 preproprotein
                                 matrix metalloproteinase
    AGGGAGGGACCAGAGGAGAGAG[CG]AGAGAGGGAACCAGACCCCAGTTCG
N           MMP-X1, MTMMP1, MT1-MMP metallopeptidase 14 (membrane-inserted) (MMP14), mRNA.
                       Homo sapiens matrix cg01508380 14 preproprotein
                                 matrix metalloproteinase
    CTACAGCCCCCTGCTGTCCAT[CG]CGGCCTCAACCCCTGCAGATGGCA
N           .          PREDICTED: Homo sapiens matrix metallopeptidase
                                 similar to Matrix metalloproteinase-19 precursor (MMP-19) (Matrix
                                              cg01843273
    CTGAAGGTCAGGAGGGAGGCTT[CG]ATGGGGCTGTGGAGCAGTAAC 19 (MMP19), mRNA. metalloprotein
N           .          PREDICTED: Homo sapiens matrix metallopeptidase
                                 similar to Matrix metalloproteinase-19 precursor (MMP-19) (Matrix
                                              cg18787783
    CCTGGGCCAGCAAATCACTC[CG]CCCCTACCTTTGAGTCTCCCTAGAA 19 (MMP19), mRNA. metalloprotein
Y           CLG4, MONA, CLG4A,matrix metalloproteinase 2 preproprotein
                       Homo sapiens matrix metallopeptidase 2 (gelatinase
                                   TBE-1, MMP-II
                                              cg16119420
    CGGCTGCCCTCCCTTGTTTC[CG]CTGCATCCAGACTTCCTCAGGCGGTA, 72kDa gelatinase, 72kDa type IV co
Y           CLG4, MONA, CLG4A,matrix metalloproteinase 2 preproprotein A, 72kDa gelatinase, 72kDa type IV co
                       Homo sapiens matrix metallopeptidase 2 (gelatinase
                                   TBE-1, MMP-II
                                              cg20597545
    GCGAGAGAGGCAAGTGGGGTGA[CG]AGGTCGTGCACTGAGGGTG
Y           CLG4, MONA, CLG4A,matrix metalloproteinase 2 preproprotein A, 72kDa gelatinase, 72kDa type IV co
                       Homo sapiens matrix metallopeptidase 2 (gelatinase
                                   TBE-1, MMP-II
                                              cg20640526
    CCGGCGTCCCTCCTAGTAGTAC[CG]CTGCTCTCTAACCTCAGGACGTCAAGG
N           SL-1, STMY, STR1, STMY1, MGC126102, MGC126103, MGC126104
                       Homo sapiens matrix metallopeptidasepreproprotein 1, progelatinase) (MMP3), mRNA.
                                 matrix metalloproteinase 3 3 (stromelysin
                                              cg16466334
    CTCCTTGTAGGTCCAACCTCGGGAG[CG]CAGCTTTTAAAGAGTGACAGTGTTTGT
N           SL-1, STMY, STR1, STMY1, MGC126102, MGC126103, MGC126104
                       Homo sapiens matrix metallopeptidasepreproprotein 1, progelatinase) (MMP3), mRNA.
                                 matrix metalloproteinase 3 3 (stromelysin
                                              cg01026111
    AGAGTGACAGTGTTTGTTTGGATCACC[CG]CAGCTTGACTCATCCTTGCTTTCATCC
N           MMP-7, MPSL1, PUMP-1 matrix metallopeptidasepreproprotein uterine)
                       Homo sapiens
                                 matrix metalloproteinase 7 7 (matrilysin,
                                              cg10521988
    CAGGCACACAGCACACAGCA[CG]GTGAGTCGCATAGCTGCCGTCCAGAGAC (MMP7), mRNA.
N           MMP-7, MPSL1, PUMP-1 matrix metallopeptidasepreproprotein uterine) (MMP7), mRNA.
                       Homo sapiens
                                 matrix metalloproteinase 7 7 (matrilysin,
                                              cg20645973
    TGTGTCCCCTCACCTTCCA[CG]TCCCTTAGCAGAGCAGTGATAATTCCC
N           HNC, CLG1, PMNL-CLmatrix metalloproteinase 8 preproprotein collagenase) (MMP8), mRNA.
                       Homo sapiens matrix metallopeptidase 8 (neutrophil
                                              cg04241713
    CTGCACATGGAGTAAGAGCAGAAATGGAAG[CG]TCTTCAGGGAGAACATGATCTTCT
N           GELB, CLG4BHomo sapiens matrix metallopeptidasepreproprotein B,
                                 matrix metalloproteinase 9 9 (gelatinase
                                              cg05437645
    CTGCTTTGCTGCCCCCAGACAG[CG]CCAGTCCACCCTTGTGCTCTTCCC 92kDa gelatinase, 92kDa type IV co
N           GELB, CLG4BHomo sapiens matrix metallopeptidasepreproprotein
                                 matrix metalloproteinase 9 9 (gelatinase
                                              cg02310296
    TTGCCTGACTTGGCAGTGGAGACTG[CG]GGCAGTGGAGAGAGGAGG B, 92kDa gelatinase, 92kDa type IV co
N           GELB, CLG4BHomo sapiens matrix metallopeptidasepreproprotein B, 92kDa gelatinase, 92kDa type IV co
                                 matrix metalloproteinase 9 9 (gelatinase
                                              cg12243192
    CCCTCCCCTGAGGGCCTG[CG]GTTTCCTGCGGGTCTGGGGTCTTGCCTGAC
Y           MSV, MGC119962, MGC119963 Moloney murine sarcoma viral
                       Homo sapiens v-mos cg09241196sarcoma viral oncogene homolog
                                 v-mos Moloney murine
    GAGGGACTGCTGCAGGGCCGCG[CG]TCCACCGATGGGGAAAACTCG oncogene homolog (MOS), mRNA.
Y           MSV, MGC119962, MGC119963 Moloney murine sarcoma viral oncogene homolog (MOS), mRNA.
                       Homo sapiens v-mos cg05661838sarcoma viral oncogene
                                 v-mos Moloney murine
    GCACTTTGCAGGGGGACACCAGGGC[CG]CTGGAGTGAATGAAGAGACTAG homolog
N           MSV, MGC119962, MGC119963 Moloney murine sarcoma oncogene homolog
                       Homo sapiens v-mos cg27002178sarcoma viral
                                 v-mos Moloney murine
    AATCCTTCCCTTCCAAGG[CG]ATTTGGCCCAACCGGTCAGCTCA viral oncogene homolog (MOS), mRNA.
N           MPLV, TPOR, C-MPL, myeloproliferative leukemia virus oncogene
                       Homo sapiens myeloproliferative leukemia virus oncogene (MPL), mRNA.
                                 CD110        cg22126520
    AGGGGCAGGGACAGGGACAGGA[CG]TGGGGCTGTATCTGACAGGA
N           MPLV, TPOR, C-MPL, myeloproliferative leukemia virus oncogene
                       Homo sapiens myeloproliferative leukemia virus oncogene (MPL),
                                 CD110        cg06545304
    ATTTTGAGTAGCAAGGGATTAGAGGCAGC[CG]TGGAGGCCACCCATAATGGAGAG mRNA.
N           .          Homo sapiens myeloperoxidase (MPO), nuclear gene encoding mitochondrial protein, mRNA
                                 myeloperoxidase
                                              cg09421562
    GGAGCAGCACCTTCAGAGGGCTGGGG[CG]TGGCCAGAATGGCCAGGAGCCC
N           .          Homo sapiens myeloperoxidase (MPO), nuclear gene
                                 myeloperoxidase
                                              cg24997501
    GGACAGGAAATCTGGCTGGAGAC[CG]TTGGGCTTCACAGGAAGGAG encoding mitochondrial protein, mRNA
Y           FCC1, COCA1, HNPCC, HNPCC1cg20331910
                       Homo sapiens mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) (MSH2), mRNA.
                                 mutS homolog 2
    ACTGGGATTATGGCGTGTGACACCA[CG]CCTGGCGTCAAACGTTTGTCTT
Y           .          Homo sapiens mutS homolog 3 (E. coli) (MSH3), mRNA.
                                 mutS homolog 3
                                              cg14636131
    TTCTGGGACACAGCGACGATGCAGTTTAG[CG]AACCAACCATGACAGCAGCGGGAGG
Y           .          Homo sapiens mutS homolog 3 (E. coli) (MSH3), mRNA.
                                 mutS homolog 3
                                              cg06210628
    CGATGCCCATGTTCTGGGACACAG[CG]ACGATGCAGTTTAGCGAACCAACCAT
N           MSSK1, STK23, MGC102944 proteinkinase 23 (SRPK3), mRNA.
                       Homo sapiens SFRS cg10117702 3
                                 serine/threonine kinase
    TCCTGCCAGGGCCACAGCCTACAAGGGTCT[CG]GTATTGCAGGCGCAAGCGCTTTGT
Y           RON, PTK8, CDw136 macrophage stimulating 1 receptor
                       Homo sapiens macrophage stimulating 1 receptor (c-met-related tyrosine kinase) (MST1R),
                                              cg03714052
    AGCAGCAACAGGAAGGACTGAGGCAGCGG[CG]GGAGGAGCTCCATCGAGGC
Y           RON, PTK8, CDw136 macrophage stimulating 1 receptor
                       Homo sapiens macrophage stimulating 1 receptor (c-met-related tyrosine kinase) (MST1R),
                                              cg03610760
    CCTGGCTCCTGTACCTTCACCTGG[CG]TCTTGGCGCCTTTTTCTCAGCGGCC
Y           RON, PTK8, CDw136 macrophage stimulating 1 receptor
                       Homo sapiens macrophage stimulating 1 receptor (c-met-related tyrosine kinase) (MST1R),
                                              cg01709977
    GGACTGGGCCAAATTTAAGCAGCGGTCC[CG]ACAGCCCCAAGATAGCGGACCCCCGCC
Y           MT1, MTC, Homo sapiens metallothionein 1A (functional) (MT1A), mRNA.
                        MT1S, MGC32848
                                 metallothionein 1A
                                              cg26001009
    GCCCTACCAAGCCTTCCA[CG]TGCGCCTTATAGCCTCTCAACTTCTTGCTT
Y           MT1, MTC, Homo sapiens metallothionein 1A (functional) (MT1A), mRNA.
                         MT1S, MGC32848
                                  metallothionein 1A
                                               cg22243129
    GCAGGGCGGGTCCTTTGCGTC[CG]GCCCTCTTTCCCCTGACCATAA
Y           MT1, MTC, Homo sapiens metallothionein 1A (functional) (MT1A), mRNA.
                         MT1S, MGC32848
                                  metallothionein 1A
                                               cg10731123
    AGAGTGAGAGGCCGACCCGTGTTCC[CG]TGTTACTGTGTACGGAGTAGTGG
Y           .           Homo sapiens metastasis associated 1 (MTA1), mRNA.
                                  metastasis cg21902921
                                               associated protein
    GCATCAGGAGGAACCCCTGGAGAGCTA[CG]GCAGGACTCACCTGTGGGGCAC
N           EMA, PEM,Homo sapiens PEMT, 1, transmembrane (MUC1), transcript variant 1, mRNA.
                          PUM, MAM6, mucin CD227, H23AG, mucin
                                  MUC1 mucin isoform 1 precursor
                                               cg00265953
    GGAGGGGGCAGAACAGATTCAGGCAGG[CG]CTGGCTGCTTGAGAGGTG
Y           EMA, PEM,Homo sapiens PEMT, 1, transmembrane (MUC1), transcript variant 1, mRNA.
                          PUM, MAM6, mucin CD227, H23AG, mucin
                                  MUC1 mucin isoform 1 precursor
                                               cg11011735
    CTCAACCCCCTGACTACC[CG]TTTGTTCTCCAGCTGGCCTCCCC
N           MGC126323, MGC126324muscle,cg22051739 tyrosine kinase
                        Homo sapiens
                                  skeletal muscle receptor
                                                skeletal, receptor tyrosine kinase
    GGAGAGGTGGGGTGCTGAATT[CG]AAGGTCAGGACACCTATACCTCTGGG(MUSK), mRNA.
Y           MXI, MAD2, MXD2, MGC43220 interactor 1 (MXI1), transcript variant 1, mRNA.
                        Homo sapiens MAX cg07262395 a
                                  MAX interactor 1 isoform
    TGCCTTTGAGTAGGGTGGCTGCAT[CG]CACACCTCCAGGGGGCAGCATTGTCT
Y           MXI, MAD2, MXD2, MGC43220 interactor 1 (MXI1), transcript variant
                        Homo sapiens MAX cg21891273 a
                                  MAX interactor 1 isoform
    CCACCTTTTATTTTGACCGGTC[CG]ATGGCGACAGGCTCGCACTAGGACCC 1, mRNA.
Y           efg, c-myb, Homo sapiens v-myb myeloblastosis viral oncogene homolog (avian)
                         c-myb_CDSv-myb myeloblastosis viral oncogene homolog
                                               cg18253802
    TCCGCTGGGGCGCTCCATTAGTGAG[CG]GTGATGGTTGCCGCCCACTTGTATTGAAGC(MYB), mRNA.
Y           BMYB, MGC15600
                        Homo sapiens v-myb myeloblastosis viral oncogene homolog (avian)-like 2 (MYBL2), mRNA
                                  MYB-related protein B
                                               cg20643167
    CGCTATGTGGGATACTCCTGGGC[CG]CCCCGGACTGACACGTGAGCCAG
Y           BMYB, MGC15600
                        Homo sapiens v-myb myeloblastosis viral oncogene homolog (avian)-like 2 (MYBL2), mRNA
                                  MYB-related protein B
                                               cg13938063
    GAGAGGCACAGGTAGGGTGAGGAGC[CG]CTTTAGGGTGCGGCTCTAGG
Y           LMYC, MYCL  Homo sapiens v-myc myelocytomatosis viral1oncogene homolog 1, lung carcinoma derived (
                                  l-myc-1 proto-oncogene isoform
                                               cg27650434
    GGCCCAAGCCTGGATGGCATCGAAG[CG]AAGATTCCGGGATTTAGAGCCC
Y           .           .         .            cg16102556
    CCATCACTATTTCTACGACTATGACGG[CG]GGGAGGATTTCTACCGCTCCACGAC
Y           .           .         .            cg03072658
    GGAACTAGTCTGCTCCAGGTGGCAAGCTG[CG]TGAGCAAGCAAGCCAACATGGACCGCG
Y           NMYC, ODED, MODED, N-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avia
                        Homo sapiens v-myc cg02204046 viral related oncogene,
                                  v-myc myelocytomatosis
    GCCGAGCAAGCGCTAGCCAGG[CG]CAAGCGCGCACAGACTGTAGCCATCC neuroblastoma derived
Y           NMYC, ODED, MODED, N-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avia
                        Homo sapiens v-myc cg21023053 viral related oncogene,
                                  v-myc myelocytomatosis
    GGCCTTGCTCAACGTTGGCCTCG[CG]CTCAGCTGCACAACACGCAGTCAAA neuroblastoma derived
Y           AAT4, FAA4, SMHC, SMMHC, muscle myosin heavy chainDKFZp686D10126
                        Homo sapiens myosin,cg15581089
                                  smooth MGC32963, MGC126726,smooth muscle (MYH11), transcript variant SM
                                                heavy polypeptide 11, 11 isoform
    GGAGCGTCCAAATCTCCCTG[CG]CGTCCTCGGACGCCTCTCTTTATAGAC SM2
Y           AAT4, FAA4, SMHC, SMMHC, muscle myosin heavy chainDKFZp686D10126
                        Homo sapiens myosin,cg21571155
                                  smooth MGC32963, MGC126726,smooth muscle (MYH11), transcript variant SM
                                                heavy polypeptide 11, 11 isoform SM2
    GCACCGCACAAGGGCGCACGGAACAGGTG[CG]CACAGGGACGGGAGTCTCAGCCC
Y           KRP, MLCK, MLCK108, MLCK210,light polypeptide kinase (MYLK),
                        Homo sapiens myosin,cg07455270 DKFZp686I10125
                                  myosin light chain kinase isoform 1
                                                 FLJ12216,
    CCTCGGAGCCTTGACTTCCAGGGCC[CG]CGCCTGGACAAAAGCATGGGG transcript variant 1, mRNA.
Y           KRP, MLCK, MLCK108, MLCK210,light polypeptide kinase (MYLK), transcript variant 1, mRNA.
                        Homo sapiens myosin,cg03731616 DKFZp686I10125
                                  myosin light chain kinase isoform 1
                                                 FLJ12216,
    TAGGTCGGGGTCTGATGCTAGCTT[CG]TGAGCGTGCATGAGACACTGGCT
Y           PUM, MYF3, MYOD myogenic differentiation 1 1 (MYOD1), mRNA.
                        Homo sapiens myogenic differentiation
                                               cg20325846
    TGGGCGAAGCCAGGACCGTGCCG[CG]CCACCGCCAGGATATGGAGCTACTGTC
Y           PUM, MYF3, MYOD myogenic differentiation 1 1 (MYOD1), mRNA.
                        Homo sapiens myogenic differentiation
                                               cg27060180
    CTACGGATAAATAGCCCAGGGCGCCTGG[CG]AGAAGCTAGGGGTGAGGAA
N           AAC2        Homo sapiens N-acetyltransferase 2 (arylamine N-acetyltransferase) (NAT2), mRNA.
                                  arylamide acetylase 2
                                               cg07102632
    AACTAGACTCTGGTGTCAGGGTGATA[CG]GAATTCCAGTGAGATCACTTCCCT
N           NB, DAN, NO3, DAND1, MGC8972, D1S1733E
                        Homo sapiens neuroblastoma, suppression of tumorigenicity 1 (NBL1), transcript variant 2, m
                                  neuroblastoma, suppression of tumorigenicity 1 precursor
                                               cg21813747
    AAATCCCCAAGTCCTACAAT[CG]TGTCCCAGTGGTGTCCCTGGGCCAC
N           NB, DAN, NO3, DAND1, MGC8972, D1S1733E
                        Homo sapiens neuroblastoma, suppression of tumorigenicity 1
                                  neuroblastoma, suppression of tumorigenicity 1 precursor
                                               cg04102045
    GAATTCCGGGCAGAGGGAAGGG[CG]CAGGCAACAGCTAGGAGGCGCAGATGC (NBL1), transcript variant 2, m
Y           C23, FLJ45706 sapiens nucleolin (NCL), mRNA.
                        Homo      nucleolin cg26862286
    TAAAAATCACCTCAGGCCGGG[CG]CGGTGGCTCAGATCCGCAATCCCA
Y           C23, FLJ45706 sapiens nucleolin (NCL), mRNA.
                        Homo      nucleolin cg11738271
    GGCTGCGAAGTCAGTGTCACCAGATGGCC[CG]GGAGCAGGTCGAGAGCCACCG
Y           HsT16328 Homo sapiens necdin homolog (mouse) (NDN), mRNA.
                                  necdin       cg10021600
    GCACCTCGGAGTTGGGGGCCT[CG]GCTGCAAAGTTAGGGTCGCTCAGA
N           HsT16328 Homo sapiens necdin homolog (mouse) (NDN), mRNA.
                                  necdin       cg12138102
    CTGATGTGGTCCTTCAGCTCTTCC[CG]GGTTTCTTCTCATCAGCAGCTTCTTAAA
Y           NFL, NF-L, Homo sapiens neurofilament, light polypeptide 68kDa (NEFL),
                         NF68, CMT1F, CMT2E light polypeptide 68kDa
                                  neurofilament,
                                               cg00987688
    CGCCGCTTGTAGGAGGTCGAGTAGTA[CG]GCTCGTAGCTGAAGGAACTCATG mRNA.
Y           NFL, NF-L, Homo sapiens neurofilament, light polypeptide 68kDa (NEFL), mRNA.
                         NF68, CMT1F, CMT2E light polypeptide 68kDa
                                  neurofilament,
                                               cg05876319
    GGGGCAGCGCGCTGCTGCAGCCAAGG[CG]AGGATTCTGCGCAAAAGGGA
Y           NGN, HsT17534 sapiens neogenin homolog 1 (chicken) (NEO1), mRNA.
                        Homo      neogenin homolog 1
                                               cg11673424
    GAAAGACGTGATTCCCAGGTAGGAAAA[CG]CCAAGTGTCCCGCAAAGGTACAGGTAA
N           FLJ21841, Nbla00170 nestin
                        Homo sapiens nestin (NES), mRNA.
                                               cg17059112
    GAGGCTGTGAAGAAGGGTCACAATCCC[CG]AAAAAGGCAGATAATGCACAGAACTGA
Y           NEU, SIAL1  Homo sapiens sialidase 1 (lysosomal sialidase) (NEU1),
                                  neuraminidase precursor
                                               cg20383155
    TCACTTCTTCCTCTTCTTGTTGTC[CG]GGGGCGCCTCGTTCTTCTTGCCCAmRNA.
Y           KBF1, EBP-1, MGC54151,nuclear cg06930505 subunit 1
                        Homo sapiens NFKB-p50, NFKB-p105, NF-kappa-B, DKFZp686C01211
                                  nuclear factor kappa-B,
                                               factor of kappa light polypeptide
    CTCCGTGCTGCCTGCGTTCCC[CG]ACCATTGATTGGGCCCGGCAGGCGCgene enhancer in B-cells 1 (p105) (N
Y           KBF1, EBP-1, MGC54151,nuclear cg24413435 subunit 1
                        Homo sapiens NFKB-p50, NFKB-p105, NF-kappa-B, DKFZp686C01211 B-cells 1 (p105) (N
                                  nuclear factor kappa-B,
                                               factor of kappa light polypeptide gene enhancer in
    GTGAAGAGATGTGAATGTAACTGAGACA[CG]CTTAAATGGAATATACAGATGAGCTTT
Y           LYT10, LYT-10 sapiens nuclear cg23201134light polypeptide gene enhancer in in B-cells 2 (p49/p10
                        Homo      nuclear factor of kappa
                                               factor of kappa light polypeptide gene enhancer
    GGGATTCACCTATCTACACACATGCT[CG]CTTGCACACTCATGTTGACGCCATGGACAC B-cells 2 (p49/p100)
Y           NGF, HSAN5, Beta-NGF nerve growth factor, beta polypeptide (NGFB), mRNA.
                        Homo sapiens growth factor, beta polypeptide precursor
                                  nerve        cg02459758
    CGCGTTATCCACTTCTAGCCCT[CG]AGCTAGACCCTGGCATGGCCGTGGGCTTCT
Y           NGF, HSAN5, Beta-NGF nerve growth factor, beta polypeptide (NGFB), mRNA.
                        Homo sapiens growth factor, beta polypeptide precursor
                                  nerve        cg11660906
    CCAGCGCTCTCTGCTGTGCCGGAG[CG]CCGAGCTGCTCTCACACAGGCTTCTTGAA
Y           CD271, TNFRSF16, p75(NTR) growth factor receptor (TNFR superfamily, member 16) (NGFR), mRNA
                        Homo sapiens nerve cg07426306
                                  nerve growth factor receptor precursor
    AAGGACCTCTGATGCCGGGACCA[CG]AAGGAGGGTCTAGGGTTC
Y           CD271, TNFRSF16, p75(NTR) growth factor receptor (TNFR superfamily, member 16) (NGFR), mRNA
                        Homo sapiens nerve cg02052412
                                  nerve growth factor receptor precursor
    CTCCAGGGAGAAGGTGAAGCCAGAGG[CG]GAGGAAGATGGGTAAGAGA
N           NID, enactin, ENTACTIN nidogencg20234959
                        Homo sapiens
                                  nidogen (enactin)
                                                1 (NID1), mRNA.
    AACTCACGGGGTGTCCTTCTCAG[CG]CATCTCATCAGGAGATCCATGATGCCA
N           NID, enactin, ENTACTIN nidogencg16408295
                        Homo sapiens
                                  nidogen (enactin)
                                                1 (NID1), mRNA.
    ATCAGGAGATCCATGATGCCACTGTGTCC[CG]TTACTGCTGCAGTTAATGTTGATTGAT
Y           NKX3A, NKX3.1 sapiens NK3 transcription factor related, locus
                        Homo      NK3 transcription factor related, locus
                                               cg04902123
    CGAGCCCTGAGCACTGCCC[CG]CTCCGCTCCTCCCTAGGGGATTC 1 1 (Drosophila) (NKX3-1), mRNA.
N           NKX3A, NKX3.1 sapiens NK3 transcription factor related, locus 1 (Drosophila) (NKX3-1), mRNA.
                        Homo      NK3 transcription factor related, locus 1
                                               cg01716041
    GGACTGGACGGTACCGTGACAACAGA[CG]AAAGTGGAACAGAGATGATGG
Y           Peg5, MGC1439 sapiens neuronatin (NNAT), transcript variant 2,
                        Homo      neuronatin isoform beta
                                               cg10288563
    CCTACAGTAGCGACCTCCAC[CG]CAGATTCTCATCTCCTCGCTACCGTAAmRNA.
N           NOS, INOS, NOS2, HEP-NOS oxide synthase isoform 1
                        Homo sapiens nitric synthase 2A 2A (inducible, hepatocytes)
                                  nitric oxide cg26853415
    GGAAGAGACCTGTGCCTTGAGAACTT[CG]GGACTGTCTAGAACTGCCCAGTCC (NOS2A), transcript variant 1
N           NOS, INOS, NOS2, HEP-NOS oxide synthase isoform 1
                        Homo sapiens nitric synthase 2A 2A (inducible, hepatocytes) (NOS2A), transcript variant 1
                                  nitric oxide cg00297776
    AGGGTGGCTGCTAAGATAGAGGCACCA[CG]GAGCCAGGTTTTATTTGGCCAAGCC
N           eNOS, ECNOS, NOS III nitric oxide synthase 3 (endothelial cell) (NOS3), mRNA.
                        Homo sapiens oxide synthase 3 (endothelial cell)
                                  nitric       cg04071701
    TCAGAGCAGGTGACCAGTGGTGACTCAGTT[CG]GAGCAGGTGATAGAAGCTAGGAG
Y           hN1, TAN1 Homo sapiens Notch homolog 1, translocation-associated (Drosophila) (NOTCH1), mRNA.
                                  notch1 preproprotein
                                               cg17501216
    GGCGAAGAAGAAAGAAGATAAATGGCC[CG]GAGAAGCAACAGGAAACCAAAACCGA
Y           hN1, TAN1 Homo sapiens Notch homolog 1, translocation-associated
                                  notch1 preproprotein
                                               cg26924342
    CAAAATGCCTGCCATAGTCCCTG[CG]CAAAGTTCACGGCCTCGTGCCAGGG (Drosophila) (NOTCH1), mRNA.
Y           hN2         Homo sapiens Notch homolog 2 (Drosophila) (NOTCH2), mRNA.
                                  notch 2 preproprotein
                                               cg09189069
    TTCAAGCACTGGAGTTTGCCGGGAT[CG]TGAACTTGCAGGGAGAGGCG
Y           CASIL, CADASIL sapiens Notch homolog 3 (Drosophila) (NOTCH3),
                      Homo       Notch homolog 3
                                             cg20969065
    TCCCTTCATCTTCAGCTCTAAT[CG]CTCAAGGGTCCCTGTTCCTTGGGCC mRNA.
Y           CASIL, CADASIL sapiens Notch homolog 3 (Drosophila) (NOTCH3), mRNA.
                      Homo       Notch homolog 3
                                             cg17944161
    GAGCATGCAGTGAGACGCGGGCAGAACC[CG]GAGTGGCGGGCACACCCAACCT
N           INT3, NOTCH3, MGC74442 preproprotein (Drosophila) (NOTCH4), mRNA.
                      Homo sapiens Notch homolog 4
                                 notch4      cg14700707
    CCTCGGCCTGCTGCAAGCCTCA[CG]TCTGAGCTGTTTCCTGAGTCACACAATGTC
N           INT3, NOTCH3, MGC74442 preproprotein (Drosophila) (NOTCH4), mRNA.
                      Homo sapiens Notch homolog 4
                                 notch4      cg05166027
    CCTGAGAGCCTTCCCCTAC[CG]GGGAATATACTTCACCAGCACCACTTT
Y           AMDM, NPRB, ANPRB, GUC2B, peptide receptor B precursor
                      Homo sapiens natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide rec
                                 natriuretic NPRBi, GUCY2B
                                             cg17151902
    AGGACAAACCCTGGGGTCGCTGG[CG]TGTGTGAGATGGAAATGGA
Y           AMDM, NPRB, ANPRB, GUC2B, peptide receptor B precursor
                      Homo sapiens natriuretic peptide receptor B/guanylate cyclase
                                 natriuretic NPRBi, GUCY2B
                                             cg02519855
    CGCCGTAGCTCCGGATGGGACCAG[CG]CCCGGGCCCGTTAGTCCAAGCAGG B (atrionatriuretic peptide rec
Y           PYY4      Homo sapiens neuropeptide Y (NPY), mRNA.
                                 neuropeptide Y
                                             cg25884711
    TGGCTCTCACCCCTCGGAGA[CG]CTCGCCCGACAGCATAGTACTTGCCG
Y           PYY4      Homo sapiens neuropeptide Y (NPY), mRNA.
                                 neuropeptide Y
                                             cg20666532
    GAAGGAAAGAAGGAAAGCAGGGAT[CG]GGCACTGCCCGAGGGCAGATACT
Y           PYY4      Homo sapiens neuropeptide Y (NPY), mRNA.
                                 neuropeptide Y
                                             cg20961293
    CGCCACTCAGGGGCGGGAAGTGG[CG]GGTGGGAGTCACCCAAGCGT
Y           DTD, QR1, Homo sapiens NMOR1,cg09516362
                      DHQU, DIA4, NAD(P)H dehydrogenase, quinone 1dioxin-inducible isoform c 3, mRNA.
                                 NAD(P)H menadione oxidoreductase 1, (NQO1), transcript variant
                                               NMORI
    CGGCTGCAACCTTGTGGGAGTCG[CG]TGTGTAGTGCACGGTGCATTCTCT
N           DTD, QR1, Homo sapiens NMOR1,cg19194454
                      DHQU, DIA4, NAD(P)H dehydrogenase, quinone 1dioxin-inducible isoform c
                                 NAD(P)H menadione oxidoreductase 1, (NQO1),
                                               NMORI
    AAATGGAGCAGAAAAAGAGCCGGATG[CG]GATTACTGTGGTGCCCTAGGCT transcript variant 3, mRNA.
Y           EAR2, EAR-2, ERBAL2 nuclear cg24945194 2, group F, member 6 6 (NR2F6), mRNA.
                      Homo sapiens
                                 nuclear receptor subfamily
                                              receptor subfamily 2, group F, member
    CGGCAGGTGTAGCTGAGGTTGCGG[CG]GATGCTTCGCTTGAAAAAGCTC
Y           N-ras, NRAS1
                      Homo sapiens neuroblastoma RAS viral (v-ras) oncogene homolog (NRAS), mRNA.
                                 neuroblastoma RAS viral (v-ras) oncogene homolog
                                             cg24584246
    AACAGAAAACTGGAGAAAGCAAAAATGTTT[CG]TGTTTACAAAGATAAACGGCCTCTTT
Y           N-ras, NRAS1
                      Homo sapiens neuroblastoma RAS viral (v-ras) oncogene homolog (NRAS), mRNA.
                                 neuroblastoma RAS viral (v-ras) oncogene homolog
                                             cg18989243
    TCCCACACGGGACGTTTCAATAATGAAAG[CG]CTAGGTGCTAGTGTCTCAAAAATCAGT
Y           GGF, HGL,Homo sapiens neuregulin 1 (NRG1), transcript variant
                      HRG, NDF, ARIA, GGF2, HRG1, HRGA, SMDF
                                 neuregulin 1 isoform HRG-beta3
                                             cg25833018
    GAAAAAGAGCCGGCGAGGAGTTCCC[CG]AAACTTGTTGGAACTCCGG HRG-beta3, mRNA.
Y           GGF, HGL,Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-beta3, mRNA.
                      HRG, NDF, ARIA, GGF2, HRG1, HRGA, SMDF
                                 neuregulin 1 isoform HRG-beta3
                                             cg12863621
    AGCGCAACCTAGCATCTTTAAGGTT[CG]CTTAGCCCTTCCTGTGCACCTGGAAGG
N           MTC, TRK, Homo sapiens p140-TrkA tyrosine kinase, receptor, type 1
                      TRK1, TRKA, neurotrophic
                                 neurotrophic tyrosine kinase, receptor, type 1 isoform 3
                                             cg18744444
    GAGCAGTAAGGGAGTGAGTGGGCAACT[CG]GCGCATGAAGGAGGTACTCCTC(NTRK1), transcript variant 3, m
Y           TRKB, GP145-TrkB neurotrophic tyrosine kinase, receptor, type 2 isoform e precursor
                      Homo sapiens neurotrophic tyrosine kinase, receptor, type 2
                                             cg23399093
    TGACTGCGGAAAAACAGATTCCGAGC[CG]CAAAAGGGAAGACGGATTCTCAG (NTRK2), transcript variant e, m
Y           TRKB, GP145-TrkB neurotrophic tyrosine kinase, receptor,
                      Homo sapiens neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), transcript variant e, m
                                             cg07764593
    TCCGAGCATTCACTCTAACGTT[CG]GTTTCTTGATCCTTCCCATCCC type 2 isoform e precursor
Y           TRKC, gp145(trkC)
                      Homo sapiens neurotrophic tyrosine kinase, receptor, type
                                 neurotrophic tyrosine kinase, receptor, type 3 isoform b precursor
                                             cg00865584
    CCTCTGCCTTTGAAACGCCGAG[CG]ATCAGATGCAAAATCCTTCAGCGTCTG 3 (NTRK3), transcript variant 2, m
Y           TRKC, gp145(trkC)
                      Homo sapiens neurotrophic tyrosine kinase, receptor, type 3 (NTRK3), transcript variant 2, m
                                 neurotrophic tyrosine kinase, receptor, type 3
                                             cg25116345
    CGCTAGCCGCAGCCCGGGGGAAAC[CG]AGACCGAAGGGAAAAAGTTGCA isoform b precursor
Y           TRKC, gp145(trkC)
                      Homo sapiens neurotrophic tyrosine kinase, receptor, type 3 (NTRK3), transcript variant 2, m
                                 neurotrophic tyrosine kinase, receptor, type
                                             cg09147530
    CCTTTCCACTTTTTGGCCCT[CG]CGCTACCCGGTTTTGCTGCAATCCGGA3 isoform b precursor
Y           NTR       Homo sapiens neurotensin receptor 1 (high affinity) (NTSR1), mRNA.
                                 neurotensincg13085480
                                               receptor 1
    TGGAACCCGTGGCAAGCGCCGAGC[CG]GGAGACAGCCCGAGGAACCACG
Y           NTR       Homo sapiens neurotensin receptor 1 (high affinity) (NTSR1), mRNA.
                                 neurotensincg03567830
                                               receptor 1
    AAGGGTCTGGTGCACGATACCCGCCG[CG]CCCGCTCGGAATCCTGGTTC
Y           HOGA, DKFZp781A11155ornithine aminotransferase (gyrate
                      Homo sapiens
                                 ornithine aminotransferase precursor
                                             cg10231486
    CTCTGCCCCAGCCACAGCTG[CG]GGAGCCCCATGCCCTTGAACCC atrophy) (OAT), nuclear gene encoding m
Y           .         Homo sapiens ornithine decarboxylase 1 (ODC1), mRNA.
                                 ornithine decarboxylase 1
                                             cg06408248
    AGCTGCACAGCTGTGCTTCCACCTGG[CG]TTCAGTACCTCGTGCCCGAGAGCG
Y           HMMH, MUTM, OGH1, HOGG1 cg10816847
                      Homo sapiens 8-oxoguanine DNA glycosylase (OGG1), nuclear
                                 8-oxoguanine DNA glycosylase isoform 2d
    GATGGAGTATGGAAGAAATGCCCAAGA[CG]GCAGGCAGCAGCTGTGGCGGCC gene encoding mitochondria
Y           OC2, OC-2, MGC120377, one domain, family member 2 2 (ONECUT2),
                      Homo sapiens MGC120378
                                 one cut cut cg15475634 member
                                              domain, family
    CCAAAGACCTAGAAGGCTGCGCCATGAACC[CG]GAGCTGACAATGGAAAGTCTGmRNA.
Y           OC2, OC-2, MGC120377, one domain, family member 2 2 (ONECUT2), mRNA.
                      Homo sapiens MGC120378
                                 one cut cut cg04991486 member
                                              domain, family
    GGTAGGTTGGCTGCCCCGGCGAG[CG]GCAGAGCCCTTCTGGACAGCTCCC
Y           OPCM, OBCAM sapiens opioid binding protein/cell adhesion molecule-like (OPCML), transcript
                      Homo       opioid binding protein/cell adhesion molecule-like
                                             cg19151121
    TGGGATGAAGAGCAGGGCAGTTGT[CG]CCGAGAAGACGACCCAGTAGGCAGGisoform a preproprotein variant
N           OPCM, OBCAM sapiens opioid binding protein/cell adhesion molecule-like (OPCML), transcript variant
                      Homo       opioid binding protein/cell adhesion molecule-like isoform a preproprotein
                                             cg00738841
    CAGAGCAGTCCTCCAAGGCA[CG]CATTGGCTCCACTCTCCTGAGCGACGG
Y           MGC20461Homo sapiens oncostatin M (OSM), mRNA.
                                 oncostatin M precursor
                                             cg04546763
    CGCTCCTCCTCCTGTTTTCTT[CG]AATTCGTTCTTCGAGGTCAGCCCTAC
N           MGC20461Homo sapiens oncostatin M (OSM), mRNA.
                                 oncostatin M precursor
                                             cg10467217
    CAGGCTGGCAGCCACTTTATGCC[CG]CTGGGGCGATTGGCCAACACCTCATGA
Y           ARF, MLM,Homo sapiens cyclin-dependent kinase inhibitor isoform
                      p14, p16, p19, CMM2,cg05238395 inhibitorCDK4I, CDKN2,
                                 cyclin-dependent kinase TP16, 2A 2A (melanoma, p16, inhibits p16INK4, p16I
                                              INK4, MTS1,
    GGCCTCCGACCGTAACTATTCGGTG[CG]TTGGGCAGCGCCCCCGCCTC 4 INK4a, p14ARF, CDK4) (CDKN2
Y           ARF, MLM,Homo sapiens cyclin-dependent kinase inhibitor isoform 4 INK4a, p14ARF, CDK4) (CDKN2
                      p14, p16, p19, CMM2,cg17449661 inhibitorCDK4I, CDKN2,
                                 cyclin-dependent kinase TP16, 2A 2A (melanoma, p16, inhibits p16INK4, p16I
                                              INK4, MTS1,
    CGAAGGCTCCATGCTGCTCCC[CG]CCGCCGGCTCCATGCTGCTCCCC
Y           P2X7, MGC20089sapiens purinergic receptor P2X, ligand-gated ion channel,
                      Homo       purinergic receptor P2X7 isoform b
                                             cg10190173
    GCACATTCTGAATCTCACATGGTTTT[CG]AATCTGAGACGTGCTCTCACAGCCAGCT7 (P2RX7), transcript varia
N           P2X7, MGC20089sapiens purinergic receptor P2X, ligand-gated ion channel, 7 (P2RX7), transcript varia
                      Homo       purinergic receptor P2X7 isoform b
                                             cg25604246
    GTCATCTGCCAGCCAGGCC[CG]TAGGACTTGGCGCTTCTTGTTTATCACAGC
N           P2X7, MGC20089sapiens purinergic receptor P2X, ligand-gated ion
                      Homo       purinergic receptor P2X7 isoform b
                                             cg08688169
    TTTGGCTGATTGGTCTAGGTCATAGAT[CG]ACCTGCCGGGGTGCAGAGG channel, 7 (P2RX7), transcript varia
N           PAD, PDI4,Homo sapiens peptidyl cg18333690
                      PDI5, PADI5peptidyl arginine deiminase, type IV IV (PADI4), mRNA.
                                              arginine deiminase, type
    TCCTACAGCCAGAGGGACGAGCTAGCCCGA[CG]ATGGCCCAGGGGACATTGATC
N           PAD, PDI4,Homo sapiens peptidyl cg23228178
                      PDI5, PADI5peptidyl arginine deiminase, type IV IV (PADI4), mRNA.
                                              arginine deiminase, type
    CATGGGCATCCCCCTGGCAGG[CG]TGGCCCACACCTGCACTGTCTGGTCTGAC
N           PAD, PDI4,Homo sapiens peptidyl cg19159961
                      PDI5, PADI5peptidyl arginine deiminase, type IV IV (PADI4), mRNA.
                                              arginine deiminase, type
    ACCCACGAAACGCTCTATGTTCA[CG]CCAGACTCCCATGCATGCACCCTT
Y           AKAP2     Homo sapiens PALM2-AKAP2 protein (PALM2-AKAP2),
                                 PALM2-AKAP2 protein isoform 2
                                             cg21898539
    GGTCCATCACACTCCAGGGG[CG]GAGCGAGGCACCGAGACGTCAGGGC transcript variant 2, mRNA.
Y           AKAP2     Homo sapiens PALM2-AKAP2 protein (PALM2-AKAP2), transcript variant 2, mRNA.
                                 PALM2-AKAP2 protein isoform 2
                                             cg12992456
    GGGTCCCACATTCGGTCAGA[CG]CCCCTCTCCACTGGCATCTGCCC
Y           PARP, PPOL, ADPRT,poly (ADP-ribose) polymerase family, member
                      Homo sapiens poly (ADP-ribose) polymerase family, member
                                  ADPRT1, PARP-1, pADPRT-1
                                             cg17303114
    TCCGGGAAGCGCAGGCCCCCGCCT[CG]GGAATATAGTTGATTGGCCCGA 1 1 (PARP1), mRNA.
Y           AN, AN2, MGDA, WAGR, D11S812E,gene 6 (aniridia, keratitis) (PAX6), transcript variant 2, mRNA.
                      Homo sapiens paired box MGC17209b
                                 paired box gene 6 isoform
                                             cg25893336
    CGCTCCTCACTGGCCCATTAG[CG]AAGCCTGACCTCTGTCATCATCCTCC
Y           AN, AN2, MGDA, WAGR, D11S812E,gene 6 (aniridia, keratitis) (PAX6),
                      Homo sapiens paired box MGC17209b
                                 paired box gene 6 isoform
                                             cg10185808
    CTCTCCTGGGTCTGCTCAGTCCA[CG]GAGGCAGCTCCCCTTCAGCTGTTGCC transcript variant 2, mRNA.
Y           AN, AN2, MGDA, WAGR, D11S812E,gene 6 (aniridia, keratitis) (PAX6),
                      Homo sapiens paired box MGC17209b
                                 paired box gene 6 isoform
                                             cg06727689
    GCTTTATGCAAAGCAGCGCCGGGGCCT[CG]CGCCAGCCGATTGGATGCTCCCtranscript variant 2, mRNA.
Y           PC42, PCDH42, MGC45991
                      Homo sapiens protocadherin 1 (cadherin-like 1) (PCDH1), transcript variant 2, mRNA.
                                 protocadherin 1 isoform 2 precursor
                                             cg09064128
    GCTCCGGCTCCGGCTGGCTCTGGG[CG]CAGCAGCCCGGCGGCTTTGCGTCC
Y           PC42, PCDH42, MGC45991
                      Homo sapiens protocadherin 1 (cadherin-like 1) (PCDH1), transcript variant 2, mRNA.
                                 protocadherin 1 isoform 2 precursor
                                             cg19580572
    CTCTGCCATCTCTTCACTGCC[CG]AGGCCCAGTACACAGGCCGTGCC
Y           BMI1, RNF51, MGC12685 polycomb group ring finger 4 (PCGF4), mRNA.
                      Homo sapiens
                                 polycomb group ring finger 4
                                             cg26800126
    GAAACGATGCGATCTCCTGGGTTTGT[CG]CAGACCCCTGCTTCGGGGCTCCG
Y           BMI1, RNF51, MGC12685 polycomb group ring finger 4 (PCGF4), mRNA.
                      Homo sapiens
                                 polycomb group ring finger 4
                                             cg04657605
    CAGTTTCCACTCTGCCTTCAG[CG]GTGCATTTTTTTCCACCCTCCC
Y           PCTAIRE, FLJ16665, PCTAIRE1, cg12064400 1 1 (PCTK1), transcript
                      Homo sapiens PCTAIRE protein kinase
                                 PCTAIRE protein kinase
                                              PCTGAIRE
    ATAACTCTTCAGGCTGCCTCTCCT[CG]AAAAGTCATCTTCTCGCGAACCTTTAA variant 1, mRNA.
Y           PDE1B1, PDES1B
                       Homo sapiens phosphodiesterase 1B, calmodulin-dependent (PDE1B), mRNA.
                                 phosphodiesterase 1B, calmodulin-dependent
                                             cg15927682
    CTAGAGACACCGGCCTGGCTGGTCCA[CG]CCAGCCGCAGGTGGGAAGGG
Y           PDE1B1, PDES1B
                       Homo sapiens phosphodiesterase 1B, calmodulin-dependent (PDE1B), mRNA.
                                 phosphodiesterase 1B, calmodulin-dependent
                                             cg06901488
    CGCCTCCGCTGCACTCTGTAAACA[CG]CACTCACATCCGCCAGTACAGGGC
Y           .          PREDICTED: Homo sapiens platelet-derived growth factor
                                 platelet-derived growth factor alpha isoform
                                             cg26073791
    CACCTGCCTGGACGCCTGGCC[CG]GCCCCGGCTGCGAGCTGCGAGCC 1 alpha polypeptide, transcript varia
Y           .          PREDICTED: Homo sapiens platelet-derived growth factor alpha
                                 platelet-derived growth factor alpha isoform 1
                                             cg18011616
    GGCAGCGGGCAGCGCCCAGAGCTGCTG[CG]CCAAAAAGGGCCAGAGAGCCGGT polypeptide, transcript varia
Y           SIS, SSV, PDGF2, c-sis, FLJ12858
                       Homo sapiens platelet-derived growth factor beta polypeptide
                                 platelet-derived growth factor beta isoform 1, preproprotein
                                             cg01293532
    CGCAGGGAGGCAGGCAGGCCGCTCC[CG]GCTGCAGGAGGAGAAGTTGCCA (simian sarcoma viral (v-sis) o
N           SIS, SSV, PDGF2, c-sis, FLJ12858
                       Homo sapiens platelet-derived growth factor beta polypeptide
                                 platelet-derived growth factor beta isoform 1, preproprotein
                                             cg10554007
    AGGGCTACCAACATGATCTTCC[CG]TCAGTCACCCTGCTGTTTACTATCTCCC (simian sarcoma viral (v-sis) o
N           CD140A, PDGFR2, MGC74795 cg20629161 factor receptor, alpha polypeptide (PDGFRA), mRNA.
                       Homo sapiens platelet-derived growth receptor alpha
                                 platelet-derived growth factor
    GTGTGGGACATTCATTGCGGAATAACAT[CG]GAGGAGAAGGTAAGGGAA precursor
Y           CD140A, PDGFR2, MGC74795 cg27645880 factor receptor, alpha polypeptide (PDGFRA), mRNA.
                       Homo sapiens platelet-derived growth receptor alpha
                                 platelet-derived growth factor
    GCTGAAGATGCACGAGAGCGGGTCG[CG]TAGAAGAACTGCGGCAATGGGprecursor
N           JTK12, PDGFR, CD140B, platelet-derived growth factor receptor, precursor
                       Homo sapiens PDGFR1, PDGF-R-beta receptor beta
                                 platelet-derived growth factor
                                             cg21817429
    AAGCATCCTTCGGGAGGAGCAGAGC[CG]CCAGAGGGGCCGCCCTGG beta polypeptide (PDGFRB), mRNA.
Y           JTK12, PDGFR, CD140B, platelet-derived growth factor receptor, beta polypeptide (PDGFRB), mRNA.
                       Homo sapiens PDGFR1, PDGF-R-beta receptor beta precursor
                                 platelet-derived growth factor
                                             cg12727795
    CTTAGAAATTCCACAGCCCA[CG]CCAGCCGCCAGCTGCTGAGTCACTTTT
Y           JTK12, PDGFR, CD140B, platelet-derived growth factor receptor, precursor
                       Homo sapiens PDGFR1, PDGF-R-beta receptor beta
                                 platelet-derived growth factor
                                             cg25440811
    CACTTTCCCGATGCCCATGT[CG]GGTGGCGGCCTCCCCTTGCCATGGC beta polypeptide (PDGFRB), mRNA.
Y           CD31, PECAM-1 sapiens platelet/endothelial cell adhesion molecule (CD31 antigen) (PECAM1), mRNA
                       Homo      platelet/endothelial cell adhesion molecule (CD31
                                             cg12476586
    GCGCCTGCAGAGAGACCGGCTGTGG[CG]CTGGTCAGGTAATGGCAGCCATGGantigen)
Y           CD31, PECAM-1 sapiens platelet/endothelial cell adhesion molecule (CD31 antigen) (PECAM1), mRNA
                       Homo      platelet/endothelial cell adhesion molecule (CD31
                                             cg05359956
    CAAGGCACAAGTGACATTTGCCTTGG[CG]TTCTTGACCCTCCCTCTGTCTCGC antigen)
Y           .          PREDICTED: Homo sapiens paternally expressed
                                 similar to paternally expressed 10
                                             cg07861337
    CTCCCAGCATTTCATGATTC[CG]CTTCCCTGCTCCGTAAAACCGAA 10 (PEG10), mRNA.
Y           PW1, ZSCAN24, KIAA0287, DKFZp781A095 3 (PEG3), mRNA.
                       Homo sapiens paternally expressed
                                 paternally expressed 3
                                             cg07299214
    CATTGGTGTCGACCTTGCTGGACTTGC[CG]TGGCAGAGCCCCCGGCTGTCTGCC
Y           .          Homo sapiens proenkephalin (PENK), mRNA.
                                 proenkephalin
                                             cg25021837
    TTCGAGCCTGCCTGGGCGCAGAA[CG]GGGTCCCTCGGCAGGACCCTC
Y           .          Homo sapiens proenkephalin (PENK), mRNA.
                                 proenkephalin
                                             cg07433146
    CCAATTGGAAAAGCCGGGTTCAGACA[CG]ACTCTAGAGGGAAGAGAAGAAG
Y           PLGF, PlGF-2
                       Homo sapiens placental growth factor, vascular endothelial growth factor-related protein (PG
                                 placental growth factor, vascular endothelial growth factor-related protein
                                             cg11057536
    GTCCTCCCGTAGCTGGGCGGC[CG]TCCGTCGATGCAGTTTCCTCCGC
Y           PLGF, PlGF-2
                       Homo sapiens placental growth factor, vascular endothelial
                                 placental growth factor, vascular endothelial growth factor-related protein
                                             cg07464201
    CCAGGAGTCCAGCGTCAGC[CG]TCAAGGCTCATGATCTAACCGCCTCTGC growth factor-related protein (PG
N           PR, NR3C3Homo sapiens progesterone receptor (PGR), mRNA.
                                 progesterone receptor
                                             cg24886336
    GAAGTTTGGATGTTGTGTGCCACACTT[CG]ATTTGTCTTAAGGAATGTGTTCC
N           PR, NR3C3Homo sapiens progesterone receptor (PGR), mRNA.
                                 progesterone receptor
                                             cg00173799
    ATTCTGGGAAGCAGGTATAGAATGTTCAC[CG]GGCATCAAATGGCAGGATATAATATGG
N           PR, NR3C3Homo sapiens progesterone receptor (PGR), mRNA.
                                 progesterone receptor
                                             cg01987509
    CACTAGCAGTTATTCCACATTTC[CG]CCTAAATCTCCCAGCAGCCACTAATAT
Y           IPL, BRW1C, BWR1C,pleckstrinTSSC3
                       Homo sapiens pleckstrin homology-like domain, family A, member 2 (PHLDA2), mRNA.
                                  HLDA2, homology-like domain family
                                             cg18242686
    GCTGGCGGGGAACAGGCTCAGG[CG]GTCGGAGGTGAGCACCCCGCA member 2
Y           IPL, BRW1C, BWR1C,pleckstrinTSSC3
                       Homo sapiens pleckstrin homology-like domain, family A,
                                  HLDA2, homology-like domain family A member 2
                                             cg07667013
    CTATCTTGCCACCCACGGGCTG[CG]CCAAGAACGACCACCTCTCTTAGCC member 2 (PHLDA2), mRNA.
N           ESI, WAP3, SKALP, WFDC14, MGC13613 3, skin-derived (SKALP) (PI3), mRNA.
                       Homo sapiens peptidase inhibitor
                                 elafin preproprotein
                                             cg17976697
    CTTGATCGTGGTGGTGTTCCTCAT[CG]CTGGGACGCTGGTTCTAGAG
N           ESI, WAP3, SKALP, WFDC14, MGC13613 3, skin-derived (SKALP) (PI3), mRNA.
                       Homo sapiens peptidase inhibitor
                                 elafin preproprotein
                                             cg18675416
    AAAGGCTTCCACAGTCTGACATT[CG]TTTATGTCTCCCTCAGTTTCAGGCTTGG
N           ESI, WAP3, SKALP, WFDC14, MGC13613 3, skin-derived (SKALP) (PI3), mRNA.
                       Homo sapiens peptidase inhibitor
                                 elafin preproprotein
                                             cg19931348
    TCTACCAGTGACTTGCTGAATAACCTT[CG]GTGATTCCTTTCTCTTCTTGGGTCTCACT
N           GRB1, p85-ALPHA
                       Homo sapiens phosphoinositide-3-kinase, regulatory subunit 1 (p85 alpha) (PIK3R1), transc
                                 phosphoinositide-3-kinase, regulatory subunit, polypeptide
                                             cg03473299
    CGTGTGTGGAGTGCCACGGTACAATCAGA[CG]ACAGATGGACAGTGTGACAAAAGTGT 1 isoform 3
Y           RS, RGS, ARP1, Brx1,paired-like homeodomain transcription factor 2 isoform c
                       Homo sapiens paired-likeIHG2, PTX2, RIEG, IGDS2, IRID2, Otlx2, RIEG1, MGC20144, 3, m
                                  IDG2, IGDS, homeodomain transcription factor
                                             cg10692923
    CTGGCGGGGCACTTAGGAGCCAAC[CG]AGGAGCAGGAGCACGGACTCCCAC 2 (PITX2), transcript variantMG
Y           RS, RGS, ARP1, Brx1,paired-like homeodomain transcription factor 2 isoform c
                       Homo sapiens paired-likeIHG2, PTX2, RIEG, IGDS2, IRID2, Otlx2, RIEG1, MGC20144, 3, m
                                  IDG2, IGDS, homeodomain transcription factor
                                             cg13359552
    AGCGACAGGGAAAGTGGCCCAAGAGA[CG]GAACAAAGGACAATGTTCATGGG2 (PITX2), transcript variantMG
Y           PKD4, APKD2, MGC138468
                       Homo sapiens polycystic kidney disease 2 (autosomal
                                 polycystin 2cg27652306
    CCTTTCCCTGCAGGCGGGCTGG[CG]GGTGAGCGATTCCCTCCCTTCC dominant) (PKD2), mRNA.
Y           PKD4, APKD2, MGC138468
                       Homo sapiens polycystic kidney disease 2 (autosomal
                                 polycystin 2cg21790274
    ACCCAAGAGTTATCTCAGCGT[CG]GGCAGGCATCGACAGCTCCAGGAG dominant) (PKD2), mRNA.
N           MOM1, PLA2, PLA2B, phospholipase A2, A2, group IIA (platelets, synovial fluid) (PLA2G2A), mRNA.
                       Homo sapiens phospholipase groupsPLA2
                                 PLA2L, PLA2S, PLAS1, IIA
                                             cg22220722
    CCAGCACCTGTGCAGGCCTCA[CG]TGTGCACCCCACAGTCCACCA
N           MOM1, PLA2, PLA2B, phospholipase A2, A2, group IIA (platelets,
                       Homo sapiens phospholipase groupsPLA2
                                 PLA2L, PLA2S, PLAS1, IIA
                                             cg09600256
    CCATCAAACAGCTTTCCTCT[CG]AGAATACCATTTACCTCCAGTGCTCGAsynovial fluid) (PLA2G2A), mRNA.
Y           ZAC, LOT1, ZAC1, MGC126275, MGC126276, DKFZp781P1017
                       Homo sapiens pleiomorphic adenoma gene-like 1 (PLAGL1), transcript variant 1, mRNA.
                                 pleiomorphic adenoma gene-like 1 isoform
                                             cg12757684
    ATGGCAGATGCCGTGGGCTTTGC[CG]CCCGCGGCAGCCAAGAGGATGG1
Y           ZAC, LOT1, ZAC1, MGC126275, MGC126276, DKFZp781P1017 1
                       Homo sapiens pleiomorphic adenoma gene-like 1 (PLAGL1),
                                 pleiomorphic adenoma gene-like 1 isoform
                                             cg11532302
    AGCGGGGCCTGCTAGCCGAAGTCTC[CG]CCAGGATGGGCCGCCAGAGCCC transcript variant 1, mRNA.
Y           ZAC, LOT1, ZAC1, MGC126275, MGC126276, DKFZp781P1017 1
                       Homo sapiens pleiomorphic adenoma gene-like 1 (PLAGL1), transcript variant 1, mRNA.
                                 pleiomorphic adenoma gene-like 1 isoform
                                             cg23460430
    AACTAACTTACCTCCTGTGCCAGCAG[CG]CCCAAGTGCAGCTGCCCAAACGTGAG
N           TPA, T-PA,Homo sapiens plasminogen activator, tissue (PLAT), 2 precursor
                       DKFZp686I03148
                                 plasminogen activator, tissue type isoform
                                             cg00024388
    GCTTGCTCCTTCCCTTTCCT[CG]CAGAGGTTTTCTCTCCAGCCCTGGA transcript variant 2, mRNA.
N           TPA, T-PA,Homo sapiens plasminogen activator, tissue (PLAT), transcript variant 2, mRNA.
                       DKFZp686I03148
                                 plasminogen activator, tissue type isoform 2 precursor
                                             cg02252925
    AGCACAGCCCATCCTGGCTT[CG]GGCCAGGCTGATTATTCACAGCCGTGAT
Y           ATF, UPA, URK, u-PA urokinase plasminogen activator preproprotein
                       Homo sapiens plasminogen activator, urokinase (PLAU), mRNA.
                                             cg04950292
    GCGGGCCCTGATATAGAGCAGGCGCCG[CG]GGTCGCAGCACAGTGCGGAGACC
Y           ATF, UPA, URK, u-PA urokinase plasminogen activator preproprotein
                       Homo sapiens plasminogen activator, urokinase (PLAU),
                                             cg26457761
    TCTCGATTCCTCAGTCCAGA[CG]CTGTTGGGTCCCCTCCGCTGGAGATC mRNA.
Y           CD87, UPAR, URKR plasminogen activator, urokinase receptor
                       Homo sapiens plasminogen activator, urokinase receptor (PLAUR), transcript variant 3, mRN
                                             cg08793657
    GGACTCCTCCCAGACGTTTTG[CG]AAAGAGCGAGTCAGCCCCAGATGC isoform 3 precursor
Y           CD87, UPAR, URKR plasminogen activator, urokinase receptor isoform 3
                       Homo sapiens plasminogen activator, urokinase receptor (PLAUR), transcript variant 3, mRN
                                             cg04828696
    TCTCTCTTCCTAACGTGGGACC[CG]GGGCAATCGCTCTCCACTGCTGTAAAATGA precursor
N           DKFZp779M0222 sapiens plasminogen (PLG), mRNA.
                       Homo      plasminogeng17161407
                                             c
    AAGAGCCAATGTAGCTAATTATGCAAAGGA[CG]GCTAAGCTCTTTGCCTGGTTCT
N           DKFZp779M0222 sapiens plasminogen (PLG), mRNA.
                       Homo      plasminogeng03709290
                                             c
    GAAGCTTGAGGGAGGCTATGGA[CG]TGCAGCGCTTGGCAGAGGGTCT
Y           T-PLASTINHomo sapiens plastin 3 (T isoform) (PLS3), mRNA.
                                 plastin 3 cg10907857
    GGCAGTCGGGCCAGACCCAGGACTCTG[CG]ACTTTACGTAAGTGCTTTGTAGGCGC
Y           T-PLASTINHomo sapiens plastin 3 (T isoform) (PLS3), mRNA.
                                 plastin 3 cg26006361
    CCTTCCTGGTTCCCAGGC[CG]ACTGCTAGCACCACCCGAGCCAATG
Y           .          Homo sapiens phospholipid scramblase 3 (PLSCR3), mRNA.
                                 phospholipid scramblase 3
                                             cg26114392
    GTGGAAGCTGCGATTTGGCCCCA[CG]AGCAGCGAGGAGTCCACCGAGACATTT
Y           TEM3, TEM7, FLJ45632 plexin domain containing 1 (PLXDC1), mRNA.
                       Homo sapiens
                                 plexin domain containing 1 precursor
                                             cg26456838
    AGCTCGCCTCGCATGGTGGGTGCC[CG]GACCTGCCCCCGGCCTGCTTGCTGC
Y           TEM3, TEM7, FLJ45632 plexin domain containing 1 (PLXDC1),
                       Homo sapiens
                                 plexin domain containing 1 precursor
                                             cg21125376
    CGCCTGCCCTCAGCCCTAA[CG]GAGCGCTCCCCTAGAGCTCTGCAGCCmRNA.
Y           TEM7R, FLJ14623
                       Homo sapiens plexin domain containing 2 (PLXDC2), mRNA.
                                 plexin domain containing 2 precursor
                                             cg16953926
    GCTGCCCGAGTGGAACCGACAGTTTG[CG]AGCCTCGGCTGCAAGTGGCCTC
Y           TEM7R, FLJ14623
                       Homo sapiens plexin domain containing 2 (PLXDC2), mRNA.
                                 plexin domain containing 2 precursor
                                             cg22660101
    CCTGTTCCTTTAAACTCTCGCTTT[CG]CCCCCGCTGACACTTTGCAAAGCC
N           DSS, HNPP, CMT1A, CMT1E, GAS-3, Sp110, MGC20769
                       Homo sapiens peripheral myelin protein 22 (PMP22), transcript variant 1, mRNA.
                                 peripheral myelin protein 22
                                             cg06112772
    ATTTCCAGTGTCTTTCTCCC[CG]CTGGATGTTTCGTTGTCCAGCCAGGTTGTC
N           DSS, HNPP, CMT1A, CMT1E, GAS-3, Sp110, MGC20769
                       Homo sapiens peripheral myelin protein 22 (PMP22), transcript variant 1, mRNA.
                                 peripheral myelin protein 22
                                             cg08815822
    CCCTCCCTGTCACACACTTTA[CG]TTTGATTGGACTCTCCAGTCACAAGGGC
Y           PCLP, Gp200Homo sapiens podocalyxin-like (PODXL), transcript variant 1,
                                 podocalyxin-like precursor isoform 1
                                             cg03748590
    TGCCTGGGAGACGCAGACCCCAGGCC[CG]CCTGAAGAGGAGGCACATCGGC mRNA.
Y           MSH, POC,Homo sapiens proopiomelanocortin (adrenocorticotropin/
                        ACTH, CLIP
                                 proopiomelanocortin
                                             cg11227734
    GGCCCTCCAGCTCAGCTACTGG[CG]GCTTCTCATGCCGCAGTCGGCGCAGbeta-lipotropin/ alpha-melanocyte s
Y           MSH, POC,Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte s
                        ACTH, CLIP
                                 proopiomelanocortin
                                             cg22632966
    TGGTTCGCATTTGGCGGTAAATATCAC[CG]TCTGCACACGGGGAGGCCTCC
Y           MSH, POC,Homo sapiens proopiomelanocortin (adrenocorticotropin/ beta-lipotropin/ alpha-melanocyte s
                        ACTH, CLIP
                                 proopiomelanocortin
                                             cg00293936
    ACTTGCCGAGCTCTCCTGGTGGGCG[CG]GGACTTTGACCTTCCCGGCAGCAC
Y           FAAR, NUC1, NUCI, NR1C2, NUCII, PPARB, MGC3931,receptor, delta isoform 1
                       Homo sapiens peroxisome proliferative activated receptor, delta (PPARD), transcript variant
                                 peroxisomecg02381942 activated PPAR-beta
                                              proliferative
    GCTAGGTGTGGCCTAAGGAGCTTG[CG]GCCTACGGAAGGTGTGGCC
Y           NR1C3, PPARG1,sapiens peroxisome proliferative activated receptor, gamma
                       Homo PPARG2, HUMPPARG
                                 peroxisomecg11660988 activated receptor gamma isoform 1
                                              proliferative
    CGCAGGTCAGAGTACGGGTGCC[CG]CGGCGCTCGGGAACCGGCTGCTGGCTGGGC(PPARG), transcript varia
Y           NR1C3, PPARG1,sapiens peroxisome proliferative activated receptor, gamma (PPARG), transcript varia
                       Homo PPARG2, HUMPPARG
                                 peroxisomecg27051533 activated receptor gamma
                                              proliferative
    CCCACTTTGGACAGGTCACGATGGACAG[CG]TGGCAGGAAAAGAAAAGGTCACTisoform 1
Y           GPAT, ATASE sapiens phosphoribosyl pyrophosphate amidotransferase
                       Homo      phosphoribosyl pyrophosphate amidotransferase proprotein
                                             cg08412991
    GCCGAAAGCACGTGGAAGGACCTGC[CG]CTGCGGCCAAGGTGTAAGCACCAACC (PPAT), mRNA.
Y           MGC26454Homo sapiens protein phosphatase 2 subunit A,2A), regulatory
                                 beta isoform of regulatory (formerly protein phosphatase 2 isoform b
                                             cg25733613
    AAGACTCAGGCGGACCAAAGAGAGTGCC[CG]AGGCCAGGAGGAAAAAGGCTT subunit A (PR 65), beta isofo
N           RIZ, RIZ1, RIZ2, MTB-ZF, PR domain containing 2, with ZNF domain (PRDM2), transcript variant 3, mR
                       Homo sapiens HUMHOXY1
                                 retinoblastoma protein-binding zinc finger protein isoform c
                                             cg19359071
    AGAAGTGGACTTCAGGTCTGTCCA[CG]TTCCTTTCCACCTTTGGTTTTGTGACTT
Y           CAR, CNC1, PKR1, TSE1,protein kinase,protein kinase, regulatory subunit alpha 1
                       Homo sapiens PRKAR1, MGC17251, DKFZp779L0468
                                 cAMP-dependent cAMP-dependent, regulatory,
                                             cg08932246
    CCGTGCCTGGTTTCCACAGGGA[CG]GTGTTGCCTGCACAGACGACAGCACC type I, alpha (tissue specific exti
Y           SRBC, HSRBC, MGC20400 kinase C, delta binding protein
                       Homo sapiens protein kinase C, delta binding protein
                                 protein     cg03953093
    GCCCAGGCCGCTCTGGATGCGG[CG]CACGGACCCTGCCAGGCCTCC (PRKCDBP), mRNA.
Y           SRBC, HSRBC, MGC20400 kinase C, delta binding protein
                       Homo sapiens protein kinase C, delta binding protein (PRKCDBP), mRNA.
                                 protein     cg21590521
    TGGGCGCAGAGACTGTGTTGGCA[CG]GCAAAGAGATAACCAGAGGGGCCT
Y           BV8, PK2, MIT1 sapiens prokineticin 2 (PROK2), mRNA.
                       Homo      prokineticincg12848837
                                              2
    CAGGCTCCTCATGGCGCCCT[CG]GGACTGGGCGGCCGCCGGAGGCAG
Y           BV8, PK2, MIT1 sapiens prokineticin 2 (PROK2), mRNA.
                       Homo      prokineticincg01645467
                                              2
    CCGGAACCGCTTTTGTGGTCTC[CG]AGACACTCATTTGCTGTCCTGGTTTCCAA
N           AC133, CD133, PROML1, prominin 1 (PROM1), mRNA.
                       Homo sapiens MSTP061
                                 prominin 1 cg05586943
    GGAAGCCTTGGGGAAGGCAAG[CG]TGTTCCTGGGCAGAAGAGGA
N           TRP1, TRY1, TRY4, TRYP1, MGC120175preproprotein (PRSS1), mRNA.
                       Homo sapiens protease, serine, 1 (trypsin 1)
                                 protease, serine, 1
                                             cg16567953
    CTGATCCTTACCTTTGTGGCAGCTGCT[CG]TGAGTATCATGCCCTGCCTCAGGCCC
N           TRP1, TRY1, TRY4, TRYP1, MGC120175preproprotein (PRSS1),
                       Homo sapiens protease, serine, 1 (trypsin 1)
                                 protease, serine, 1
                                             cg09471643
    TAGCCCCCTGGCCAGGTC[CG]ATTTCAACACCAAGTTTCTGAGCTTTT mRNA.
Y           CAP1, PROSTASIN prostasin preproprotein(prostasin) (PRSS8), mRNA.
                       Homo sapiens protease, serine, 8
                                             cg27436259
    GGGAGACGCCTGGAGTATCCGAAG[CG]AGCAGTGTGGACGAGTCACCAGCACCG
N           PRO232 Homo sapiens prostatecg20546389
                                 prostate stem cell cell antigen (PSCA), mRNA.
                                              stem antigen
    TCCTAGGGGGCAGGTAGACAGACTGA[CG]GATGGATGGGCAGAGATGC
N           PRO232 Homo sapiens prostatecg15098809
                                 prostate stem cell cell antigen (PSCA),
                                              stem antigen
    AAGGGAGAGGGAGGTGCAGGT[CG]CTCAGGGAGGAGACTCGGAC mRNA.
Y           p52, p75, PAIP, DFS70, LEDGF, PSIP2,interacting protein 1 isoform 2
                       Homo sapiens PC4 and SFRS1 interacting protein 1 (PSIP1),
                                 PC4 and SFRS1 MGC74712
                                             cg13330618
    ACAGGTGCATGCAGATGGAGAGGAAGA[CG]CAAGCGAAGAAGAAAGGACTGG transcript variant 2, mRNA.
Y           PTC, BCNS, HPE7, PTC1,patchedcg19830282
                       Homo sapiens NBCCS, patched(Drosophila) (PTCH), mRNA.
                                 patched      homolog
    GCAGGCTGCTCGGGCTCGGGCTC[CG]GTTGACAGACCAGCCGCTGCTGCTGCTCA
Y           .          Homo sapiens patchedcg02200417(Drosophila) (PTCH2), mRNA.
                                 patched 2 homolog 2
    CTTGCCTTCAGACATCTAATGACACT[CG]GCACTTCAAGACATCACAAACCTTGC
Y           .          Homo sapiens patchedcg02059556(Drosophila) (PTCH2), mRNA.
                                 patched 2 homolog 2
    CCCAACCCGCGTTATCTGGG[CG]CTCCCATAGGCTAGCCCGGTCTCC
Y           .          Homo sapiens patchedcg04731174(Drosophila) (PTCH2), mRNA.
                                 patched 2 homolog 2
    CGCCGGCCAAGTGTAAGTCCAGAGGCTTA[CG]CTGAGAAAGGGCCTTTGCG
Y           BZS, MHAM, TEP1, MMAC1, PTEN1, MGC11227 homolog (mutated in multiple advanced cancers 1) (
                       Homo sapiens phosphatase and tensin
                                 phosphatase and tensin homolog
                                             cg09214843
    AAAGGAAAGAGCGAATGCAGTCCACGCCG[CG]GAAATCTAGGGGTAGAGGCAAG
Y           COX1, COX3, PHS1, PCOX1, PGHS1, PTGHS, PGG/HS, PGHS-1
                       Homo sapiens prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyc
                                 prostaglandin-endoperoxide synthase 1 isoform 1
                                             cg04028914
    GGCTGGAGCTCCGGGCAGTGTG[CG]AGGCGCACGCACAGGAGCCTGCACTC precursor
Y           COX1, COX3, PHS1, PCOX1, PGHS1, PTGHS, PGG/HS, PGHS-1
                       Homo sapiens prostaglandin-endoperoxide synthase 1
                                 prostaglandin-endoperoxide synthase 1 isoform 1 precursor
                                             cg05658254
    TGGGCAGAGGAAGTAAGCGGGCAGC[CG]AGGTGACAGCTGGAGGGAG (prostaglandin G/H synthase and cyc
Y           COX2, COX-2, PHS-2,prostaglandin-endoperoxide synthase 2 precursor
                       Homo sapiens prostaglandin-endoperoxide synthase 2
                                  PGG/HS, PGHS-2, hCox-2
                                             cg03367301
    CCGCCAGATGTCTTTTCTTCTT[CG]CAGTCTTTGCCCGAGCGCTTCCGA (prostaglandin G/H synthase and cyc
Y           COX2, COX-2, PHS-2,prostaglandin-endoperoxide synthase 2 precursor
                       Homo sapiens prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyc
                                  PGG/HS, PGHS-2, hCox-2
                                             cg03160309
    AAGTCACGTCGGGACAGACTGGGG[CG]AGTAAGGTTAAGAAAGGCTGACATG
N           HHM, PLP, Homo sapiens parathyroid hormone-like hormone (PTHLH),
                        PTHR, PTHRP, MGC14611
                                 parathyroid cg01333011 hormone isoform 2 preproprotein
                                              hormone-like
    CCTCAGTTCATTACTGTAAACCC[CG]TACCTTAAAAGACTCGGCTTCTTCTCACtranscript variant 3, mRNA.
N           HHM, PLP, Homo sapiens parathyroid hormone-like hormone (PTHLH),
                        PTHR, PTHRP, MGC14611
                                 parathyroid cg05045983 hormone isoform 2 preproprotein
                                              hormone-like
    TCCAAAAAGATGCAGGAGCCCTAATGTAAT[CG]TTAGATCTGAAGGGGGAAAT transcript variant 3, mRNA.
N           HHM, PLP, Homo sapiens parathyroid hormone-like hormone (PTHLH),
                        PTHR, PTHRP, MGC14611
                                 parathyroid cg21788470 hormone isoform 2 preproprotein
                                              hormone-like
    CCAAGCTGCCCTGTTTATTACTTTC[CG]TAGAAATTCTCCTCAATATATACCCA transcript variant 3, mRNA.
N           PTHR, MGC138426, MGC138452 cg21954799 receptor 1 (PTHR1), mRNA.
                       Homo sapiens parathyroid hormone
                                 parathyroid hormone receptor 1 precursor
    GGGACTATCCATGGCCTCCC[CG]TGGCCAACTTGAGTCTGCTCTGCAGCTTTA
N           PTHR, MGC138426, MGC138452 cg04041000 receptor 1 (PTHR1), mRNA.
                       Homo sapiens parathyroid hormone
                                 parathyroid hormone receptor 1 precursor
    CAGCCCTGGGCATCTGAACAC[CG]GCACACTTGGATCTGCCTCTGTTGCCTCC
N           PTHR, MGC138426, MGC138452 cg13804333 receptor 1 (PTHR1), mRNA.
                       Homo sapiens parathyroid hormone
                                 parathyroid hormone receptor 1 precursor
    GGCAAGGAGAGGACTATTGAGGCACACACA[CG]TGTCTGGCAGCCTGAGTGGG
Y           FAK, FADK, FAK1, pp125FAK protein tyrosine kinase 2 (PTK2), transcript variant 2, mRNA.
                       Homo sapiens PTK2 cg07723484
                                 PTK2 protein tyrosine kinase 2 isoform b
    ACTGGAGGTAGACAGGTTACCTAAATGAA[CG]CCAGCAGGGAACGAGCCCTGCAATC
Y           PKB, PTK, CAKB,sapiensPYK2, CADTK, FADK2, RAFTK2 beta (PTK2B),
                       Homo FAK2, PTK2B protein tyrosine kinase
                                 PTK2B protein tyrosine kinase 2 beta isoform b
                                             cg17346886
    AAATCGCTGCTCTTACCCGAAAGT[CG]TGGGCAGTGTCCTTCACCGGCTGCAC transcript variant 4, mRNA.
Y           BRK        Homo sapiens PTK6 protein tyrosine kinase 6 (PTK6), mRNA.
                                 PTK6 protein tyrosine kinase 6
                                             cg03004675
    GGCCCAGGTGAGCCTGGTCC[CG]GGACACCATGGCGGGCGGGCGCAGC
Y           CCK4       Homo sapiens PTK7 protein tyrosine kinase 7 (PTK7), transcript
                                 PTK7 protein tyrosine kinase 7 isoform
                                             cg21726633
    GGGGGCACAGAGCTTGGGAAGCG[CG]GGAGTCCCGTGGGCAAAAG a precursor variant PTK7-1, mRNA.
Y           HCP, HCPH, SHP1, SHP-1, HPTP1C, PTP-1C, SHP-1L,non-receptor 6 isoform 2
                       Homo sapiens protein tyrosine phosphatase, SH-PTP1type
                                 protein tyrosine phosphatase, non-receptor
                                             cg00788854
    GAGATGCTGTCCCGTGGGTAAGTCC[CG]GGCACCATCGGGGTCCCAGTCT type 6 (PTPN6), transcript variant
N           HCP, HCPH, SHP1, SHP-1, HPTP1C, PTP-1C, SHP-1L,non-receptor 6 isoform 2
                       Homo sapiens protein tyrosine phosphatase, SH-PTP1type
                                 protein tyrosine phosphatase, non-receptor
                                             cg15975802
    TAGGCCCTTTGGTTTCCGCCTA[CG]GAGAGGTTTCCCCCATTGGTTGCTCT type 6 (PTPN6), transcript variant
Y           BIT, MFR, P84, SIRP, MYD-1, tyrosine phosphatase, non-receptor SIRPalpha, SIRPalpha2, SIRP-ALPH
                       Homo sapiens protein tyrosine phosphatase, non-receptor type substrate 1 (PTPNS1), mRN
                                 protein SHPS1, SIRPA, CD172A, SHPS-1,
                                             cg16332153
    GCCCCTGGCTTTATTTCTCGCG[CG]CTTGGGGTCTCTCCCAGTCTCCGT type substrate 1 precursor
Y           BIT, MFR, P84, SIRP, MYD-1, tyrosine phosphatase, non-receptor type substrate 1 precursor
                       Homo sapiens protein tyrosine phosphatase, non-receptor type substrate 1 (PTPNS1), mRN
                                 protein SHPS1, SIRPA, CD172A, SHPS-1, SIRPalpha, SIRPalpha2, SIRP-ALPH
                                             cg10140880
    GGCCTCTGGGCAGCCCCGG[CG]GCGCTTCCAGTGCCTTCCAGCC
Y           LAR        Homo sapiens protein tyrosine phosphatase, receptor type,
                                 protein tyrosine phosphatase, receptor type, F isoform 1 precursor
                                             cg09322748
    GGAGCAGCGGCCCTAGCGGCTTG[CG]GGGGGACATGCGGACCGACGGCCC F (PTPRF), transcript variant 1, m
Y           PTPG, HPTPG, RPTPG, R-PTP-GAMMA phosphatase,
                       Homo sapiens protein tyrosine
                                 protein tyrosine phosphatase, receptor type, G precursor
                                             cg05362669
    ATGGCCAGTTTCCAGCCC[CG]CGCTCTTCGTTCCTTCCCAGCC receptor type, G (PTPRG), mRNA.
Y           PTPG, HPTPG, RPTPG, R-PTP-GAMMA phosphatase, receptor type, G (PTPRG), mRNA.
                       Homo sapiens protein tyrosine
                                 protein tyrosine phosphatase, receptor type, G precursor
                                             cg25680813
    AACAGGAGCCGCAGACGGTGAGCCTCAC[CG]CTGCAAATGCCAGGGCAGTGAAGCC
N           SAP-1      Homo sapiens protein tyrosine phosphatase, receptor H precursor
                                 protein tyrosine phosphatase, receptor type,
                                             cg09948821
    CAGCACCTACTTCCTCAAGAT[CG]AGGTGCAGGCACCCAGCTCCTTCT type, H (PTPRH), mRNA.
N           SAP-1      Homo sapiens protein tyrosine phosphatase, receptor type, H (PTPRH), mRNA.
                                 protein tyrosine phosphatase, receptor type, H
                                             cg17314748
    TGCACCCCAGGTACCGGGTGC[CG]CGCCCCACTGCTGCACGGATGCGGGAprecursor
Y           PTPU2, GLEPP1, sapiens protein tyrosine phosphatase, receptor type, O
                       Homo PTP-U2receptor-type protein tyrosine phosphatase O isoform b precursor
                                               cg23147819
    GGGACTGGAAAGGCAGCATGCGCT[CG]CCAGGAGCAACCTCGGCGCCCAGG (PTPRO), transcript variant 2,
N           PTPU2, GLEPP1, sapiens protein tyrosine phosphatase, receptor O isoform b precursor
                       Homo PTP-U2receptor-type protein tyrosine phosphatase
                                               cg25816184
    TGAGAGGGAACTGGGATCTGG[CG]CCTGGATTGCTCAAGAGAGGTC type, O (PTPRO), transcript variant 2,
Y           PUR1, PURALPHA, PUR-ALPHA element binding protein A A (PURA),
                       Homo sapiens purine-rich element binding protein
                                  purine-rich cg13473072
    GCCCTGGTGCGTCTACTGTCCTCTGCT[CG]GCTCCCCCCATCGGTGAGTGCG mRNA.
N           PET1, HBII-85
                       Homo sapiens Prader-Willi syndrome chromosome region 1 (PWCR1) on chromosome 15.
                                  .            cg11319956
    GAGAACTCATAACGTCATTCTCAT[CG]GAACTGAGGTCCAGCATGTTGCTTCCTCT
N           PET1, HBII-85
                       Homo sapiens Prader-Willi syndrome chromosome region 1 (PWCR1) on chromosome 15.
                                  .            cg07197644
    GGAGAAGTTGTCATGGGAGGCCAGC[CG]CCTGCTGGCAAGGAAGATGG
N           PET1, HBII-85
                       Homo sapiens Prader-Willi syndrome chromosome region
                                  .            cg19695710
    TTGAGCTGTCCGGTTGCCACAGGGT[CG]GACCTGGAGGCTGCAGACCATC 1 (PWCR1) on chromosome 15.
Y           .          Homo sapiens paxillin (PXN), mRNA.
                                  paxillin     cg16785344
    TCAAAGTCACTTGCCTGACCCTG[CG]GATGACAAATCCGTCCACAGTCAGC
Y           ASC, TMS1, CARD5, MGC10332 cg05898613 containing isoform b
                       Homo sapiens PYD and CARD domain containing
                                  PYD and CARD domain
    CGTTGCCCTCCAGCAAAAGG[CG]CTTCCTTACTACACCCTTGGTCCC(PYCARD), transcript variant 2, mRNA.
Y           ASC, TMS1, CARD5, MGC10332 cg15468095 containing isoform b
                       Homo sapiens PYD and CARD domain containing (PYCARD),
                                  PYD and CARD domain
    TTATTGGAGCACCTAGGCTTAGAACCT[CG]GATTTCTAGAACCCCGAAACCTC transcript variant 2, mRNA.
N           ASC, TMS1, CARD5, MGC10332 cg23185156 containing isoform
                       Homo sapiens PYD and CARD domain containing (PYCARD), transcript variant 2, mRNA.
                                  PYD and CARD domain
    CCAGCATAACATGGCCAACC[CG]ATGGCTCCCGAAACCTTGCCAGATGC b
Y           .          Homo sapiens RAB32,cg21792703 oncogene family (RAB32), mRNA.
                                  RAB32, member RAS oncogene family
                                               member RAS
    AGACCAGCATCATCAAGCGCTA[CG]TCCACCAGCTCTTCTCCCAGC
Y           .          Homo sapiens RAB32,cg01851450 oncogene family (RAB32), mRNA.
                                  RAB32, member RAS oncogene family
                                               member RAS
    AGCCCAGTGTTATCCGTCCTT[CG]TTAAGTTCAAAGTCACGGTGCCACTTC
Y           hRad50, RAD50-2sapiens RAD50 cg05198819 cerevisiae) (RAD50), transcript variant 2, mRNA.
                       Homo       RAD50 homolog isoform 2
                                               homolog (S.
    GAGTCCCAGGATCAAGCTTTGGGAAG[CG]CCATCCGTCACAGGTCTTGGTCTCC
Y           .          Homo sapiens RAD54 cg22204387 cerevisiae) (RAD54B), transcript
                                  RAD54 homolog B isoform 2
                                               homolog B (S.
    GCCTACTTTCAGACACAGTGTAGATGC[CG]AGGCTACAGACCTCACCATCTGCGTGGA variant 2, mRNA.
Y           CRAF, Raf-1, c-Raf v-raf-1 murine leukemia viral oncogene homolog
                       Homo sapiens v-raf-1 murine leukemia viral oncogene homolog
                                               cg02830576
    AGGGCACAGTGTCCAACTTTGACG[CG]TCCTCTCCGGGCACTTTAATACCAA 1 1 (RAF1), mRNA.
Y           TC4, Gsp1,Homo sapiens RAN, member RAS oncogene family (RAN),
                       ARA24      ras-related nuclear protein
                                               cg22909979
    GGGTGCATCCCTCTCTGGTTCCT[CG]CTCTCCAACTGGCCCTGGTCCTGGGGmRNA.
Y           RAP1, KREV1, KREV-1, SMGP21 cg06550436RAS oncogene family (RAP1A),
                       Homo sapiens RAP1A, member of oncogene family
                                  RAP1A, member of RAS
    CCTAACAGGTGCTCAATTAGGGCTTGT[CG]AATGATTGAGTTCCCTCCAAATTCTCT transcript variant 1, mRN
N           RAR, NR1B1 Homo sapiens retinoic cg00848035 alpha (RARA),
                                  retinoic acid receptor, alpha isoform a
                                               acid receptor,
    CCCTTCCCAATTCTTTGGC[CG]CCTTTGACCCCGGCCTCTGCTTCTGA transcript variant 1, mRNA.
N           RAR, NR1B1 Homo sapiens retinoic cg23685453 alpha (RARA),
                                  retinoic acid receptor, alpha isoform
                                               acid receptor,
    CCTCTCCCCTCAAGTCTGT[CG]CTGACTTCCTCTGGCCCTTCCCC a transcript variant 1, mRNA.
N           RAR, NR1B1 Homo sapiens retinoic cg10363722 alpha (RARA),
                                  retinoic acid receptor, alpha isoform a
                                               acid receptor,
    GAACTGTTCCTGTCCCCAGC[CG]ATGACCAGACGCCCATCTTTCTTC transcript variant 1, mRNA.
Y           HAP, RRB2, NR1B2 retinoic acid receptor, beta isoform 2 transcript variant 2, mRNA.
                       Homo sapiens retinoic cg14265392 beta (RARB),
                                               acid receptor,
    GAGGACTGGGATGCCGAGAACG[CG]AGCGATCCGAGCAGGGTTTGTC
Y           HAP, RRB2, NR1B2 retinoic acid receptor, beta isoform 2 transcript variant 2, mRNA.
                       Homo sapiens retinoic cg06720425 beta (RARB),
                                               acid receptor,
    CTAGTTGGGTCATTTGAAGGTTAGCAGCC[CG]GGTAGGGTTCACCGAAAGTTCA
Y           TIG1       Homo sapiens retinoic cg09424996 responder (tazarotene
                                  retinoic acid receptor responder (tazarotene induced) 1 isoform 1
                                               acid receptor
    GCCGCCTGCTGCAGGAGCCTGCG[CG]GGACCCCAGCATCCTGAGGCTGCC induced) 1 (RARRES1), transcrip
Y           TIG1       Homo sapiens retinoic cg13848998 responder
                                  retinoic acid receptor responder (tazarotene induced) 1 isoform 1
                                               acid receptor
    CGGAGAAAGGGGCAGGCCGCAG[CG]GGCATTGATGGGGCTCCT (tazarotene induced) 1 (RARRES1), transcrip
Y           TIG1       Homo sapiens retinoic cg12199224 responder (tazarotene induced) 1 (RARRES1), transcrip
                                  retinoic acid receptor responder (tazarotene
                                               acid receptor
    CCAGGGCGAAGGTCTGTAGCGAGCC[CG]GGTCCCCATGGGGCCACTCC induced) 1 isoform 1
Y           GAP, PKWS, RASA, CMAVM, RASGAP, p120GAP, DKFZp434N071
                       Homo sapiens RAS p21 protein activator (GTPase activating protein) 1 (RASA1), transcript v
                                  RAS p21 protein activator 1 isoform 2
                                               cg07195528
    GCGGGCAGGGTAGGGCAGAGTAGAG[CG]GGCTTCAACATGATGGCGGCC
Y           GNRP, GRF1, CDC25,RasRas protein-specific guanine nucleotide-releasing factor 1 (RASGRF1), trans
                       Homo sapiens protein-specific guanine nucleotide-releasing
                                    GRF55, CDC25L, H-GRF55
                                               cg16752670
    GCGACGTGGCCATCATTCAGC[CG]GATCCCCTTCTGCATGGTGCTCAGAGG factor 1 isoform 1
Y           GNRP, GRF1, CDC25,RasRas protein-specific guanine nucleotide-releasing factor 1 (RASGRF1), trans
                       Homo sapiens protein-specific guanine nucleotide-releasing
                                    GRF55, CDC25L, H-GRF55
                                               cg08522779
    CAGTCCTAGTCTTTGCATAGTCAGC[CG]GGTCACATTGAATTCCAGCATCCGG factor 1 isoform 1
Y           123F2, RDA32, NORE2A, Ras association (RalGDS/AF-6) domain family 1
                       Homo sapiens RASSF1A, REH3P21
                                  Ras association domain family 1 isoform B
                                               cg18804483
    CGACATGGCCCGGTTGGGCC[CG]TGCTTCGCTGGCTTTGGGCGCTAGCAAGCG (RASSF1), transcript variant
Y           123F2, RDA32, NORE2A, Ras association (RalGDS/AF-6) domain family 1 (RASSF1), transcript variant
                       Homo sapiens RASSF1A, REH3P21
                                  Ras association domain family 1 isoform B
                                               cg04540383
    GGCCCTGGCCCTCCTGGTC[CG]GTTTGCTGAAGCAACACACTTGGCCTACC
Y           Rb2, P130 Homo sapiens retinoblastoma-like 2 (p130) (RBL2), mRNA.
                                  retinoblastoma-like 2 (p130)
                                               cg02021817
    ACGTCAGTGTCTTTTGGACATTTTCT[CG]TCAGTACAGCCCTGTTGAATGTTCTCACG
Y           CRBP, RBPC, CRBP1,retinol binding protein 1, cellular
                       Homo sapiens retinol binding protein 1, cellular (RBP1),
                                    CRABP-I cg21141873
    GCGCAGGTACTCCTCGAAATTCT[CG]TTGACCAACATCTTCCAGTACCC mRNA.
Y           CRBP, RBPC, CRBP1,retinol binding protein 1, cellular
                       Homo sapiens retinol binding protein 1, cellular (RBP1),
                                    CRABP-I cg11861701
    GGGTCAGGTTTGTCCAGGCCG[CG]CCACCTTCGTTTCAGACGTTCAGTT mRNA.
Y           CRBP, RBPC, CRBP1,retinol binding protein 1, cellular
                       Homo sapiens retinol binding protein 1, cellular (RBP1), mRNA.
                                    CRABP-I cg11986962
    GAAAGCTGGGAGGTTCAACTACGGG[CG]AGAAAATTGGGGCACTTTCCACG
N           PTC, MTC1, HSCR1, MEN2A, MEN2B, RET51, CDHF12, RET-ELE1
                       Homo sapiens proto-oncogene isoform c
                                  ret ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcin
                                               cg21859545
    CTGAAAGGACGCCGGAGCCAGTTTC[CG]GTTTCCAAGGGTTGGACCAGT
Y           PTC, MTC1, HSCR1, MEN2A, MEN2B, RET51, CDHF12, RET-ELE1
                       Homo sapiens proto-oncogene isoform c
                                  ret ret proto-oncogene (multiple endocrine neoplasia
                                               cg01812049
    GCGGGGTCGCACCCCGAGCCAGT[CG]GCCAGACCTGCATCCCGCGTAGCATCC and medullary thyroid carcin
Y           PTC, MTC1, HSCR1, MEN2A, MEN2B, RET51, CDHF12, RET-ELE1
                       Homo sapiens proto-oncogene isoform c
                                  ret ret proto-oncogene (multiple endocrine neoplasia
                                               cg23241367
    GCTTCAGTCCCGCGACCGAAGCA[GG]GCGCGCAGCAGCGCTGAGTGCCCCGG and medullary thyroid carcin
Y           ARH9, ARHC, RHOH9 ras ras homolog gene family, member
                       Homo sapiens homolog gene family, member C
                                               cg21975783
    TCCTAGGATCGTACAGCCCAA[CG]TCATCCCCCAAACTTGAAGACC C (RHOC), mRNA.
Y           TTF, ARHHHomo sapiens ras homolog gene family, member H (RHOH),
                                  ras homolog gene family, member H
                                               cg26296101
    GTGGGGGATAAATTAAACGCAAACCCAG[CG]GTGCGGCAAAGGCCTTATTCTG mRNA.
N           TTF, ARHHHomo sapiens ras homolog gene family, member H (RHOH), mRNA.
                                  ras homolog gene family, member H
                                               cg08826756
    GGCCTTTGCACATACTATTTGCCTCTA[CG]TGGAATGTTCTTTCCTCCTTCTCATC
N           RIP, FLJ39204 sapiens receptor (TNFRSF)-interacting serine-threonine kinase
                       Homo       receptor (TNFRSF)-interacting serine-threonine kinase 1
                                               cg24303123
    CCCCTGTGTGAGCTACTGCCTGCCTC[CG]GTGCTCTGTTTCTGTCCCTAGAGTTCTTTT 1 (RIPK1), mRNA.
N           RIP, FLJ39204 sapiens receptor (TNFRSF)-interacting serine-threonine
                       Homo       receptor (TNFRSF)-interacting serine-threonine kinase 1
                                               cg24886867
    TTCATCAAAGGGTTGCACATTGAGCAGTGC[CG]TGTTAAGGGGGGATTCTTCA kinase 1 (RIPK1), mRNA.
Y           RICK, RIP2, CARD3, GIG30, CARDIAK serine-threonine kinase 2
                       Homo sapiens receptor-interacting serine-threonine
                                  receptor-interacting
                                               cg11343947
    TGGGCGCCCTCGTGACCTAGTGTTG[CG]GGGCAAAAAGGGTCTTGC kinase 2 (RIPK2), mRNA.
N           RIP3, RIP3 HomoRIP3 receptor-interacting serine-threonine kinase 3 3
                       beta, sapiens receptor-interacting serine-threonine kinase
                                  gamma        cg13583230
    AAAGCTAGTGCCTTTCTCCTTGACTAG[CG]TTTCCTGAGCACCTGCCGCAGCC (RIPK3), mRNA.
N           RIP3, RIP3 HomoRIP3 receptor-interacting serine-threonine kinase 3 3
                       beta, sapiens receptor-interacting serine-threonine kinase
                                  gamma        cg17413439
    TCCGGGTTGTTACCCTTTTTC[CG]AGTTGACTGAACAACTTCCCTTATAGGCGC(RIPK3), mRNA.
Y           DIK, PKK, RIP4, ANKK2, ANKRD3cg11719297serine-threonine kinase 4
                       Homo sapiens receptor-interacting3
                                  ankyrin repeat domain
    AGCCAGGTCTTCCAGTGGACATGG[CG]CACCTTGTACACCTGCCCGAAGCCG (RIPK4), mRNA.
Y           DIK, PKK, RIP4, ANKK2, ANKRD3cg19812226serine-threonine kinase
                       Homo sapiens receptor-interacting3
                                  ankyrin repeat domain
    GCAGAGCTTCTCACGCTTCTCA[CG]GGTCTCGACGTGCGCATCAGCTGCCC 4 (RIPK4), mRNA.
Y           NTRKR1, MGC99659, receptor tyrosine kinase-like orphan receptor 1
                       Homo sapiens receptor tyrosine kinase-like orphan receptor
                                  dJ537F10.1   cg01680459
    GTGACAAGTTGAGCGAGAGAGGGAG[CG]TGGAGAGCTGGAGCAGCCGCCAC 1 (ROR1), mRNA.
Y           BDB, BDB1, NTRKR2 receptor tyrosine kinase-like orphan receptor 2 precursor
                       Homo sapiens receptor tyrosine kinase-like orphan
                                               cg25776538
    CACCCCTTTCTACGATGCGTC[CG]CTCCTCCTTCTCCCTGGCGCTTC receptor 2 (ROR2), mRNA.
Y           BDB, BDB1, NTRKR2 receptor tyrosine kinase-like orphan receptor 2 precursor
                       Homo sapiens receptor tyrosine kinase-like orphan receptor
                                               cg11653203
    GGCGGGTCTGCCCACGCAGGAGAGG[CG]CCCAGAGCGGGTGCCCCCGACT 2 (ROR2), mRNA.
Y           .          Homo sapiens related RAS viral (r-ras) oncogene
                                  related RAS viral (r-ras) oncogene homolog
                                               cg17675106
    TCCGGACACTTAAGGAGGGGGA[CG]GGCCAAAGAAAGGGAGGA homolog (RRAS), mRNA.
N           CDR, ETO,Homo sapiens runt-related ZMYND2, CBFA2T1, MGC2796protein (cyclin MTG8c
                       MTG8, MTG8b, AML1T1, transcription factor 1; translocated
                                  acute myelogenous leukemia 1 translocation 1
                                               cg07538339
    GGATAGCAGAGGTGATGGGAGATAG[CG]TCAAGGCCAGGGGTAGATGCCTC to, 1isoform D-related) (RUNX
Y           CDR, ETO,Homo sapiens runt-related ZMYND2, CBFA2T1, MGC2796 to, (cyclin MTG8c
                        MTG8, MTG8b, AML1T1, transcription factor 1; translocated
                                 acute myelogenous leukemia 1
                                              cg13659823
    CCCTCCTTCCTCCCTGCT[CG]CCTCCCTCCCCTGTTCACGGAtranslocation 1 protein1isoform D-related) (RUNX
N           AML2, CBFA3, PEBP2aC runt-related transcription factor 3 (RUNX3),
                       Homo sapiens
                                 runt-relatedcg21368948 factor 3 isoform 1
                                               transcription
    CGGCAGCCAGGGTGGAGGAGCTC[CG]AAGCTGACAGAGCAGAGTGGGCC transcript variant 1, mRNA.
Y           AML2, CBFA3, PEBP2aC runt-related transcription factor 3 (RUNX3), transcript variant 1, mRNA.
                       Homo sapiens
                                 runt-relatedcg10672665 factor 3 isoform 1
                                               transcription
    CGGCCTTGGCTCATTGGCTGGGCCG[CG]GTCACCTGGGCCGTGATGTCACGGCC
Y           AML2, CBFA3, PEBP2aC runt-related transcription factor 3 (RUNX3), transcript
                       Homo sapiens
                                 runt-relatedcg12607238 factor 3 isoform 1
                                               transcription
    TTTTATTTGTGAGGCTGGCCTCAGCACG[CG]GCCCAAGAAACAGAACTGAAAGCGG variant 1, mRNA.
Y           .          PREDICTED: Homo sapiens RYK receptor-like tyrosine kinase (RYK), mRNA.
                                 similar to RYK receptor-like tyrosine kinase isoform
                                              cg04318393
    AGAAATCATCCTTTATCTTACCAT[CG]GTGATCAACTTTATCGTTTCCGTATCTATT2
N           p6, CGRP, Homo sapiens S100 calcium binding protein A12 (calgranulin C)
                       MRP6, CAAF1, ENRAGE
                                 S100 calcium-binding protein A12
                                              cg15108991
    GAGGTTTATTTGGCCAAAGTTAAGGATG[CG]TGCCCAGAGGTAGGTCTACGTCTT (S100A12), mRNA.
N           CAN19, S100L, MGC111539calcium binding protein A2 A2
                       Homo sapiens S100 calcium binding protein
                                 S100         cg09232826
    CACAGTGGGAAGTGGGAGGTGT[CG]TGGGGACTGGGCATCCTG (S100A2), mRNA.
N           CAN19, S100L, MGC111539calcium binding protein A2 A2 (S100A2),
                       Homo sapiens S100 calcium binding protein
                                 S100         cg21074565
    TCTACACCTTGGCACAGCCAC[CG]AGTGTCCCTTGCTCCCCTCAGTACTT mRNA.
N           42A, 18A2, Homo sapiens P9KA,calcium binding protein A4 (calcium protein, calvasculin, metastasin, m
                        CAPL, MTS1, S100 PEL98
                                 S100 calcium-binding protein A4
                                              cg22502265
    CATACCAACACGTACTATAGCAACAG[CG]TGTGCAAGCCCACATCTCAGAAGCA
N           42A, 18A2, Homo sapiens P9KA,calcium binding protein A4 (calcium
                        CAPL, MTS1, S100 PEL98
                                 S100 calcium-binding protein A4
                                              cg13091627
    CCCGTGGGTAACGGGTAAGCCCTAG[CG]GTTACTAGCAGGGGACTGGAT protein, calvasculin, metastasin, m
N           42A, 18A2, Homo sapiens P9KA,calcium binding protein A4 (calcium protein, calvasculin, metastasin, m
                        CAPL, MTS1, S100 PEL98
                                 S100 calcium-binding protein A4
                                              cg25085776
    GGGGCTCACGGATAGATCTCAGGTT[CG]GAGAGGGTATCAGGAGGG
Y           HIN1, HIN-1, LU105, UGRP2, PnSP-2, MGC87867 member 1 (SCGB3A1), mRNA.
                       Homo sapiens secretoglobin, family 3A,
                                 secretoglobin, family 3A, member 1
                                              cg19421379
    CTCACCGGAGCTGCAGGACAGGGCCA[CG]CAGAGCCCCAGGAGGGCGGCG
Y           HIN1, HIN-1, LU105, UGRP2, PnSP-2, MGC87867 member 1 (SCGB3A1),
                       Homo sapiens secretoglobin, family 3A,
                                 secretoglobin, family 3A, member 1
                                              cg11379125
    GCGCTCCTGAGAAAGCCCTGCCCGCTC[CG]CTCACGGCCGTGCCCTGGCCAA mRNA.
N           SemD, SEMA1, SEMAD, SEMAL, cg16346212
                       Homo sapiens sema domain, Hsema-I, SEMAIII, sema(Ig), short basic
                                 semaphorincoll-1, immunoglobulin domain III
                                               3A
    CCTTTTATCTAAGCTCCTCTGATAGC[CG]GTGGCAGTCTCTAATCCTGCTCCCTGCTTC domain, secreted, (se
N           SemD, SEMA1, SEMAD, SEMAL, cg00927350
                       Homo sapiens sema domain, Hsema-I, SEMAIII, sema(Ig), short basic
                                 semaphorincoll-1, immunoglobulin domain III
                                               3A
    GAGATTAGAGCCGGGAGCAGAACCCTCAGG[CG]TGCCTGTGAAAGGCATGTAGCTATAAdomain, secreted, (se
N           SemA, SEMA5, SEMAA, semaV,domain, immunoglobulin domain
                       Homo sapiens sema LUCA-1, FLJ34863
                                 semaphorincg25047248 1 precursor
                                               3B isoform
    GAGAGATGCTGCTGCGGAAGTCCT[CG]GTGGAGTGTGAGAAGGCAGC (Ig), short basic domain, secreted, (se
N           SemA, SEMA5, SEMAA, semaV,domain, immunoglobulin domain
                       Homo sapiens sema LUCA-1, FLJ34863
                                 semaphorincg12999941 1 precursor
                                               3B isoform
    CTTGTGCCCATTCCACTCC[CG]CCTGGCTGCCGTCTCCAGCTGGTCCC (Ig), short basic domain, secreted, (se
Y           SemE, SEMAE sapiens sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (se
                       Homo      semaphorincg08098035
                                               3C
    CGCGGCTGGCCAGACGCAAGAATGCG[CG]GCCGCAGGCTGGAGCCCTAGCT
N           SemE, SEMAE sapiens sema domain, immunoglobulin domain (Ig),
                       Homo      semaphorincg03445665
                                               3C
    CAGTAATTCTGTTGACCCCTCCA[CG]TTGACTCATATCCAGTACGTTGTCCCCshort basic domain, secreted, (se
Y           SEMA4, SEMAK, SEMA-IV, sema cg19734524
                       Homo sapiens sema domain, immunoglobulin domain (Ig),
                                 semaphorinIV  3F
    GGATTCTTACCTGTCCTGGAGGCC[CG]GACCCCTTACCTACGGGGCGGCGT short basic domain, secreted, (se
Y           SEMA4, SEMAK, SEMA-IV, sema cg22805248
                       Homo sapiens sema domain, immunoglobulin domain (Ig),
                                 semaphorinIV  3F
    AGCGCAGGCTCGTTGCTCCCTGG[CG]CTGCAGCCCTTCTCGCCAGGGAGT short basic domain, secreted, (se
Y           H5, CDCREL, PNUTL1, CDCREL1, CDCREL-1, HCDCREL-1 2, mRNA.
                       Homo sapiens septin 5cg11788728
                                 septin 5 isoform 2
                                               (SEPT5), transcript variant
    GTCTGCTCGCAGAGCAGGTCTGCGCAGCAC[CG]AGCGGTCAGCAGGGGCAATGCT
Y           H5, CDCREL, PNUTL1, CDCREL1, CDCREL-1, HCDCREL-1 2, mRNA.
                       Homo sapiens septin 5cg01250674
                                 septin 5 isoform 2
                                               (SEPT5), transcript variant
    CCTACAGCCTGCCAGGTGCGTCTGCT[CG]CAGAGCAGGTCTGCGCAGCACCGAGC
Y           MSF, MSF1, SINT1, PNUTL4, AF17q25, KIAA0991
                       Homo sapiens septin 9cg11617283
                                 septin 9      (SEPT9), mRNA.
    GGGGCCAGCCCAGGACAGAGGAAGG[CG]AGGCAGGCACGCAGGAACTGG
Y           MSF, MSF1, SINT1, PNUTL4, AF17q25, KIAA0991
                       Homo sapiens septin 9cg05428394
                                 septin 9      (SEPT9), mRNA.
    CCGGTGGTCTGCCGGACTCCT[CG]GGGCCCACTTCGGGCCCTCTCT
N           PCI, PAI3, PROCI, PLANH3 (or cysteine) proteinaseclade A (alpha-1 antiproteinase, antitrypsin), memb
                       Homo sapiens serpin peptidase inhibitor, inhibitor, clade
                                 serine       cg08764227
    CCCAGGGCTTGAGGGCATGTGAGG[CG]AGGAGAGGATGGACTCTAGAG A (alpha-1 antiproteinase, antitryps
N           PCI, PAI3, PROCI, PLANH3 (or cysteine) proteinaseclade A (alpha-1 antiproteinase, antitrypsin), memb
                       Homo sapiens serpin peptidase inhibitor, inhibitor, clade
                                 serine       cg13984563
    GCGTCTGCAGGCAGGCCTGCTGGC[CG]GAAACCTGCCAGGAAAGGAAG A (alpha-1 antiproteinase, antitryps
N           PAI, PAI2, PAI-2, PLANH2, HsT1201
                       Homo sapiens serpin cysteine) proteinaseclade B (ovalbumin), member 2member 2
                                 serine (or peptidase inhibitor, inhibitor, clade B (ovalbumin), (SERPINB2), mRN
                                              cg15747712
    AGAGCACTAAGGACAAAGGGGCACTTAACA[CG]TGTAAAAGGGCAATGGCTCCTAA
Y           PI5, maspinHomo sapiens serpin cysteine) proteinaseclade B (ovalbumin), member 5 (SERPINB5), mRN
                                 serine (or peptidase inhibitor, inhibitor, clade B
                                              cg22362057
    CGCTGCTTCTGCCCAGACACGGT[CG]CCTCCACATCCAGGTCTTTGTGCTCC (ovalbumin), member 5
Y           PAI, PAI1, PAI-1, PLANH1serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type
                       Homo sapiens
                                 plasminogen activator inhibitor-1
                                              cg10678915
    CGCTATTCCTCTATTTTCTTTTCCT[CG]GACCTGCAGCCTTGGGTCGACCCTGC
N           PAI, PAI1, PAI-1, PLANH1serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type
                       Homo sapiens
                                 plasminogen activator inhibitor-1
                                              cg19722814
    GACAGCCCTGGGGGAAAACTTCCA[CG]TTTTGATGGAGGTTATCTTTG
Y           .          Homo sapiens seizure cg20207331 (mouse)-like precursor
                                 seizure related 6 homolog
                                              related 6 homolog (mouse)-like (SEZ6L), mRNA.
    GCTCCCAGGACGCAAGGGGAATTGG[CG]TTAAACTTTGCAGGGCCGACGG
Y           .          Homo sapiens seizure cg09131631 (mouse)-like precursor
                                 seizure related 6 homolog
                                              related 6 homolog (mouse)-like (SEZ6L), mRNA.
    TGGCCAGGCAGAGCTGCTGGGAG[CG]TCAGCAGGGAGAGAAAACGCTCG
Y           .          Homo sapiens stratifin cg08545357
                                 stratifin    (SFN), mRNA.
    GATCCAGAAGGCCAAGCTGGCAGAGCAGGC[CG]AACGCTATGAGGACATGGCAGCCTT
N           .          Homo sapiens stratifin cg10270832
                                 stratifin    (SFN), mRNA.
    GATGTGGGCAGCCATGTGATGCCAGCCC[CG]AACAAGAGGGGGCAGCCTGG
Y           FRP, FRP1, FrzA,sapiens SARP2 cg27086426 protein 1 1 (SFRP1), mRNA.
                       Homo FRP-1, secreted frizzled-related protein
                                 secreted frizzled-related
    TGTCCGACTGGAAGCTCACGTAGTCGTACT[CG]CTGGCCGAGCCCACGGCCAGAAG
Y           FRP, FRP1, FrzA,sapiens SARP2 cg15881237 protein 1 1 (SFRP1),
                       Homo FRP-1, secreted frizzled-related protein
                                 secreted frizzled-related
    GCGGGTTCGGTTTACTAGAACCAGA[CG]CGGCTCAACACCCCTTAAAAAACA mRNA.
N           PSAP, PSPA, SP-A, SFTP1, SP-A1, COLEC4
                       Homo sapiens surfactant, pulmonary-associated protein
                                 surfactant, pulmonary-associated protein A1
                                              cg17981088
    GGGGCCAGGCTGCGGGCCC[CG]TTCATCTTTTTTCATTCTCAGGTCGC A1 (SFTPA1), mRNA.
N           PSAP, PSPA, SP-A, SFTP1, SP-A1, COLEC4
                       Homo sapiens surfactant, pulmonary-associated protein
                                 surfactant, pulmonary-associated protein A1
                                              cg27452691
    TGGGGCTCATGGCTGAGCCAGGT[CG]CAGGACAGACAAGTTGGCCTGGA A1 (SFTPA1), mRNA.
N           SP-B, PSP-B, SFTB3, SFTP3
                       Homo sapiens surfactant, pulmonary-associated protein B
                                 surfactant, pulmonary-associated protein B
                                              cg26394380
    GGTAGGGGCTGGGGCATAGCTG[CG]ATGGTTCAGCAGAAAGAAACTGTCC (SFTPB), transcript variant 1, mR
N           SP-C, PSP-C, SFTP2 surfactant, pulmonary-associated protein
                       Homo sapiens surfactant, pulmonary-associated protein
                                              cg11540705
    CTCACAGGGGGCTTATCTGGGCTT[CG]GTTCTGGAGGGCCAGGAACA C C (SFTPC), mRNA.
N           SP-D, PSP-D, SFTP4, pulmonary surfactant-associated protein
                       Homo sapiens surfactant, pulmonary-associated protein D (SFTPD), mRNA.
                                  COLEC7 cg21099739
    CCTGTGCTCCCCACCTCCTG[CG]CCCATGCCTCCTAGACCAGAACA D precursor
Y           ESG, DYT11 Homo sapiens sarcoglycan, epsilon (SGCE), mRNA.
                                 sarcoglycan, epsilon
                                              cg23616761
    CTGTCAGCAAGAATGTGCCAGTGGTCG[CG]GGGCTCATCCTGCGTGTCCCCCG
Y           ESG, DYT11 Homo sapiens sarcoglycan, epsilon (SGCE), mRNA.
                                 sarcoglycan, epsilon
                                              cg26050163
    GGTGTGTGTCGAAGAAACCTGACTG[CG]CCCTGAGGAGAACAGCGGAGAA
N           CRBM, CRPM, RES4-23 SH3-domain binding protein 2 (SH3BP2),
                       Homo sapiens
                                 SH3-domain binding protein 2
                                              cg02314872
    GGGTCCAGCCGGGTGACCCAGGC[CG]AGGCCGGCAGAAGACAGCCTGATmRNA.
Y           CRBM, CRPM, RES4-23 SH3-domain binding protein 2 (SH3BP2),
                       Homo sapiens
                                 SH3-domain binding protein 2
                                              cg10745272
    AGATGTGGGCCTCCTGTCCCAAG[CG]CCCACCAACCTCCTTGCAGCGTG mRNA.
Y           RP11-3J10.8Homo sapiens Src homology 2 domain containing adaptor
                                 SHB (Src homology 2 domain containing) adaptor protein B
                                              cg16093627
    TGAGGAGGGAGAGTGGATTAACA[CG]GAACCTGTCTAGTTTACAGCGTGGC protein B (SHB), mRNA.
Y           RP11-3J10.8Homo sapiens Src homology 2 domain containing adaptor
                                 SHB (Src homology 2 domain containing) adaptor protein B
                                              cg19574087
    GGTGGGAGCCGGGCCCAGCACCAATC[CG]AGAGCAAGGCTAGGGGAGGTCprotein B (SHB), mRNA.
Y           HHG1, HLP3, HPE3, SMMCIhedgehog preproprotein
                       Homo sapiens sonic hedgehog homolog (Drosophila)
                                 sonic        cg02023134
    GATCTTCCCTTCATACCTTC[CG]CTGGCGCCTAGGGTCTTCTCGGCCAC(SHH), mRNA.
Y           HHG1, HLP3, HPE3, SMMCIhedgehog preproprotein
                       Homo sapiens sonic hedgehog homolog (Drosophila) (SHH), mRNA.
                                 sonic        cg06981396
    ATGGCAGGCTGCCGGCCGCTGATAA[CG]GAACACATCGGAGTTGGGTCG
Y           KIAA0700 Homo sapiens SIN3 homologtranscription regulator
                                 SIN3 homolog B, B, transcription regulator (yeast) (SIN3B), mRNA.
                                              cg17697680
    CCACGCAAGGCCCTATATTAGGG[CG]CTGGGGGCTCATACCTCATCGTCCC
Y           KIAA0700 Homo sapiens SIN3 homologtranscription regulator
                                 SIN3 homolog B, B, transcription regulator
                                              cg22629500
    CTAAACTGGTCCAGATGGGAAGTGA[CG]GGGCCAAGGATAGGGAAGT (yeast) (SIN3B), mRNA.
Y           SKV         Homo sapiens v-ski sarcoma viral oncogene homolog (avian) (SKI), mRNA.
                                  v-ski sarcoma viral oncogene homolog
                                               cg11377900
    CCGCAGATTCTCAACTCGGTGCTG[CG]CGACTTCTCGCTGCAGCAGATCAACGC
N           JK, UT1, UTE, HUT11,RACH1 UT-B1, family 14 (urea transporter), member
                        Homo sapiens solute carrier HsT1341
                                   RACH1, cg26803305
    TCCTGGAAGCTCAAAGGCATGCCTTTATT[CG]TGATTTCTGAAGCAAGGTGCATGC 1 (Kidd blood group) (SLC
N           JK, UT1, UTE, HUT11,RACH1 UT-B1, family 14 (urea transporter), member 1 (Kidd blood group) (SLC
                        Homo sapiens solute carrier HsT1341
                                   RACH1, cg00377772
    CCAGGAGCAGTCGCTTAGCTTC[CG]AGTCCACACAGCAGCAACCTGCC
N           HET, ITM, BWR1A, IMPT1, TSSC5, ORCTL2, 22 (organic candidate 5 p45-BWR1A, DKFZp667A184
                        Homo sapiens solute carrier family BWSCR1A,cation transporter), member 18 (SLC22A18),
                                  tumor suppressing subtransferable SLC22A1L,
                                               cg25427871
    GTCAGCCTGGATCCTCTCATC[CG]GCAGAACTGTCGCCTTGCTTCTCTGAAGCG
N           HET, ITM, BWR1A, IMPT1, TSSC5, ORCTL2, 22 (organic candidate 5 p45-BWR1A, DKFZp667A184
                        Homo sapiens solute carrier family BWSCR1A,cation
                                  tumor suppressing subtransferable SLC22A1L,
                                               cg11213910
    TCTCTAGACTCACTTTCTGCCC[CG]TCACCCCACTGTACACCCTTGGTC transporter), member 18 (SLC22A18),
Y           OCT2, MGC32628
                        Homo sapiens solute carrier familymember 2 isoform b
                                  solute carrier family 22 22 (organic cation transporter), member 2 (SLC22A2), tra
                                               cg11769038
    CCAGGAAGACGATGCCCACGTAGATGGG[CG]CGAAGGTAGCCGAGAGCAGAGCCAAG
Y           OCT2, MGC32628
                        Homo sapiens solute carrier familymember 2 isoform b
                                  solute carrier family 22 22 (organic cation transporter), member 2 (SLC22A2), tra
                                               cg21755969
    ATTATAACTGGTTCTCCACAGGCTTGT[CG]GTGCTCCACGCCAGCAGCACAAA
Y           EMT, EMTH, OCT3 solute carrier family 22 member 3
                        Homo sapiens solute carrier family 22 (extraneuronal monoamine
                                               cg01037838
    CTGCTGTGCCTGACGGGCGTCACCTT[CG]CCTTCCTCTTCGTCGGCGTGGTCTTC transporter), member 3 (S
Y           EMT, EMTH, OCT3 solute carrier family 22 member 3
                        Homo sapiens solute carrier family 22 (extraneuronal monoamine transporter), member 3 (S
                                               cg23001073
    CACATGGGCGCAGGAGGCCTCCGCACG[CG]CAAGGGCCAAGGGCTGGAG
Y           EMT, EMTH, OCT3 solute carrier family 22 member 3
                        Homo sapiens solute carrier family 22 (extraneuronal
                                               cg13523841
    TGTAGCTCTCGATGGGTCGAGGG[CG]ATGGCCAGCGCTGTGCTGGG monoamine transporter), member 3 (S
Y           NIS         Homo sapiens solute carrier family 5 (sodium iodide symporter), member 5 (SLC5A5), mRN
                                  solute carrier family 5 (sodium iodide symporter), member 5
                                               cg04997686
    GGACAGACAGCCGGCTGCATGGGACAG[CG]GAACCCAGAGTGAGAGGGG
Y           AIT, MGC125354 sapiens solute carrier family 5 (iodide transporter), member 8 (SLC5A8), mRNA.
                        Homo      solute carrier family 5 (iodide transporter), member 8
                                               cg05722918
    ACTGGAGTGGCCGAGTTCGCCAAGG[CG]CCGGGGACACCTGAGCAGATGA
Y           AIT, MGC125354 sapiens solute carrier family 5 (iodide transporter), member
                        Homo      solute carrier family 5 (iodide transporter), member 8
                                               cg13433302
    TGGGCAGGTTTTGTTCAAGTGGTACC[CG]AGGGGACGCACCATTTAAATAAGCAGG 8 (SLC5A8), mRNA.
Y           CT1, CRTR, MGC87396 solute carrier family 6 (neurotransmitter transporter, creatine), member
                        Homo sapiens
                                  solute carrier family 6 (neurotransmitter
                                               cg19792609
    GTAGCAACCATCCTGCCTCC[CG]CTGGAGCGGCGTCTCCTCCCCG transporter, creatine), member 8 8 (SL
Y           CT1, CRTR, MGC87396 solute carrier family 6 (neurotransmitter
                        Homo sapiens
                                  solute carrier family 6 (neurotransmitter transporter, creatine), member 8
                                               cg15489755
    GAGAGCTCAAGGAAGGAGGGAGCAC[CG]GGAGGAGACGGCTGCAGCC transporter, creatine), member 8 (SL
Y           CT1, CRTR, MGC87396 solute carrier family 6 (neurotransmitter transporter, creatine), member
                        Homo sapiens
                                  solute carrier family 6 (neurotransmitter transporter,
                                               cg23643753
    GCCGAGAACGGCATCTATAGCGTGTCCGG[CG]ACGAGAAGAAGGGCCCCCTC creatine), member 8 8 (SL
Y           SLIL3, Slit-2
                        Homo sapiens homolog 2 2 (Drosophila) (SLIT2), mRNA.
                                  slit slit homolog
                                               cg26860620
    CACTCTGGGTTGCTAGCCCCGC[CG]GGCACTGGGCCTCAGACACTGCGCGGTT
Y           SLIL3, Slit-2
                        Homo sapiens homolog 2 2 (Drosophila) (SLIT2), mRNA.
                                  slit slit homolog
                                               cg13875122
    CCACTGGCATCGGATTTGCAGAAGCGTG[CG]TGGGATCAGAGGACCGCCCTC
Y           JV18, MADH2, MADR2, JV18-1, hMAD-2, hSMAD2, MGC22139, 2 (Drosophila) (SMAD2), transcript va
                        Homo sapiens SMAD,Mad-related protein 2 homolog MGC34440
                                  Sma- and mothers against DPP
                                               cg15729966
    GCGCCTGAGAGAGAAAAGGGGTT[CG]GGAGAAGCCCGAGGACCCG
Y           JV18, MADH2, MADR2, JV18-1, hMAD-2, hSMAD2, MGC22139, 2
                        Homo sapiens SMAD,Mad-related protein 2 homolog MGC34440
                                  Sma- and mothers against DPP
                                               cg02100834
    GGGTCTTTGGAGAGCACTTAGGGCC[CG]GGTAGGGGATGCCAGGTATAA (Drosophila) (SMAD2), transcript va
Y           JIP, DPC4, Homo sapiens SMAD, mothers against DPP homolog 4
                         MADH4 MAD, mothers against decapentaplegic homolog 4
                                               cg18894340
    CGCCAGCGTCTGTTTCTTCC[CG]AAGTGAACTCCTACAACCTAGCCACCT (Drosophila) (SMAD4), mRNA.
Y           HLTF, ZBU1, HLTF1, RNF80, HIP116, SNF2L3, HIP116A actin-dependent regulator of chromatin a3
                        Homo sapiens SWI/SNF related, matrix associated, actin
                                  SWI/SNF-related matrix-associated
                                               cg27077285
    GAGTCCAGTCAGACGTCGA[CG]CCGTCTCCTTCTGCAACAATCTGGGAG dependent regulator of chromatin,
Y           HLTF, ZBU1, HLTF1, RNF80, HIP116, SNF2L3, HIP116A actin-dependent regulator of chromatin a3
                        Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin,
                                  SWI/SNF-related matrix-associated
                                               cg02333465
    AGCACAGAAGGGAGGGCAACTCCGCCC[CG]CTGCCATTCAAAGACGGCGGG
Y           HLTF, ZBU1, HLTF1, RNF80, HIP116, SNF2L3, HIP116A actin-dependent
                        Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin,
                                  SWI/SNF-related matrix-associated
                                               cg01427078
    CTTCTGCAACAATCTGGGAGACCAGCGT[CG]CTCTGTGACTGGCACTAGGAAAG regulator of chromatin a3
Y           BRG1, BAF190, SNF2L4, SNF2LB, hSNF2b,matrix associated, actin dependent regulator of chromatin,
                        Homo sapiens SWI/SNF related, SNF2-BETA actin-dependent regulator of chromatin a4
                                  SWI/SNF-related matrix-associated
                                               cg08405378
    CGGTCTTGGTCCAGGCGGCC[CG]TCCTACGGTCCAGGGTTCCTATTTC
Y           RDT, INI1, SNF5, sapiens SWI/SNF related, matrix associated, dependent regulator of chromatin, sub
                        Homo Snr1, BAF47, Sfh1p, hSNFS, associated, actin
                                  SWI/SNF related, matrix SNF5L1
                                               cg10525168
    CCTCCTTCAGGCCTCACTT[CG]TTGCTTTTCCCCTGGGCTCAGTTCC actin dependent regulator of chromatin,
Y           Gx, SMOH Homo sapiens smoothened homolog (Drosophila) (SMO),
                                  smoothened   cg13659980
    TTGGGGAGTCGTGCATCCCGTTC[CG]GGCCTCCGCAGCCCAACATGGGC mRNA.
Y           Gx, SMOH Homo sapiens smoothened homolog (Drosophila)
                                  smoothened   cg23925992
    CCGAGTCTCTCCTTGCAGGTC[CG]GCCCACGATTTCCACTCATCTC (SMO), mRNA.
N           SR, BCSG1   Homo sapiens synuclein, gamma (breast cancer-specific protein
                                  synuclein, gamma (breast cancer-specific protein
                                               cg26738310
    GGAAAAGACCAAGCAGGGGGTGA[CG]GAAGCAGCTGAGAAGACCAAGGAG 1) 1) (SNCG), mRNA.
Y           SR, BCSG1   Homo sapiens synuclein, gamma (breast cancer-specific protein 1)
                                  synuclein, gamma (breast cancer-specific protein 1)
                                               cg12027410
    CGTCAATAGGAGGCATCGGGGACAGC[CG]CTGCGGCAGCACTCGAGCCAGCTCAAG(SNCG), mRNA.
Y           SR, BCSG1   Homo sapiens synuclein, gamma (breast cancer-specific protein
                                  synuclein, gamma (breast cancer-specific protein 1)
                                               cg03677069
    GCTGGCTGGGCTCCAGCTGGCCTC[CG]CATCAATATTTCATCGGCGTCAATAGGA 1) (SNCG), mRNA.
N           SMN, SM-D, RT-LI, HCERN3, SNRNP-N, SNURF-SNRPNpolypeptide N (SNRPN),
                        Homo sapiens small nuclear ribonucleoprotein
                                  small nuclear ribonucleoprotein polypeptide N
                                               cg18859420
    GCTGCAGACCACGCCCACCAAGGGCTGGC[CG]CAGCCACTGTAGCTGAGCTCAGAGCCTtranscript variant 3,
N           SMN, SM-D, RT-LI, HCERN3, SNRNP-N, SNURF-SNRPNpolypeptide N
                        Homo sapiens small nuclear ribonucleoprotein
                                  small nuclear ribonucleoprotein polypeptide N
                                               cg22491305
    TCTCTTGAATCTTGACAATCCC[CG]AACACTGCTCCCCGCTTTATTTGTTTAGTC(SNRPN), transcript variant 3,
Y           SMN, SM-D, RT-LI, HCERN3, SNRNP-N, SNURF-SNRPNpolypeptide
                        Homo sapiens small nuclear ribonucleoprotein
                                  small nuclear ribonucleoprotein polypeptide N
                                               cg05182424
    GTGTGCGAAGCCTGCCGCTGCTGCAG[CG]AGTCTGGCGCAGAGTGGAGCG N (SNRPN), transcript variant 3,
Y           SMN, SM-D, RT-LI, HCERN3, SNRNP-N, SNURF-SNRPNpolypeptide N (SNRPN), transcript variant 3,
                        Homo sapiens small nuclear ribonucleoprotein
                                  small nuclear ribonucleoprotein polypeptide N
                                               cg10146073
    CGCATCTGTCTGAGGAGCGGTCAGTGA[CG]CGATGGAGCGGGCAAGGTCAGCTGTGCCGG
Y           .           Homo sapiens SNRPNcg07995992 frame protein
                                  SNRPN upstream reading
                                                upstream reading frame (SNURF), transcript variant 1, mRNA.
    AGGCTTGCTGTTGTGCCGTTCTGCCC[CG]ATGGTATCCTGTCCGCTCGCATTGGGGCG
Y           .           Homo sapiens SNRPNcg17916021 frame protein
                                  SNRPN upstream reading
                                                upstream reading frame (SNURF), transcript variant 1, mRNA.
    AGCCTGCCGCTGCTGCAGCGAGTCTGG[CG]CAGAGTGGAGCGGCCGCCGGAGATGCC
Y           .           Homo sapiens SNRPNcg15999943 frame protein
                                  SNRPN upstream reading
                                                upstream reading frame (SNURF), transcript variant 1, mRNA.
    CCTGCACTGCGGCAAACAAGCACGCCTGCG[CG]GCCGCAGAGGCAGGCTGGCG
N           EC-SOD Homo sapiens superoxide dismutase 3, extracellular (SOD3), mRNA.
                                  superoxide cg10307548 extracellular
                                               dismutase 3,
    CTCTGAAAACTCATTAGTTGAGGATAACTA[CG]CCTACCAACAGAATGCAGAGGTGCAAG
N           EC-SOD Homo sapiens superoxide dismutase 3, extracellular (SOD3), mRNA.
                                  superoxide cg16986592 extracellular
                                               dismutase 3,
    TAGCACAAGTCCTAGAATACCAGAA[CG]GAGACGTGCTTTCTTGGACCTTAAACGAAA
Y           .           Homo sapiens SRY (sex determining region Y)-box 1 (SOX1), mRNA.
                                  SRY (sex determining region Y)-box 1
                                               cg14311093
    CACGACGATCCTTTCTTAGTCTT[CG]CTTTTCAACCCAATCGTTAATCATT
Y           .           Homo sapiens SRY (sex determining region Y)-box 1 (SOX1),
                                  SRY (sex determining region Y)-box 1
                                               cg23071766
    GGGCCGGGCCCAGCGCACCGCTCC[CG]GCCCCAAAAGCGGAGCTGCAACTT mRNA.
Y           FLJ22252 Homo sapiens SRY (sex determining region Y)-box 17 (SOX17), mRNA.
                                  SRY-box 17   cg19346665
    TTCATCTAAACGACCTTGGGCAAGTA[CG]TCGATTCCAAGGTACAATCAGCCC
Y           FLJ22252 Homo sapiens SRY (sex determining region Y)-box 17 (SOX17),
                                  SRY-box 17   cg09626193
    GAATGGACGCTCGGTATGTTCATCTAAA[CG]ACCTTGGGCAAGTACGTCGATTC mRNA.
Y           ANOP3, MGC2413
                        Homo sapiens SRY (sex determining region Y)-box 2 (SOX2),
                                  sex-determining region Y-box 2
                                               cg18036037
    AAGGTAAGAGAGGAGAGCGGAAGAG[CG]CAGTACGGGAGCGGCACCAGAGG mRNA.
Y           ON          Homo sapiens secreted protein, acidic, cysteine-rich (osteonectin) (SPARC), mRNA.
                                  secreted protein, acidic, cysteine-rich (osteonectin)
                                               cg03769306
    GGCAGGCGGCAGGCAGAGCGCGCTCTC[CG]GGCAGTCTGAAGGACCGCG
N           ON          Homo sapiens secreted protein, acidic, cysteine-rich (osteonectin) (SPARC), mRNA.
                                  secreted protein, acidic, cysteine-rich (osteonectin)
                                               cg01524697
    ACCCTGCCTGCCTCATCTGTTC[CG]GGGCTGCTGCCTAAACCGACTCACAGAG
N           PDEF, bA375E1.3, RP11-375E1__A.3 domain containing ets transcription factor (SPDEF), mRNA.
                        Homo sapiens SAM pointed
                                  SAM pointed domain containing ets transcription
                                               cg09567776
    CCCAGCCCAGGGCTGCCTGCTGGCAC[CG]TGGCAAGGCCCAACCTGAGGG factor
N           PDEF, bA375E1.3, RP11-375E1__A.3 domain containing ets transcription factor (SPDEF), mRNA.
                        Homo sapiens SAM pointed
                                  SAM pointed domain containing ets transcription
                                               cg10159596
    TGTGCTGGGAGGAAGTCAGACAGCCG[CG]AGATGAAGAGTTGGCCAGGGC factor
Y           OF, PU.1, SFPI1, sapiens spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1),
                        Homo SPI-Aspleen focus forming virus (SFFV) proviral
                                               cg07675031
    GGGAAACCCTTCCATTTTGCA[CG]CCTGTAACATCCAGCCGGGCTCCGAintegration oncogene spi1
N           OF, PU.1, SFPI1, sapiens spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1),
                        Homo SPI-Aspleen focus forming virus (SFFV) proviral
                                               cg03565868
    GTCCCCTTGGGGTGACATCAC[CG]CCCCAACCCGTTTGCATAAATCTC integration oncogene spi1
N           OF, PU.1, SFPI1, sapiens spleen focus forming virus (SFFV) proviral
                        Homo SPI-Aspleen focus forming virus (SFFV) proviral integration oncogene spi1
                                               cg04692506
    CATCTATATGTCCATTAATCAGCC[CG]TCCACCTGCTATCAGTCCATCAGTC integration oncogene spi1 (SPI1),
N           OPN, BNSP, BSPI, ETA-1,secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphoc
                        Homo sapiens MGC110940
                                  secreted phosphoprotein 1
                                                cg20261167
    AGTTGCAGCCTTCTCAGCCAAA[CG]CCGACCAAGGTACAGCTTCAGTTTGCTACT
N           OPN, BNSP, BSPI, ETA-1,secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphoc
                        Homo sapiens MGC110940
                                  secreted phosphoprotein 1
                                                cg24861509
    GGGAACAAGGATAGGTAGGCTGGG[CG]ATTTGCCCAAGGTTGCACAGGTCAGCA
N           ASV, SRC1, c-SRC, p60-Src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) (SRC),
                        Homo sapiens v-src cg05935845
                                  proto-oncogene tyrosine-protein kinase SRC
    CCTCTAGCCTCAGTTTATCAC[CG]CAAGAGCTACCATTCATCTAGCACAACC
N           ASV, SRC1, c-SRC, p60-Src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) (SRC),
                        Homo sapiens v-src cg13052876
                                  proto-oncogene tyrosine-protein kinase SRC
    TTCTTGCAAGTAGGTAAGGGCCAGCTCCAG[CG]TGTCACTGGGTAAATGTCCCTG
N           ASV, SRC1, c-SRC, p60-Src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) (SRC),
                        Homo sapiens v-src cg12815018
                                  proto-oncogene tyrosine-protein kinase SRC
    GAAGAAAAAAGAGGCTTGATTGGTAG[CG]TATTCCGATGTCCAAGGGGTAAATAC
Y           CD75, SIAT1, ST6GalI, MGC48859, ST6Gal I
                        Homo sapiens ST6 beta-galactosamide alpha-2,6-sialyltranferase 1 (ST6GAL1), transcript v
                                  sialyltransferase 1 isoform a
                                                cg23385525
    CTCCAGTCCCTTCCACTGTG[CG]TCTTCTGTCCCCCGTTCTTCC
Y           CD75, SIAT1, ST6GalI, MGC48859, ST6Gal I
                        Homo sapiens ST6 beta-galactosamide alpha-2,6-sialyltranferase 1 (ST6GAL1), transcript v
                                  sialyltransferase 1 isoform a
                                                cg27158598
    GCCGGTAGCAGAGACCGGGTGTACAGCACC[CG]CATGTTAGGACCAAAAGCCGGACACTG
N           MGF, STAT5  Homo sapiens signal transducer and activator of transcription
                                  signal transducer and activator of transcription 5A
                                                cg18292634
    TGCTGTGGCAAGGCCTGTAGAGAGTTT[CG]AAGTTAGGAGGACTCAAGACGGT 5A (STAT5A), mRNA.
N           MGF, STAT5  Homo sapiens signal transducer and activator of transcription
                                  signal transducer and activator of transcription
                                                cg09355539
    CAGCCACCGACAGGCTGCATGA[CG]GTGGCAAAGTCACTTCCCCTCTCTG 5A 5A (STAT5A), mRNA.
Y           PJS, LKB1 Homo sapiens serine/threonine kinase 11 (STK11), mRNA.
                                  serine/threonine protein kinase 11
                                                cg12871083
    CGAGGTCACAGCCGTGGCCT[CG]TCTCCCCATGCCTGCTTCCCG
Y           MSSK1, SRPK3, MGC102944
                        Homo sapiens serine/threonine kinase 23 (STK23),
                                  serine/threonine kinase 23
                                                cg02910024
    CACAGGCCTCCTGCGGGCC[CG]AGTCCTCGGGCTCCGAACTAGCCC mRNA.
Y           MSSK1, SRPK3, MGC102944
                        Homo sapiens serine/threonine kinase 23 (STK23), mRNA.
                                  serine/threonine kinase 23
                                                cg15753733
    GCCAAGGCTATAAATTCGCAGGCCGCGGC[CG]GGCCCCACAGGAGCAGCCGCCCG
Y           VAMP7, VAMP-7, sapiens synaptobrevin-like 1 (SYBL1), mRNA.
                        Homo TI-VAMP
                                  synaptobrevin-like 1
                                                cg18199151
    GTCCCAGCCTCCTCTGGGAG[CG]GGCAGTTGGCGACCCTGCACTGACCC
Y           VAMP7, VAMP-7, sapiens synaptobrevin-like 1 (SYBL1), mRNA.
                        Homo TI-VAMP
                                  synaptobrevin-like 1
                                                cg11419984
    ATTTTGTCTGTGAGGAAACGGG[CG]ACGCTGCCTACTGAGACTAAGCAGGA
Y           .           Homo sapiens spleen tyrosine kinase (SYK), mRNA.
                                  spleen tyrosine kinase
                                                cg25028614
    AGGTCAGACCGTGCGGAAAGTGACC[CG]GGCACCCCAGGGCGCCCAGGCC
N           .           Homo sapiens spleen tyrosine kinase (SYK), mRNA.
                                  spleen tyrosine kinase
                                                cg06713470
    TTTATTTGGTTGTGGACGTCAGAGC[CG]TCATGGTAAGAAGGAAGCAAAGCCTT
Y           SCL, TCL5,Homo sapiens T-cell acute lymphocytic leukemia 1 (TAL1), mRNA.
                         tal-1    T-cell acutecg00875272 leukemia 1
                                                 lymphocytic
    CCGACAGGCTGTCTGGAACATTTT[CG]AACCCTCCAACTGGGATCGGTCTGGTT
Y           SCL, TCL5,Homo sapiens T-cell acute lymphocytic leukemia 1 (TAL1), mRNA.
                         tal-1    T-cell acutecg13537642 leukemia 1
                                                 lymphocytic
    TCACACATCGAAGTCTTGGATTAACTG[CG]AAGGCCTCCTTCTATTTGCCGCGGCTT
Y           SCL, TCL5,Homo sapiens T-cell acute lymphocytic leukemia 1 (TAL1), mRNA.
                         tal-1    T-cell acutecg26891410 leukemia 1
                                                 lymphocytic
    TTTGCCTTATGACCAAGTCTCTGTGTC[CG]TGCCTCTCTCCATTTTCTCTTCCTA
N           DGS, TGA,Homo sapiens T-box 1 cg15095600 TBX1C A, mRNA.
                        CAFS, CTHM, DGCR, (TBX1), VCFS,
                                  T-box 1 isoform A transcript variant
                                                 DORV,
    GGAGCCACGTGTGTGCAGGGGAGG[CG]GAACTGGGCAGACAGATGGG
Y           DGS, TGA,Homo sapiens T-box 1 cg03402455 TBX1C A, mRNA.
                        CAFS, CTHM, DGCR, (TBX1), VCFS,
                                  T-box 1 isoform A transcript variant
                                                 DORV,
    CTCAGTGCTTCCCTTTGCACGGTG[CG]CGGCGGAGCCCGATTCTGCTCTCTCC
Y           E2-2, ITF2, Homo sapiens transcription factor 4 (TCF4), mRNA.
                        SEF2, SEF2-1, SEF2-1A, SEF2-1B
                                  transcription factor 4 isoform b
                                                cg19706341
    TCGGGCAGGCTAGGATGCATCCCCCT[CG]CACCCACCCCGAGGGGAAAAAA
Y           E2-2, ITF2, Homo sapiens transcription factor 4 (TCF4), mRNA.
                        SEF2, SEF2-1, SEF2-1A, SEF2-1B
                                  transcription factor 4 isoform b
                                                cg06256989
    CCTGAACAGTTCAGTTTTTGCC[CG]TTGCATCCCTCGGAGGCACTTTGAAA
Y           TCF4, TCF-4 Homo sapiens transcription factor 7-like 2 (T-cell specific, HMG-box) (TCF7L2), mRNA.
                                  transcription factor 7-like 2 (T-cell specific, HMG-box)
                                                cg21844364
    GGAGGAGAAGAGCTCCGAAAACTCCT[CG]GCAGAGAGGGATTTAGCTGATG
Y           TCF4, TCF-4 Homo sapiens transcription factor 7-like 2 (T-cell specific, HMG-box) (TCF7L2), mRNA.
                                  transcription factor 7-like 2 (T-cell specific, HMG-box)
                                                cg04266779
    CTCTCGCCCTGTCAATAATCTC[CG]CTCCCAGACTACTCCGTTCCTC
Y           .           Homo sapiens thymine-DNA glycosylase (TDG), transcript variant
                                  thymine-DNA glycosylase isoform 2
                                                cg09857351
    GGGGTTGTCTTACCGCAGTGAGTACCA[CG]CGGTACTACAGAGACCGGCTGCCC 2, mRNA.
Y           CR, CRGF,Homo sapiens teratocarcinoma-derived growth 1
                        CRIPTO teratocarcinoma-derived growth factor
                                                cg24195016
    AAGGTCAAAACGTCCAAGGC[CG]AAAGCCCTCCAGTTTCCCCTG factor 1 (TDGF1), mRNA.
N           CR, CRGF,Homo sapiens teratocarcinoma-derived growth factor
                        CRIPTO teratocarcinoma-derived growth factor 1
                                                cg04728702
    ACACACACCTAGCTCCTCAGG[CG]GAGAGCACCCCTTTCTTGGCCAC 1 (TDGF1), mRNA.
N           TIE2, VMCM, TIE-2, VMCM1, CD202B kinase, endothelial (venous malformations, multiple cutaneous a
                        Homo sapiens TEK tyrosine
                                  TEK tyrosine kinase, endothelial
                                                cg05749772
    GTAGGACGATGCTAATGGAAAGTCACAAAC[CG]CTGGGTTTTTGAAAGGATC
N           TIE2, VMCM, TIE-2, VMCM1, CD202B kinase, endothelial (venous
                        Homo sapiens TEK tyrosine
                                  TEK tyrosine kinase, endothelial
                                                cg18721075
    GCTTTTCAGGTTGTATTTTCTCATCA[CG]GAAACCTTCTTCTCCCAATTCAAmalformations, multiple cutaneous a
N           TIE2, VMCM, TIE-2, VMCM1, CD202B kinase, endothelial (venous malformations, multiple cutaneous a
                        Homo sapiens TEK tyrosine
                                  TEK tyrosine kinase, endothelial
                                                cg04687350
    TTGGGGCTACATTGAGCATTGACCTCAC[CG]GTGCTCACTGAAATTAATTGCTTT
Y           TP2, TRT, EST2, TCS1, hEST2 cg03779447transcriptase (TERT), transcript variant 2, mRNA.
                        Homo sapiens telomerase reverse
                                  telomerase reverse transcriptase isoform 2
    GGGCCAGGGCTTCCCACGTG[CG]CAGCAGGACGCAGCGCTGCCTGAAACTC
Y           TP2, TRT, EST2, TCS1, hEST2 cg17903235transcriptase (TERT),
                        Homo sapiens telomerase reverse
                                  telomerase reverse transcriptase isoform
    CGAGGGCCCCAGCGGAGAGAGGT[CG]AATCGGCCTAGGCTGTGGG 2 transcript variant 2, mRNA.
Y           TESS, TESS-2, TESTIN, MGC1146, 1 transcript (3 LIM domains) (TES), transcript variant 1, mRNA.
                        Homo sapiens testis derived
                                  testin isoform DKFZP586B2022
                                                cg14204458
    GAGGAGGAGGGGACCCATAGGA[CG]CGTTAACATGGACCTGGAAAACAAA
Y           TESS, TESS-2, TESTIN, MGC1146, 1 transcript (3 LIM domains) (TES),
                        Homo sapiens testis derived
                                  testin isoform DKFZP586B2022
                                                cg00626984
    GGCCCGTGGACGCCCAGAGAATCCCTT[CG]GAGACCAGGTCAGGGTCACTGAG transcript variant 1, mRNA.
Y           .           Homo sapiens testis-specific kinase 2 (TESK2), mRNA.
                                  testis-specific protein kinase 2
                                                cg15066293
    CGAAGGGAACCAATAGGAAGGAAGT[CG]AGGTAAAAACAGAAGAAGCAGTGTGTG
Y           ERF1, TFAP2G, hAP-2g, AP2-GAMMA factor AP-2 gamma (activating enhancer binding protein 2 gamm
                        Homo sapiens transcription AP-2 gamma
                                  transcription factor
                                                cg13061291
    CGGACGCCATGTTGTGGAAAATAAC[CG]ATAATGTCAAGTACGAAGAGGACTGC
Y           ERF1, TFAP2G, hAP-2g, AP2-GAMMA factor AP-2 gamma (activating enhancer binding protein 2 gamm
                        Homo sapiens transcription AP-2 gamma
                                  transcription factor
                                                cg25369162
    GGCCCGCCAGAGGCAGCTGCAGAGCCGG[CG]TTCCGCAGGGCAGGGCAGGG
Y           DP1, Dp-1, Homo sapiens transcription factor Dp-1 (TFDP1), mRNA.
                        DRTF1     transcription factor Dp-1
                                                cg03399232
    TAGTGCACACACCAGTCCC[CG]CTCCCTCACGTGCACATGCACTAGTGCA
Y           RCCP2       Homo sapiens transcription factor binding to IGHM enhancer 3
                                  transcription factor binding to IGHM enhancer 3
                                                cg05988412
    CTGGCCAAGCTTTTAGCTGCGGAAC[CG]CGCCCTCTTTCGGCCAATATTTGTAAT(TFE3), mRNA.
N           pS2, BCEI, Homo sapiens trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in) (TF
                        HPS2, HP1.A, pNR-2, cg27405706
                                  trefoil factorD21S21
                                                 1 precursor
    ATGGAAGGATTTGCTGATAGACAGAGA[CG]ACATGTGGTGAGGTCATCTTGG
N           SP, SML1 Homo sapiens trefoil factor 2 (spasmolytic protein 1) (TFF2),
                                  trefoil factorcg10018784
                                                 2 precursor
    GCCAGGGTGACTCTCTCCCTGCT[CG]GTGATACCTCTTCCTGCCCTGGACAGAmRNA.
N           SP, SML1 Homo sapiens trefoil factor 2 (spasmolytic protein 1) (TFF2),
                                  trefoil factorcg11158374
                                                 2 precursor
    TGGAGATGAGGCTGACAGGGTCAG[CG]GAGTAGCCTGTGACAGGCAGGTTT mRNA.
Y           PP5, TFPI-2 Homo sapiens tissue factor pathway inhibitor 2 (TFPI2), mRNA.
                                  tissue factor pathway inhibitor 2
                                                cg23686014
    AGATACCTGTTGGCTCCTGAGCAGCAT[CG]CCCAGTGCAGCCTCCGTCAGGAA
Y           PP5, TFPI-2 Homo sapiens tissue factor pathway inhibitor 2 (TFPI2), mRNA.
                                  tissue factor pathway inhibitor 2
                                                cg12005526
    TGTGTAAGAGGGAGAGGAATTCCC[CG]CCAAGTTGAAAAGTTGAACCTGCCT
Y           PP5, TFPI-2 Homo sapiens tissue factor pathway inhibitor 2 (TFPI2), mRNA.
                                  tissue factor pathway inhibitor 2
                                                cg16934178
    GAGGTGCGCGGCTTTCTGCTCCAGG[CG]GCCCGGGTGCCCGCTTTATGCGGGG
Y           TFR, CD71, TFR1, TRFR transferrin receptor (p90, CD71) (TFRC), mRNA.
                        Homo sapiens
                                  transferrin receptor
                                                cg22956956
    TGCACTGCGGCAGTGCCTTGAAATGTA[CG]TGCAGGATGGAATGTTAGGTAACT
Y           TFGA        Homo sapiens transforming growth factor, alpha (TGFA),
                                  transforming growth factor, alpha
                                                cg26582629
    CGGGCACCCGTTACCTACAC[CG]AGGGGCCGCTCCTGGGGCATCTCTGGGmRNA.
Y           TFGA        Homo sapiens transforming growth factor, alpha (TGFA), mRNA.
                                  transforming growth factor, alpha
                                                cg16146108
    GGAAAGGGACCTGTGAGTTTCGC[CG]GCCGCTTGCCAAGACTTGGCTC
Y           CED, DPD1, TGFB
                        Homo sapiens transforming growth factor, beta 1 (Camurati-Engelmann disease) (TGFB1), m
                                  transforming growth factor, beta 1
                                                cg05445479
    CGGTCGAAGTTGCGGAGCAGCAGGC[CG]ATCTCCAGGTGCACGGTGCCACCAGC
Y           MGC116892, TGF-beta2 transforming growth factor, beta 2 (TGFB2), mRNA.
                        Homo sapiens
                                  transforming growth factor, beta 2
                                                cg20490551
    TTTCTGATCCTGCATCTGGTCACGGT[CG]CGCTCAGCCTGTCTACCTGCAGCACACT
Y           MGC116892, TGF-beta2 transforming growth factor, beta 2 (TGFB2), mRNA.
                        Homo sapiens
                                  transforming growth factor, beta 2
                                                cg11125460
    CGTGGAGTAACCAAGCGGGTCAGCGCG[CG]CCCGCCAGGGTGTAGGCCACGG
N           FLJ16571, TGF-beta3 transforming growth factor, beta 3 3 (TGFB3), mRNA.
                        Homo sapiens transforming growth factor, beta
                                                cg17928876
    CAGGAAGCGCTGGCAACCCTGAGGA[CG]AAGAAGCGGACTGTGTGCCTT
Y           CSD, CDB1, CDG2, CSD1, CSD2,cg00833799 factor, beta-induced, 68kDa (TGFBI), mRNA.
                        Homo sapiens transforming growth BIGH3, CDGG1
                                   transformingCSD3, LCD1, beta-induced,
                                                  growth factor,
    ACTGAGCACGGGCACAGTGCGGGAG[CG]GGTGGGTGCCCAGGGCAG 68kDa
Y           CSD, CDB1, CDG2, CSD1, CSD2,cg07852148 factor, beta-induced, 68kDa (TGFBI), mRNA.
                        Homo sapiens transforming growth BIGH3, CDGG1
                                   transformingCSD3, LCD1, beta-induced, 68kDa
                                                  growth factor,
    GCTTACTTAACCTGGCCCGGGCGG[CG]GAGGCGCTCTCACTTCCCTGGAGCC
Y           .           Homo sapiens transforming growth factor, beta receptor III (betaglycan, 300kDa) (TGFBR3),
                                   transforming growth factor, beta receptor III (betaglycan, 300kDa)
                                                cg15563741
    GGCGGTGTGTCCAGCGGAGATCCACC[CG]CAGCAAGTTGGAGGAAAGCGGC
Y           .           Homo sapiens transforming growth factor, beta receptor III (betaglycan, 300kDa) (TGFBR3),
                                   transforming growth factor, beta receptor III
                                                cg19846193
    CGGGGACTCGCTCCCTCAAA[CG]AGGTCCTTTGAACTTTCCAGGGCTCC (betaglycan, 300kDa)
Y           TSP, THBS, TSP1
                        Homo sapiens thrombospondin 1 (THBS1), mRNA.
                                   thrombospondin 1 precursor
                                                cg08811261
    CCGGGACATCCACCTGGAG[CG]CTGAGGCTTCAGTCCCTCTGGTGGACC
Y           TSP, THBS, TSP1
                        Homo sapiens thrombospondin 1 (THBS1), mRNA.
                                   thrombospondin 1 precursor
                                                cg06698640
    GTGGAGGAGAGTCAGCGAGGGCC[CG]AGGGGCAGGTACTTTAACGAATG
Y           TSP2        Homo sapiens thrombospondin 2 (THBS2), mRNA.
                                   thrombospondin 2 precursor
                                                cg05068443
    CTGTGCAGGGCTGTCAATCAGACACA[CG]AGGAAGCACGTTTAATTCATTCCTTCG
N           TSP2        Homo sapiens thrombospondin 2 (THBS2), mRNA.
                                   thrombospondin 2 precursor
                                                cg24654845
    AACCTGACGTGCAGGCACAGAGCAAGGACT[CG]AGAGAACGAGAAGCAGTGGCAGCAGCT
N           ML, TPO, MGDF, sapiens thrombopoietin (myeloproliferative leukemia virus oncogene ligand, megakary
                        Homo MKCSF, MPLLG
                                   thrombopoietin isoform 2 precursor
                                                cg08997821
    TCCCATTACCCTCTCCTTG[CG]CCCTGGCTTGCCTGGCCCAGCTTCC
N           ML, TPO, MGDF, sapiens thrombopoietin (myeloproliferative leukemia virus
                        Homo MKCSF, MPLLG
                                   thrombopoietin isoform 2 precursor
                                                cg20482454
    TGTCAGGTGCGGGGCACATGTATGTG[CG]CACACGTGCACTGGGTTAAGCCTGAGoncogene ligand, megakary
Y           CD90        Homo sapiens Thy-1 cell surface antigen (THY1),
                                   Thy-1 cell surface antigen
                                                cg18809507
    GGAAGGAAGAGAAGGCGGTCC[CG]CATTGGTGTGAGAGTGGCAGGmRNA.
Y           CD90        Homo sapiens Thy-1 cell surface antigen (THY1), mRNA.
                                   Thy-1 cell surface antigen
                                                cg11980653
    CCGGTTGCTGCACCCAGCTCGGAGCC[CG]CAGTTTTCACCGGGGATGGAG
Y           .           Homo sapiens T-cell lymphoma invasion and metastasis
                                   T-cell lymphoma invasion and metastasis
                                                cg06524895
    AACCCGCTCGTGGTCTGCCAAT[CG]GAGCTGTCAGGGCCCCTCCGCC 1 1 (TIAM1), mRNA.
Y           .           Homo sapiens T-cell lymphoma invasion and metastasis
                                   T-cell lymphoma invasion and metastasis
                                                cg02217293
    GGAGCCCGTGGGAAACCGAGCTC[CG]ATTGGGCCGCCTGACAATCGC 1 1 (TIAM1), mRNA.
N           TIE, JTK14Homo sapiens tyrosinecg19492156immunoglobulin-like and EGF-like domains 1 (TIE1), mR
                                   tyrosine kinase withwith
                                                 kinase immunoglobulin-like and EGF-like domains 1
    CCAGCTCGTCCTGGCTGGCCTGGGT[CG]GCCTCTGGAGTATGGTCTGGCGGGTGCCCC
N           EPA, EPO, Homo sapiens TIMP metallopeptidase inhibitor 1 (TIMP1),
                        HCI, CLGI, tissue inhibitor of metalloproteinase precursor
                                    TIMP, FLJ90373
                                                cg13659929
    CTTGGGTGCTGGCCACCAGGCC[CG]TGCACTCCCGTGCCAGATGCCTGTCTmRNA.
N           EPA, EPO, Homo sapiens TIMP metallopeptidase inhibitor 1 (TIMP1),
                        HCI, CLGI, tissue inhibitor of metalloproteinase precursor
                                    TIMP, FLJ90373
                                                cg22164815
    CCATATTTCCTCATCCGTAAAA[CG]GGAATAAGAACCGGTACCCATCTCAG mRNA.
Y           .           PREDICTED: Homo sapiens TIMP metallopeptidase inhibitor 2 (TIMP2), mRNA.
                                   similar to Metalloproteinase inhibitor 2 precursor (TIMP-2) (Tissue inhibitor of me
                                                cg14087402
    TGCAAAACGCCTGTTGCGGGTGCAC[CG]GGGAGCAGCTGCAGGCGTCG
Y           .           PREDICTED: Homo sapiens TIMP metallopeptidase inhibitor 2 (TIMP2), mRNA.
                                   similar to Metalloproteinase inhibitor 2 precursor
                                                cg27235002
    GGTCCCCGCTGCGTGGCCTTCTG[CG]CCCGGGGTCCCTGACTCAGCGCG (TIMP-2) (Tissue inhibitor of me
N           SFD, K222,Homo sapiens TIMP metallopeptidase inhibitor 3 (Sorsby fundus dystrophy, pseudoinflamma
                         K222TA2, tissue inhibitor of metalloproteinase precursor
                                   HSMRK222     cg23817297
    GAATCTCTCAAATTCCACCA[CG]TATGCCCTCATTCAACCTGGATCCT
N           SFD, K222,Homo sapiens TIMP metallopeptidase inhibitor 3 (Sorsby fundus
                         K222TA2, tissue inhibitor of metalloproteinase precursor
                                   HSMRK222     cg25245338
    AATACCATCTCTCACGAATTCTT[CG]GCCTCTGCTGTCCCAATGTCACTTGTCTGA dystrophy, pseudoinflamma
Y           SFD, K222,Homo sapiens TIMP metallopeptidase inhibitor 3 (Sorsby fundus dystrophy, pseudoinflamma
                         K222TA2, tissue inhibitor of metalloproteinase precursor
                                   HSMRK222     cg04421373
    GAGGGCTCCGCTCCGAGGACCCAG[CG]GCAAGCACCGGTCCCGGGC
Y           ZO-1, DKFZp686M05161 tight junction protein 1 (zona occludens 1) (TJP1),
                        Homo sapiens junction protein 1 isoform b
                                   tight        cg07003973
    CATGCATGAGTGCGGCTGGAAAGGC[CG]GCAGAGCCGATACCCGACAGTTGTTT transcript variant 2, mRNA
Y           ZO-1, DKFZp686M05161 tight junction protein 1 (zona occludens 1) (TJP1), transcript variant 2, mRNA
                        Homo sapiens junction protein 1 isoform b
                                   tight        cg10264754
    AAACAGCATGGTCACGGCTGTCAC[CG]CGTGCCTCGGCGTTGTTCCCACGGA
Y           ZO2, X104,Homo sapiens tight junction protein 2 (zona occludens 2) (TJP2),
                        ZO-2, MGC26306
                                   tight junction protein 2 (zona occludens 2)
                                                cg04003500
    GCGGACAGTCGGGCCAGCAG[CG]CCCGGAGCTCACTCCAGGTCTCC isoform 1 transcript variant 1, mRNA
Y           ZO2, X104,Homo sapiens tight junction protein 2 (zona occludens 2) (TJP2),
                        ZO-2, MGC26306
                                   tight junction protein 2 (zona occludens 2)
                                                cg16782205
    GCTGAGAAATGTGGGGTACAAGGC[CG]TGTATGTGTTGGTTAGCCGGGisoform 1 transcript variant 1, mRNA
Y           TK2         Homo sapiens thymidine kinase 1, soluble (TK1), mRNA.
                                   thymidine kinase 1, soluble
                                                cg26206461
    AGGTTAATGCAGCTCATTGCGCCTC[CG]GGAAGTTCACGAACCCGAGTACTCTC
Y           TK2         Homo sapiens thymidine kinase 1, soluble (TK1), mRNA.
                                   thymidine kinase 1, soluble
                                                cg03239574
    CGTGCTGGCCAATCACGAGCCGGCCC[CG]CCGCCATGGGGCCAATCAGCGCCC
N           .           Homo sapiens transmembrane 7 superfamily member
                                   transmembrane 7 superfamily member 3
                                                cg03385215
    GGAAGAGGGACTGGGCTCAACTC[CG]AATACAGCGTGGGCAAGAGGGA3 (TM7SF3), mRNA.
Y           orf, H7365, Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 1 (TME
                        C9orf2     transmembrane protein with EGF-like and two follistatin-like domains 1
                                                cg00965425
    CTCCGCTCGCCTTCTGCTGCTACA[CG]TCGGTGCTTCTGCTCTTCGCCTTCTCTCT
Y           orf, H7365, Homo sapiens transmembrane protein with EGF-like and follistatin-like domains 1
                        C9orf2     transmembrane protein with EGF-like and two
                                                cg24890679
    GGACACAAAGGGAAGGCGAGGAGG[CG]AGCAAGAGGCTGGGCCTGCCT two follistatin-like domains 1 (TME
Y           orf, H7365, Homo sapiens transmembrane protein with EGF-like and follistatin-like domains 1
                        C9orf2     transmembrane protein with EGF-like and
                                                cg20925051
    ACAAGTCACCTTTACCTCTTC[CG]TGACTCAGTTTCTTCCACCTAAAAAC two two follistatin-like domains 1 (TME
Y           TR, HPP1, TPEF, sapiens transmembrane protein with EGF-like two follistatin-like domains 2
                        Homo TENB2 transmembrane protein with EGF-like and
                                                cg10026428
    GGAAGCCGGAGGACAGGAGGAGA[CG]GGAGTCCAGGGGCAGACGA and two follistatin-like domains 2 (TME
Y           TR, HPP1, TPEF, sapiens transmembrane protein with EGF-like and follistatin-like domains 2
                        Homo TENB2 transmembrane protein with EGF-like and two
                                                cg10348923
    GAGGTGCAAGGATGCAAGGAGGAGG[CG]GCCGCGGAAGCCACAGATGGG two follistatin-like domains 2 (TME
Y           TR, HPP1, TPEF, sapiens transmembrane protein with EGF-like two follistatin-like domains 2
                        Homo TENB2 transmembrane protein with EGF-like
                                                cg21377961
    CGCTGGCCCGAGTGGGGCTAGG[CG]GGGATGGCTCAAATGAGAA andand two follistatin-like domains 2 (TME
Y           KIAA0489, KIAA0792, RP4-559A3.1 protein 63A63A (TMEM63A), mRNA.
                        Homo sapiens transmembrane protein
                                   transmembranecg09739214
    AGGGTGCATTGCCCCTCCTCA[CG]CCCCCTGTCCCCTGTACCTGCGGC
N           MT-SP2, TMPRSS3 transmembrane protease, serine 4 isoform
                        Homo sapiens transmembrane protease, serine 4 (TMPRSS4), transcript variant 1, mRNA.
                                                cg13233515
    TTGCTCAGCGGACAAGGATGCTGGG[CG]TGAGGGACCAAGGCCTGCCC 1
N           MT-SP2, TMPRSS3 transmembrane protease, serine 4 isoform 1
                        Homo sapiens transmembrane protease, serine 4 (TMPRSS4), transcript variant 1, mRNA.
                                                cg26118131
    GAAAGAAGGAAATGACTCCGTGGA[CG]AGGAGACGTGGGCTCTAGCCAG
Y           TN, HXB Homo sapiens tenascin C (hexabrachion) (TNC), mRNA.
                                   tenascin C (hexabrachion)
                                                cg22480835
    GGAACCCATTTGCATACAATTTATGG[CG]AAAGTAGGAATTCCCGCCTGCCCG
Y           TN, HXB Homo sapiens tenascin C (hexabrachion) (TNC), mRNA.
                                   tenascin C (hexabrachion)
                                                cg01250769
    TCCTTCCTCTGTAATGGGACGCCT[CG]CCTCCAGACATCCTTTCCCAC
N           DIF, TNFA,Homo sapiens tumor necrosis factor (TNF superfamily, member 2) (TNF), mRNA.
                        TNFSF2, TNF-alpha cg07452656
                                   tumor necrosis factor alpha
    ATGTGATGGACTCACCAGGTGAGGC[CG]CCAGACTGCTGCAGGGGAAGCAA
N           DIF, TNFA,Homo sapiens tumor necrosis factor (TNF superfamily, member 2) (TNF), mRNA.
                        TNFSF2, TNF-alpha cg26444570
                                   tumor necrosis factor alpha
    CGCCCCCGCGATGGAGAAGAAAC[CG]AGACAGAAGGTGCAGGGCCCACTACC
Y           DR4, APO2, CD261, MGC9365, TRAILR1, TRAILR-1 superfamily, member 10a10a (TNFRSF10A), mRN
                        Homo sapiens tumor necrosis factor receptor superfamily, member
                                   tumor necrosis factor receptor
                                                cg00990613
    TCGTTTTGCCACTTGGTCCCAG[CG]CCAGGCTTCTCGGTCGGGAGTTGACCT
Y           DR4, APO2, CD261, MGC9365, TRAILR1, TRAILR-1 superfamily,
                        Homo sapiens tumor necrosis factor receptor superfamily, member
                                   tumor necrosis factor receptor
                                                cg25641272
    TTCCTCTGTGACCGCCCTTGC[CG]CTCTCAGCTTCTGTTCCTCAACCAC member 10a10a (TNFRSF10A), mRN
Y           DR5, CD262, KILLER, tumor necrosis factor receptor superfamily,
                        Homo sapiens tumorTRICKB, ZTNFR9, TRAILR2, TRICK2A, TRICK2B, TRAIL-R2, KILLER
                                   TRICK2, necrosis factor receptor superfamily, member isoform 2 precursor
                                                cg07508317
    GGCATCGTCGGTGTATTTTGTGGG[CG]CAGAGATTGCGGGGTTCTCC member 10b10b (TNFRSF10B), trans
Y           DR5, CD262, KILLER, tumor necrosis factor receptor superfamily,
                        Homo sapiens tumorTRICKB, ZTNFR9, TRAILR2, TRICK2A, TRICK2B, TRAIL-R2, KILLER
                                   TRICK2, necrosis factor receptor superfamily, member isoform 2 precursor
                                                cg26918957
    GGTCCTGTCCGCGCCAGGACAGGCAC[CG]AAACTTGGGGGAAATGAG member 10b10b (TNFRSF10B), trans
Y           LIT, DCR1, Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an in
                        TRID, CD263, TRAILR3 factor receptor superfamily, member 10c precursor
                                   tumor necrosis
                                                cg05937208
    AGGGGTGAAGGAGCGCTTCCTAC[CG]TTAGGGAACTCTGGGGACAG
N           LIT, DCR1, Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an in
                        TRID, CD263, TRAILR3 factor receptor superfamily, member 10c precursor
                                   tumor necrosis
                                                cg06346860
    CTCCTCAGCCTCTGCATGTGCC[CG]TCATGGCCCCTGTGTCCTTCATTCTGTC
Y           LIT, DCR1, Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an in
                        TRID, CD263, TRAILR3 factor receptor superfamily, member 10c precursor
                                   tumor necrosis
                                                cg23831143
    GGGTATAAATTCAGAGGCGCTGCGCTC[CG]ATTCTGGCAGTGCAGCTGTGGG
Y           DCR2, CD264, TRUNDD, TRAILR4 factor receptor superfamily, member 10d precursor
                        Homo sapiens tumor necrosis factor receptor superfamily, member
                                   tumor necrosis
                                                cg01031400
    CAGAAATCGTCCCCGTAGTTTGTG[CG]CGTGCAAAGGTTCTCGCAGCTACACTGCCA 10d, decoy with truncate
Y           DCR2, CD264, TRUNDD, TRAILR4 factor receptor superfamily, member 10d10d, decoy with truncate
                        Homo sapiens tumor necrosis factor receptor superfamily, member precursor
                                   tumor necrosis
                                                cg04134048
    CGTGGTCAGTTGTACTCCCTTCC[CG]CAGTCACTTCCAGGCACTCAGGCTGG
N           FPF, p55, p60, TBP1, TNF-R, TNFAR,factor receptor 1 CD120a, TNFR55, TNFR60, TNF-R-I, TNF-R55
                        Homo sapiens tumor necrosis factor p55-R, precursor
                                  tumor necrosis TNFR1, receptor superfamily,
                                               cg18805708
    TCCTGGCTCTGCCACCAATCATG[CG]ACATCAGGCAACTCCTCTCCTAAGC member 1A (TNFRSF1A), mRNA
Y           p75, TBPII, Homo sapiens tumor necrosis factor receptor superfamily, TNF-R-II
                        TNFBR, TNFR2, CD120b, factor receptor 2 precursor
                                  tumor necrosis TNFR80, TNF-R75, p75TNFR,
                                               cg06978331
    TCGCTTTCAGTCGAGGGCTAGCGAG[CG]CAGCGGAGCCTGGAGAGAAGG member 1B (TNFRSF1B), mRNA
Y           p75, TBPII, Homo sapiens tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B), mRNA
                        TNFBR, TNFR2, CD120b, factor receptor 2 precursor
                                  tumor necrosis TNFR80, TNF-R75, p75TNFR, TNF-R-II
                                               cg20587042
    GGTCACCCGAGTGCTGGGAGTGA[CG]CTGGAGGTATCGGCCCAGCGAT
N           TL2, APO2L, CD253, TRAIL, necrosis factor (ligand) superfamily, member
                        Homo sapiens tumor necrosis factor (ligand) superfamily, member
                                  tumor Apo-2L cg16555388
    GACTGCTGTAAGTCAGCCAGGCAGC[CG]GTCACTGAAGCCCTTCCTTCTCTATT 10 10 (TNFSF10), mRNA.
N           TL2, APO2L, CD253, TRAIL, necrosis factor (ligand) superfamily, member 10
                        Homo sapiens tumor necrosis factor (ligand) superfamily,
                                  tumor Apo-2L cg27433414
    TCTTTTATAGTCAGTGAGGAAATGAAAG[CG]AATGAGTTGTTTTTCTGGGT member 10 (TNFSF10), mRNA.
N           CD153, CD30L, CD30LG tumor necrosis factor (ligand) superfamily, member 8 (TNFSF8), mRNA.
                        Homo sapiens
                                  tumor necrosis factor (ligand) superfamily, member 8
                                               cg09980061
    CCCCAGGTGGCTGGCCACGGAGCC[CG]CCGGCACATGCATGGCTGTGTCTC
Y           CD153, CD30L, CD30LG tumor necrosis factor (ligand) superfamily,
                        Homo sapiens
                                  tumor necrosis factor (ligand) superfamily, member 8
                                               cg19343707
    CACACACAAAGCAACTTCTGTTT[CG]TTTAGACTCTGCCACAAAACGCCTTC member 8 (TNFSF8), mRNA.
Y           MGC46193Homo sapiens tyrosinecg26000767
                                  tyrosine kinase, non-receptor, 1 1 (TNK1), mRNA.
                                                kinase, non-receptor,
    GGCTGGAAAGACGTGAAGGAAGA[CG]AGCAGAGGAGAAGGGAAGG
Y           MGC46193Homo sapiens tyrosinecg25335879
                                  tyrosine kinase, non-receptor, 1 1 (TNK1),
                                                kinase, non-receptor,
    CCGCGGGATTTACTCCTGTCC[CG]CCTCCTCGGATTTAGCCCAGGCAG mRNA.
Y           P73         Homo sapiens tumor protein p73 (TP73), mRNA.
                                  tumor protein p73
                                               cg05300134
    CAGCGCTGGGCAGGCACCTGGGCT[CG]CAGCTCCGAAGCTGGGAGGT
Y           P73         Homo sapiens tumor protein p73 (TP73), mRNA.
                                  tumor protein p73
                                               cg03987602
    GCCGAGGAGCCCAGCGCTAGTGGCGG[CG]GCCAGGAGAGACCCGGGTG
Y           P73         Homo sapiens tumor protein p73 (TP73), mRNA.
                                  tumor protein p73
                                               cg21323562
    GTGTCGCTGGCCGGTAGAGAGCTT[CG]GCCTGACCTAGCGCAGGTCTGG
Y           TR, HPP1, TPEF, sapiens transmembrane protein with EGF-like and two
                        Homo TENB2transmembrane protein with EGF-like and two follistatin-like domains 2
                                               cg25278465
    AGCAGCCAGCAAAAGCCCT[CG]CAAAGTGTCCAGCTGCTGCACTGCCGCGGG follistatin-like domains 2 (TME
Y           TR, HPP1, TPEF, sapiens transmembrane protein with EGF-like and two follistatin-like domains 2 (TME
                        Homo TENB2transmembrane protein with EGF-like and two follistatin-like domains 2
                                               cg09698887
    GTAGGGAAAGCAGCGAGCTTCACCGGG[CG]GGCTACGATGAGTAGCATGACGG
Y           CART1, MLN62, RNF83 TNF receptor-associated factor 4 (TRAF4), transcript variant 2, mRNA.
                        Homo sapiens receptor-associated factor 4 isoform 2
                                  TNF          cg23340501
    CCCCGGAGCTGGTTGCCAGGCTT[CG]GCTGCCTAGCACCTGGAAGCTG
Y           ATDC        Homo sapiens tripartitecg26414304
                                  tripartite motif protein TRIM29 isoform alpha
                                                motif-containing 29 (TRIM29), transcript variant 1, mRNA.
    CAGGCTGCCACTGGGGCCCGA[CG]GGCTCCGGGCATCCCTGGCTTCTGGG
N           ATDC        Homo sapiens tripartitecg24593464
                                  tripartite motif protein TRIM29 isoform alpha
                                                motif-containing 29 (TRIM29), transcript variant 1, mRNA.
    GAGCAGATAATTGCACAGGAACCA[CG]CCCTGCACATTCATCCCTAACCTGA
N           ATDC        Homo sapiens tripartitecg13907859
                                  tripartite motif protein TRIM29 isoform alpha
                                                motif-containing 29 (TRIM29), transcript
    GCACTTGCTTCTCATCCGGGGAG[CG]GGGAGTCTCCGTCTTCACAAGTGGGCA variant 1, mRNA.
Y           OIP1, ZRP-1, MGC3837, MGC4423, MGC10556, MGC10558, MGC29959
                        Homo sapiens thyroid hormone receptor interactor
                                  thyroid hormone receptor interactor 6
                                               cg23753251
    AGGGGGTGAAGGCCAGAGGCT[CG]GGGCTTCAAGACCGCTGTCTG 6 (TRIP6), mRNA.
Y           OIP1, ZRP-1, MGC3837, MGC4423, MGC10556, MGC10558, 6
                        Homo sapiens thyroid hormone receptor interactor MGC29959
                                  thyroid hormone receptor interactor 6
                                               cg09357642
    AAGGGGACTTTGTGAACAGTGGG[CG]GGGAGACGCAGAGGCAGAGG (TRIP6), mRNA.
Y           OIP1, ZRP-1, MGC3837, MGC4423, MGC10556, MGC10558, 6 (TRIP6), mRNA.
                        Homo sapiens thyroid hormone receptor interactor MGC29959
                                  thyroid hormone receptor interactor 6
                                               cg06647679
    CTTGGGCATGGTGCCCGCTTGGCATAG[CG]CCCGGCTCCGGATCTTCCTGTGCCT
N           MTR1, LTRPC5 sapiens transient receptor potential cation
                        Homo      transient receptor potential cation channel, subfamily M, M, member
                                               cg01581060
    AGACCCTCCAAAGTTGACCT[CG]CCCCTGTGCAAGCCCAGCTCCC channel, subfamilymember 5 5 (TRPM5),
N           MTR1, LTRPC5 sapiens transient receptor potential cation channel, subfamily M, member
                        Homo      transient receptor potential cation channel,
                                               cg03982381
    GGCTCATGTCTCCCAGCTGCC[CG]GTGAGGTCGGGCATCTCAGCCCCT subfamily M, member 5 5 (TRPM5),
N           MTR1, LTRPC5 sapiens transient receptor potential cation channel, subfamilymember 5 5 (TRPM5),
                        Homo      transient receptor potential cation channel, subfamily M, M, member
                                               cg19265431
    TCTGTCTGCCCTCCTGGAACCA[CG]CGTCGGGTCACAGGCCGCTGGGCAGA
N           LAM, TSC4, uberin, TUBERIN sclerosis 2 isoform 1 transcript variant 1,
                        Homo sapiens tuberous sclerosis 2 (TSC2),
                                  tuberous cg01052512
    AGAGGGTAAACAGACGGAGTTTATCATCAC[CG]CGGAAATACTGAGAGTGAGTGA mRNA.
Y           TSG10, VPS23 sapiens tumor susceptibility gene 101 (TSG101), mRNA.
                        Homo      tumor susceptibility gene 101
                                               cg26623416
    CGAGTGCCGGAATCAGCAGGACGAAT[CG]GGTCCCAAAGATGTGGGCAAG
Y           TSG10, VPS23 sapiens tumor susceptibility gene 101 (TSG101), mRNA.
                        Homo      tumor susceptibility gene 101
                                               cg17431513
    GCTAGTGCCGGAGAGGGAAGAAGTA[CG]AAGGGCTTGCCAGTGAGCCTTAA
Y           .           Homo sapiens testes-specific protease 50 (TSP50), mRNA.
                                  testes-specific protease 50
                                               cg07522405
    GGGTGGCAGCCGACTGCGTCTCTC[CG]GAAGGCGCTCCCAGTGCCGCCC
Y           .           Homo sapiens testes-specific protease 50 (TSP50), mRNA.
                                  testes-specific protease 50
                                               cg13403573
    GCTCGTGGTGTCTGACCCGCAAGGG[CG]CCCCTAGTGACAGCCCTCCCTTATA
Y           MC1R, TUBB4, beta-4 tubulin, beta, 4 3 (TUBB3), mRNA.
                        Homo sapiens tubulin, cg21691320
                                               beta
    AGTATGAGGGAGATCGTGCACATCCAGGC[CG]GCCAGTGCGGCAACCAGATCGG
Y           MC1R, TUBB4, beta-4 tubulin, beta, 4 3 (TUBB3), mRNA.
                        Homo sapiens tubulin, cg02471566
                                               beta
    GGCGTGGGGAAAAAAGACCCTC[CG]TACAAAGCCGCAGGGTGGGGC
Y           MC1R, TUBB4, beta-4 tubulin, beta, 4 3 (TUBB3), mRNA.
                        Homo sapiens tubulin, cg15669092
                                               beta
    CCTTGTGACAATTCCTGACACGGATG[CG]CACCGGGCAGTGGCACGTCCAGGTGCT
Y           N33, OST3A, D8S1992, MGC13453
                        Homo sapiens tumor suppressor candidate 3 (TUSC3), transcript variant 2, mRNA.
                                  tumor suppressor candidate 3 isoform b
                                               cg10249582
    CAGGTCTTCTCCCGGTGAAC[CG]GATGCTCTGTCAGTCTCCTCCTCTGCGTC
Y           N33, OST3A, D8S1992, MGC13453
                        Homo sapiens tumor suppressor candidate 3 (TUSC3),
                                  tumor suppressor candidate 3 isoform b
                                               cg17170317
    TCCTCTCCTCAGCGCTGGTC[CG]GGAAAGGCAAGCTCCGGGCGGGAGC transcript variant 2, mRNA.
Y           SCS, ACS3, BPES2, BPES3, TWIST
                        Homo sapiens twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Dros
                                  twist        cg03005254
    GATGGCCCCGAGGTCCAAAAAGAAAG[CG]CCCAACGGCTGGACGCACACCCC
Y           SCS, ACS3, BPES2, BPES3, TWIST
                        Homo sapiens twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Dros
                                  twist        cg01202666
    TCCTGGCCGCGGTGGCAGCCCCATC[CG]GAGTGGCTGTGACAGCAGCAATG
Y           SCS, ACS3, BPES2, BPES3, TWIST
                        Homo sapiens twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Dros
                                  twist        cg12926104
    GGGGGCAGCAGTGTCATTGGCCTGA[CG]TGAGGAGGAGGGACTTTT
Y           JTK1        Homo sapiens tyrosinecg11800224
                                  tyrosine kinase 2 2 (TYK2), mRNA.
                                                kinase
    CGGTCCTGTCTCCTTTCCCT[CG]TTTCTACCTGGCCGACTCCATCCTG
Y           BYK, Brt, Dtk, RSE, Sky, Tif protein tyrosine kinase
                        Homo sapiens TYRO3 cg10391513
                                  TYRO3        protein tyrosine kinase (TYRO3), mRNA.
    ATGCTGGATTCTGGGATCAGAGTC[CG]AACAAGAGTTGGGGTGTGG
N           BYK, Brt, Dtk, RSE, Sky, Tif protein tyrosine kinase
                        Homo sapiens TYRO3 cg25504247
                                  TYRO3        protein tyrosine kinase (TYRO3),
    GAATGGCTCAATGAAAGGGAGGCA[CG]AAGGGATGCTAGCCGATCCTGT mRNA.
Y           CEP52, RPL40, RPS27A, HUBCEP52, MGC57125 L40 precursor
                        Homo sapiens ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), mRNA.
                                  ubiquitin and ribosomal protein
                                               cg23146959
    TTAGAAAACATTCTCCTCTACTC[CG]TTCAGCTATTCGCTGAGGGCCCGCC
N           GNT1, UGT1, UDPGT,UDP glycosyltransferase 1 family,1 family, polypeptide A1 (UGT1A1), mRNA.
                        Homo sapiens UDP glucuronosyltransferase polypeptide
                                   UGT1A, UGT1*1, HUG-BR1
                                               cg03607648
    GGCGAACCTCTGGCAGGAGCAAAGG[CG]CCATGGCTGTGGAGTCCCAGG A1 precursor
N           GNT1, UGT1, UDPGT,UDP glycosyltransferase 1 family,1 family, polypeptide A1
                        Homo sapiens UDP glucuronosyltransferase polypeptide A1 precursor
                                   UGT1A, UGT1*1, HUG-BR1
                                               cg11661768
    AGAAGCCTAACTTGTTCACTACATAGT[CG]TCCTTCTTCCTCTCTGGTAACACTTGTTGG(UGT1A1), mRNA.
N           GNT1, UGT1, UDPGT,UDP glycosyltransferase 1 family,1 family, polypeptide A1
                        Homo sapiens UDP glucuronosyltransferase polypeptide A1 precursor
                                   UGT1A, UGT1*1, HUG-BR1
                                               cg07823755
    TCTGGCTCACCTCATGGCGCGTGCT[CG]TGTGGTGGGCTCTGCTGCAGCCTCAAGACC(UGT1A1), mRNA.
N           UDPGT, UGT1G, sapiens UDP glucuronosyltransferase 1 family, polypeptide
                        Homo UGT1*7 glycosyltransferase 1 family, polypeptide A7 precursor
                                  UDP          cg16671505
    CGCTAAGACCCTTGCTCTCTTTC[CG]TCGAACATGAGATGCCAATTTCTTTCTGGG A7 (UGT1A7), mRNA.
Y           DGU, UDG, UNG1, HIGM4, UNG15, DKFZp781L1143 UNG1 precursor
                        Homo sapiens uracil-DNA glycosylase (UNG), nuclear gene
                                  uracil-DNA cg04275157isoform
                                               glycosylase
    AGCAGAGGTGGGCTGAAGGCACAAAG[CG]AATGAAAGAATAGGCCCCCGG encoding mitochondrial protein,
N           HOM-TES-84/86 sapiens ubiquitin specific peptidase 29 (USP29), mRNA.
                        Homo      ubiquitin specific protease 29
                                               cg07368873
    GATGACTTGAGCCTTGGGGAT[CG]AGGGTGTAGTGAGGTATGATC
Y           HOM-TES-84/86 sapiens ubiquitin specific peptidase 29 (USP29), mRNA.
                        Homo      ubiquitin specific protease 29
                                               cg25357752
    CCCGTACCTAGACCCGTAGGT[CG]GGAGGCCTGCGCCCGGCACTGCGCA
Y           HOM-TES-84/86 sapiens ubiquitin specific peptidase 29 (USP29),
                        Homo      ubiquitin specific protease 29
                                               cg16675193
    TTTCTCTGAACCCTAACTCCTGC[CG]TTACGCCCCACCAGCTCTAGGCC mRNA.
N           EDB, VAMP5  Homo sapiens vesicle-associated membrane protein 8 (endobrevin) (VAMP8), mRNA.
                                  vesicle-associated membrane protein 8
                                               cg12542933
    GAGGGCCACCCTGGGAGGAAGC[CG]ACTAGGCGAATTCACTTACTGACCGG
N           EDB, VAMP5  Homo sapiens vesicle-associated membrane protein 8
                                  vesicle-associated membrane protein 8
                                               cg17641218
    CACTGGGAGGACAGTGAAGAATGCC[CG]CCTACCTGGGGAAACCTGAGT(endobrevin) (VAMP8), mRNA.
N           EDB, VAMP5  Homo sapiens vesicle-associated membrane protein
                                  vesicle-associated membrane protein 8
                                               cg05486094
    ATCAGGAGGTCCAGCCTCTGGAAACCT[CG]GAGGGCTGCTTGATCTTT 8 (endobrevin) (VAMP8), mRNA.
Y           VAV         Homo sapiens vav 1 oncogene (VAV1), mRNA.
                                  vav 1 oncogene
                                               cg02621492
    AAAGAAGAGGAAGTGGTAGCACTAGCTGT[CG]CTCCACAGGCGAGCAGGGCAGGCG
N           VAV         Homo sapiens vav 1 oncogene (VAV1), mRNA.
                                  vav 1 oncogene
                                               cg15322770
    TGGAGTCAGAAGACCAGCTGAGTGATGA[CG]GGGCTGGACCAGACAGAGGA
Y           .           Homo sapiens vav 2 oncogene (VAV2), mRNA.
                                  vav 2 oncogene
                                               cg00450851
    CACACCACCCGGTGGTTGGG[CG]GCAGGACCTTGCAATCGATGAGCCAG
Y           .           Homo sapiens vav 2 oncogene (VAV2), mRNA.
                                  vav 2 oncogene
                                               cg20425899
    AGGTGCTCTCCGGCCCAGGGT[CG]CAGCCGGCCCCGGTGCTGATCCG
Y           PFD3, PFDN3, VBP-1 vonvon Hippel-Lindau binding protein 1 (VBP1), mRNA.
                        Homo sapiens Hippel-Lindau binding protein 1
                                               cg10528799
    ATGAATGTGCATGGAGATGGAGAGG[CG]GGCCTGCAAGTGCGAACAAGCCAA
Y           PFD3, PFDN3, VBP-1 vonvon Hippel-Lindau binding protein 1 (VBP1), mRNA.
                        Homo sapiens Hippel-Lindau binding protein 1
                                               cg16091746
    CCTGTCGCTCCAGCTTCTCTTT[CG]CGGCCCTTCCACGCTTGTCACTTAC
Y           PFD3, PFDN3, VBP-1 vonvon Hippel-Lindau binding protein 1 (VBP1),
                        Homo sapiens Hippel-Lindau binding protein 1
                                               cg01756638
    TCGTGATGGCGCTAGGTCCCAGGTT[CG]CTAGCATCCGAGAGAGGGGATTG mRNA.
Y           .           PREDICTED: Homo sapiens vascular endothelialfactor B factor B (VEGFB), mRNA.
                                  similar to vascular endothelial growth growth
                                               cg03028312
    CGGCTAGGGCAGCGGCAGCCGCCACCATC[CG]AGCCAACCCAAGGCCCCGAGATCGT
Y           FLJ36605 Homo sapiens vimentin (VIM), mRNA.
                                  vimentin cg07185035
    GCCCCTTTGGCGTGGTGCCAC[CG]GACCCCTCTGGTTCAGTCCCA
Y           FLJ36605 Homo sapiens vimentin (VIM), mRNA.
                                  vimentin cg01393634
    GGTCTAACGGTTTCCCCTAAAC[CG]CTAGGAGCCCTCAATCGGCGGGAC
N           WEE1hu, DKFZp686I18166 tyrosine kinase pombe) (WEE1), mRNA.
                        Homo sapiens WEE1 homolog (S.
                                  wee1         cg15071685
    AAACAACAAAACCACATCAA[CG]AACATCCACTGATGTCCTGAATTCACAG
Y           INT1        Homo sapiens wingless-type MMTV integration site family, member 1 (WNT1), mRNA.
                                  wingless-type MMTV integration site family, member 1 precursor
                                               cg18054037
    GTCCCACCGTCGCGGGCAACAACCAAAGT[CG]CCGCAACTGCAGCACAGAGCGGGCAAA
Y           INT1        Homo sapiens wingless-type MMTV integration site family,
                                  wingless-type MMTV integration site family, member 1 precursor
                                               cg08133093
    CCATTGTCTGCGCCCCTAAC[CG]GTGCGCCCTGGTGCCACAGTGCGGCC member 1 (WNT1), mRNA.
Y           WNT-12 Homo sapiens wingless-type MMTV integration site family, member precursor
                                  wingless-type MMTV integration site family, member
                                               cg23890019
    CTTGGGGTGCACAGGCAAAGGCAAAC[CG]CCTTAGGGAGACCCAGTGGCAGCG 10B10B (WNT10B), mRNA.
Y           WNT-12 Homo sapiens wingless-type MMTV integration site
                                  wingless-type MMTV integration site family, member 10B precursor
                                               cg24626581
    CAAGGCACGGCTGGCCCCA[CG]CGCCCCAGGCACATTGACTCAGAC family, member 10B (WNT10B), mRNA.
Y           IRP, INT1L1 Homo sapiens wingless-type MMTV integration site family member 2 (WNT2), mRNA.
                                  wingless-type MMTV integration site family member
                                               cg14615962
    AAAGTTTCAAACGATGGGCCCAGCGAG[CG]ATAAAGGCCAGCCCGGACCGCCT 2 precursor
Y           IRP, INT1L1 Homo sapiens wingless-type MMTV integration site family
                                  wingless-type MMTV integration site family member 2 precursor
                                               cg02655774
    AGAGCATCCGTGGGCTCTCGGAG[CG]TGCGTTCCGGATTGCCGAGGCCAT member 2 (WNT2), mRNA.
Y           WNT13, XWNT2 sapiens wingless-type MMTV integration site family, member 2B (WNT2B), transcript
                        Homo      wingless-type MMTV integration site family, member
                                               cg07216964
    CATGTGGTTCTGACGCCAAGGCC[CG]GCTGCAACGTGCCCGACGGGCTACTCC 2B isoform WNT-2B2
Y           WNT13, XWNT2 sapiens wingless-type MMTV integration site family, member isoform WNT-2B2
                        Homo      wingless-type MMTV integration site family, member 2B 2B (WNT2B), transcript
                                               cg14928292
    CTAGATTGGAAGCCATGTGGTTCTGA[CG]CCAAGGCCCGGCTGCAACGTGCC
Y           hWNT5A Homo sapiens wingless-type MMTV integration site family,
                                  wingless-type MMTV integration site family, member 5A 5A (WNT5A), mRNA.
                                               cg16891776
    CAAGGGCAGGGCCTGGTCGGGG[CG]CAACTAGGGAGCCGCCGGTCCGGC member precursor
Y           hWNT5A Homo sapiens wingless-type MMTV integration site family, member 5A (WNT5A), mRNA.
                                  wingless-type MMTV integration site family,
                                               cg19344602
    CGTATCCCGTTCTTTCTCTCTT[CG]GGTTGATCTCTCTTTTCCCCGTTTT member 5A precursor
N           .           Homo sapiens wingless-type MMTV integration site family, member 8B (WNT8B), mRNA.
                                  wingless-type MMTV integration site family, member 8B
                                               cg16763828
    GGGGTAAATGGACAGCAGCCCTTTTCA[CG]AAATCCTGATGTCAGCATTGTAGAGAG precursor
N           .           Homo sapiens wingless-type MMTV integration site family, member precursor
                                  wingless-type MMTV integration site family, member 8B 8B (WNT8B), mRNA.
                                               cg05452625
    GATTTGCTATGTCTCTTCCCCC[CG]CTTCTTTCTTTGTCCTCTTTCTCCTGGTC
Y           RECQ3, RECQL2, RECQL3 syndrome protein
                        Homo sapiens Werner cg27071045
                                  Werner        syndrome (WRN), mRNA.
    GCCGCCTGACTTCGGACACCGGCCC[CG]CACCCGCCAGGAGGGGAGG
Y           RECQ3, RECQL2, RECQL3 syndrome protein
                        Homo sapiens Werner cg19052693
                                  Werner        syndrome (WRN), mRNA.
    TTTCAGGACACTGTGAGGATGCTCTT[CG]GACCCCACCGAGACTGGTGG
Y           GUD, WAGR, WT33, WIT-2 tumor 1 isoform B transcript variant B,
                        Homo sapiens Wilms tumor 1 (WT1),
                                  Wilms        cg20134916
    CGGAGAGCCCCCGGGTGTGGG[CG]CTGCCTTGAACTCCTTACCCCAGCTG mRNA.
Y           GUD, WAGR, WT33, WIT-2 tumor 1 isoform B transcript variant B, mRNA.
                        Homo sapiens Wilms tumor 1 (WT1),
                                  Wilms        cg08219028
    CCAAAGCCTGCGTATATTCCGGC[CG]GAGCATCCTGGCGCCCAGTTTGGGG
N           XCE, XIC, SXI1, swd66, DXS1089, DXS399E transcript (XIST) on chromosome X.
                        Homo sapiens X (inactive)-specific
                                  .            cg11717280
    CTGAGGGCGGAGAGAGCATAAGAGG[CG]TGGCCTAGAAGATTGAAAGCCG
N           XCE, XIC, SXI1, swd66, DXS1089, DXS399E transcript (XIST) on chromosome X.
                        Homo sapiens X (inactive)-specific
                                  .            cg15941992
    AAGAAATATGGCTGCAGCAGCGAATTGCAG[CG]CTTTAAGAACTGAAGGGGG
Y           XP3, XPCCHomo sapiens xeroderma pigmentosum, complementation group
                                  xeroderma cg23512686 complementation group C
                                               pigmentosum,
    AAGGGCGCAGGGTTTGAAACATGG[CG]GACGACGTAGACCAGGTAAGTGTATTT C (XPC), mRNA.
Y           RCC         Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 1 (XRC
                                  X-ray repaircg12562082
                                                 cross complementing protein 1
    GGCTAGGACAGCAAATCTGAGTGAATTTT[CG]TAGTTTCGTAGGGAACCTGGATT
N           DKFZp781P0919 sapiens X-ray repair complementing defective repair in Chinese hamster cells 2 (XRC
                        Homo      X-ray repaircg01999235
                                                 cross complementing protein 2
    CCTTGGCCTCTTCTCTACGTAGGGCTG[CG]GGCCCGTATCTGAAACATTAACAACCA
Y           Yes, c-yes, Homo sapiens v-yes-1 cg01817085sarcoma viral oncogene homolog 1 (YES1), mRNA.
                        HsT441, P61-YES
                                  viral oncogene yes-1 homolog 1
                                               Yamaguchi
    CGGTCCGTGTCACTTCTCC[CG]ACCCAACATGGCGGCGGGGTCCG
Y           Yes, c-yes, Homo sapiens v-yes-1 cg02999287sarcoma viral oncogene homolog 1 (YES1), mRNA.
                        HsT441, P61-YES
                                  viral oncogene yes-1 homolog 1
                                               Yamaguchi
    CCCTCATCACCATCCTGAT[CG]CCGTCCAAAAAACGTTCACGTCTTGC
N           SRK, STD, HomoZAP-70 zeta-chain (TCR) associated protein kinase 70kDa (ZAP70), transcript varian
                        TZK, sapiens
                                  zeta-chain associated protein kinase 70kDa isoform 1
                                               cg09006159
    GGTATGCAGGCTTCCTCCCTTCTGA[CG]GTTCCTGCTGCTGGAGTCGTCCTTCCTGA
Y           ZNF656 Homo sapiens zinc finger, imprinted 2 (ZIM2), mRNA.
                                  zinc finger, cg07746548
                                               imprinted 2
    CACTCACCTCACCTCAGTGCTG[CG]CAGCCTCGGGCACGAACAGCCGC
Y           ZNF656 Homo sapiens zinc finger, imprinted 2 (ZIM2), mRNA.
                                  zinc finger, cg01034638
                                               imprinted 2
    GCAGCTGCCCAGACTTCTGCAC[CG]AGGTGCAGCTCGACGCCTCCTTGTCA
N           ZNF657 Homo sapiens zinc finger, imprinted 3 (ZIM3), mRNA.
                                  zinc finger, cg22057816
                                               imprinted 3
    AAAACTTAATCGGCCCTCTACC[CG]CTGTATTCCGCATCATAATCCAGTCAA
Y           ZNF657 Homo sapiens zinc finger, imprinted 3 (ZIM3), mRNA.
                                  zinc finger, cg16859188
                                               imprinted 3
    AGGTGGAACAATGCCTTAAAGTGCTCTC[CG]CCCGACAGAAAGAATTCAGGCTCCAA
N           ZNF657 Homo sapiens zinc finger, imprinted 3 (ZIM3), mRNA.
                                  zinc finger, cg15131643
                                               imprinted 3
    CCTCCCAGGAGAAGAGGTATCCAAAGAT[CG]TATTAGCAAATGACCCTTGGCGGTG
Y           BLU, FLU Homo sapiens zinc finger, MYND-type containing 10 (ZMYND10), mRNA.
                                  zinc finger, cg20881888
                                               MYND domain-containing 10
    GGATGCTGTCACATTCGGGGACGA[CG]GACCCCGACGGTGCCAAAGTCT
Y           BLU, FLU Homo sapiens zinc finger, MYND-type containing 10 (ZMYND10),
                                  zinc finger, cg16621790
                                               MYND domain-containing 10
    ATGGCTTCTTGGTTCCTCTATTTCTCG[CG]TCCCGGCTCCACTAGTTGGCTCCTGA mRNA.
Y           BAZ2        Homo sapiens zinc finger protein 215 (ZNF215), mRNA.
                                  zinc finger protein 215
                                               cg01684596
    CGATTTGGACTAGTTTCCCCGGA[CG]GGATGAGGCAGCGCCGGAAGTATGACGCTC
Y           BAZ2        Homo sapiens zinc finger protein 215 (ZNF215), mRNA.
                                  zinc finger protein 215
                                               cg17958423
    TCTTTAAGCCACTAGAAGCTCAC[CG]TGAGTCCATTCACAGGGCCAGAG
Y           .           Homo sapiens zinc finger protein 264 (ZNF264), mRNA.
                                  zinc finger protein 264
                                               cg08504049
    AGGTCTGTAGCCACTGAGGGCCC[CG]GTCGGGGCCGCTTTGCAGGTCCCTA
Y           .           Homo sapiens zinc finger protein 264 (ZNF264), mRNA.
                                  zinc finger protein 264
                                               cg04803824
    GGGATGTGAAAGGGGGTCAGT[CG]CCAGGCGAGCTGAGGACCCAGTTC
Y           IK1, LYF1, hIk-1, IKAROS,zinc finger protein, subfamily 1A, 1 (Ikaros) (ZNFN1A1), mRNA.
                        Homo sapiens PRO0758, Hs.54452
                                  zinc finger protein, subfamily 1A, 1 (Ikaros)
                                               cg16550878
    GGAGGATTTACGAATGCTTGATGCCT[CG]GGAGAGAAAATGAATGGCT
N           IK1, LYF1, hIk-1, IKAROS,zinc finger protein, subfamily 1A, 1 (Ikaros) (ZNFN1A1),
                        Homo sapiens PRO0758, Hs.54452
                                  zinc finger protein, subfamily 1A, 1 (Ikaros)
                                               cg18789786
    AACCCCAGGTGCATCCCGAGGCCTGCCAC[CG]AAGCCCACTCAAGGCTGAATGCACGG mRNA.
Y           .           PREDICTED: Homo sapiens zona pellucida glycoprotein 3 3 precursor (Zona pellucida glyco
                                  similar to Zona pellucida sperm-binding protein (sperm
                                               cg21988999
    CGCAGTGCACGTTGTCCAGCAGGATGTGTC[CG]GTGCCATAGCCGAAGAAGGCGTTreceptor) (ZP3), mRNA.
N           .           PREDICTED: Homo sapiens zona pellucida glycoprotein 3 3 precursor (Zona pellucida glyco
                                  similar to Zona pellucida sperm-binding protein (sperm
                                               cg14667235
    GAGTGTACCACAAGGAGTTCTGGGATATT[CG]GAGGCACTTCTAGAACAGGACTGA receptor) (ZP3), mRNA.

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:9
posted:11/28/2011
language:English
pages:58