Gen�tica Vegetal - BG006 - T1 by 68DDn4F

VIEWS: 23 PAGES: 7

									                      UNIVERSIDADE FEDERAL DO PARANÁ
                      Setor de Ciências Biológicas
                      Departamento de Genética

                                                                               Mendel Furacão
              BG006 - GENÉTICA VEGETAL PARA AGRONOMIA
Prof Juarez Gabardo
Profª Lygia Vitória Galli Terasawa
Monitor: Nícolas Zendonadi dos Santos
                        Respostas da Lista de Exercícios
              T1 - NATUREZA E FUNÇÃO DO MATERIAL GENÉTICO


1) O DNA é composto de monômeros chamados nucleotídeos, sendo que cada um
   desses contém um ácido fosfórico, um açúcar de cinco carbonos (desoxirribose) e
   uma das quatro bases nitrogenadas: adenina (A), guanina (G), timina (T) e citosina
   (C). Apresenta dupla fita em hélice, logo as razões A/T e G/C são iguais a um, uma
   vez que as fitas são antiparalelas e complementares.
   O RNA é bastante similar ao DNA, porém difere em três pontos principais: o açúcar
   é a ribose; em vez de timina temos a pirimidina uracila (U); e caracteriza-se por
   apresentar uma única fita, de modo que as razões A/U e G/C geralmente diferem
   de um.


2) Gene: segmento do DNA, situado numa posição específica de um determinado
   cromossomo, que participa da manifestação fenotípica de um certo caráter.
   Alelo: forma alternativa de um gene, situada em um loco em cromossomos
   homólogos e responsável pelas diferentes manifestações fenotípicas do caráter.


3) Éxon é a porção dos genes dos eucariontes que é traduzida em uma cadeia
   polipeptídica (proteína).
   Íntron é a porção dos genes dos eucariontes que não é traduzida em uma cadeia
   polipeptídica. Estão presentes apenas no DNA e quando este é transcrito em uma
   molécula de RNA os íntrons são cortados por enzimas específicas, as
   endonucleases.


4) a) O código genético não é sobreposto.
      Um códon (trinca de nucleotídeos), não sobreposto pode ter qualquer outro
      códon como vizinho.




                                                                                    1
               T1 – NATUREZA E FUNÇÃO DO MATERIAL GENÉTICO
                           Genética Vegetal – BG006
                                                        Prof Juarez Gabardo
                                                        Profa Lygia Vitória Galli Terasawa


  Exemplo:
  Código não sobreposto: AAG CUU GGC
  Código sobreposto em duas bases: AAG AGC GCU CUU UUG UGG GGC


b) A unidade de código genético (códon) possui três nucleotídeos (ácido fosfórico
  + açúcar de cinco carbonos + uma das quatro bases nitrogenadas).
  1 códon = 3 nucleotídeos ↔1 códon = 1 aminoácido
  Logo, 3 nucleotídeos (n) = 1 aminoácido (a) → 3 : 1

  Exemplo:
          AAG CUU GGC UUA ... cadeia nucleotídica (n)
           aa1 aa2 aa3 aa4 ... cadeia polipeptídica (proteína) (a)


                                 n  12  3
                                  a    4


c) O código genético tem ponto inicial e ponto final.
  A leitura da fita de mRNA sempre começa por um ponto determinado, que é o
  códon 5’ AUG 3’. E o término da leitura dessa mesma fita se dá por códons de
  terminação: 5’ UAA 3’, 5’ UAG 3’ e 5’ UGA 3’, os quais não são lidos por tRNAs
  mas sim por proteínas específicas (fatores de terminação).


d) O código genético é universal.
  Embora os organismos sejam diferentes entre si, o sistema básico de síntese
  protéica é idêntico. Esta propriedade faz com que seja possível se inserir um
  gene de uma bactéria, que produz por exemplo uma substância inseticida, em
  uma planta e esta planta se tornar resistente ao ataque de qualquer inseto que
  não sobreviva na presença desta substância. Isto porque o gene responsável
  pela síntese desta substância na bactéria também o fará na planta desde que
  adequadamente inserido nesta.


e) O código genético não tem vírgulas.
  Poderia se pensar que para ocorrer a leitura correta dos códons fosse
  necessário a separação dos mesmos por um nucleotídeo que funcionaria como
  uma vírgula.


f) O código genético não é ambíguo.

                                                                                             2
                  T1 – NATUREZA E FUNÇÃO DO MATERIAL GENÉTICO
                              Genética Vegetal – BG006
                                                            Prof Juarez Gabardo
                                                            Profa Lygia Vitória Galli Terasawa


      Diz-se que um códon é ambíguo se ele codifica para dois ou mais aminoácidos
      diferentes. A ambigüidade pode ser observada somente em certas condições
      artificiais. Por exemplo, alterações no pH ou temperatura, ou presença de
      estreptomicina no meio de cultura fazem com que, em E. coli, o códon 5’ UUU
      3’ codifique para fenilalanina, bem como para leucina, treonina e isoleucina.


   g) O código genético é degenerado.
      Como existem 64 códons e 20 aminoácidos, então existe mais de um códon
      codificando um mesmo aminoácido, ou seja, códons sinônimos.


5) A Replicação é dia semi-conservativa pois cada molécula nova do DNA possui
   uma fita velha e uma nova gerada durante o processo.
6) Mutação gênica é toda alteração que venha a afetar a seqüência de bases
   nitrogenadas do DNA. As mutações são mudanças herdáveis que representam as
   bases genéticas da variação, e portanto servem como matéria-prima aos
   processos de melhoramento genético e evolução. Como as mutações são
   herdáveis, elas ocorrem a nível do gene, provocando alterações do mesmo e
   conseqüentemente produzindo novas formas alternativas – os alelos.
   As alterações nas seqüências de bases do DNA podem ser decorrentes da
   substituição de bases e da adição ou deleção de bases.


7) A substituição de bases causa alteração em um único códon no DNA. Sendo que
   este códon mutante pode ou não provocar mudança de um aminoácido ao longo
   da cadeia polipeptídica. A troca de uma purina - adenina ou guanina - por outra, ou
   de uma pirimidina - citosina ou timina - por outra, é denominada de transição;
   contudo, a substituição de uma purina por uma pirimidina, ou vice-versa, é
   denominada de transição.
                              A              C


                                                            Transição
                              G              T              Transversão

   A retirada ou a inclusão de uma única base provoca alterações na seqüência de
   DNA a partir do ponto em que ocorreu a deleção ou adição. Este tipo de mutação
   modifica completamente a seqüência de aminoácidos na cadeia polipeptídica
   sintetizada, a partir do ponto em que ocorreu a mutação. Uma das conseqüências


                                                                                                 3
                 T1 – NATUREZA E FUNÇÃO DO MATERIAL GENÉTICO
                             Genética Vegetal – BG006
                                                          Prof Juarez Gabardo
                                                          Profa Lygia Vitória Galli Terasawa


pode ser o desaparecimento do ponto final, produzindo, assim, uma cadeia
polipeptídica que certamente não será funcional.


7) Ambas as três mutações são decorrentes da substituição de bases do DNA.
Mutação silenciosa: mudança na seqüência de nucleotídeos do DNA resultando na
formação de um códon que codifica o mesmo aminoácido do códon anterior, em
razão da degenerescência do código genético. Logo, não altera a seqüência de
aminoácidos na cadeia polipeptídica, ou seja, a proteína a ser formada será a
mesma que aquela sintetizada antes da mutação ter ocorrido.
Mutação de sentido errado: é a mutação que dá origem a um novo alelo com
capacidade de codificar uma cadeia polipeptídica, diferente em algumas
propriedades. Geralmente provoca alterações no fenótipo, uma vez que a proteína
final a ser sintetizada difere daquela que seria formada antes da mutação ter
ocorrido.
Mutação sem sentido: mudança na seqüência de nucleotídeos do DNA, resultando
na formação de um códon que não codifica nenhum aminoácido, ou seja, na
formação de um códon de terminação no mRNA (5’ UAA 3’, 5’ UAG 3’ e 5’ UGA
3’). Portanto, provoca a terminação prematura da cadeia polipeptídica.


8) Alternativas corretas: b - c.
Tenha em mente que a base A sempre se liga com a T, assim como a G sempre
com a C. Recorde, também, que A e G pertencem ao grupo chamado de purinas,
enquanto a T e C são do grupo das pirimidinas.
Portanto, se tivermos, por exemplo, 15% de A teremos igualmente 15% de T, bem
como 35% de G e igualmente 35% de C.
G + A / C + T = 1 é verdadeiro, pois 0,35 + 0,15 / 0,35 + 0, 15 = 1
Pirimidinas / Purinas = 1 é verdadeiro, pois G + A / C + T = 1


9) a) 5’ AUGUUUGCGAUGAAAUCA 3’
b) Met Fen Ala Met Lis Ser

c.I) Fita sense: 3’ TACAAGCGCTACTTTAGT 5’
   mRNA:        5’ AUGUUCGCGAUGAAAUCA 3’
   Met Fen Ala Met Lis Ser

c.II) Fita sense: 3’ TACCAACGCTACTTTAGT 5’


                                                                                               4
                T1 – NATUREZA E FUNÇÃO DO MATERIAL GENÉTICO
                            Genética Vegetal – BG006
                                                       Prof Juarez Gabardo
                                                       Profa Lygia Vitória Galli Terasawa


    mRNA:       5’ AUGGUUGCGAUGAAAUCA 3’
    Met Val Ala Met Lis Ser
               OU
    Fita sense: 3’ TACTAACGCTACTTTAGT 5’
    mRNA:       5’ AUGAUUGCGAUGAAAUCA 3’
    Met Ile Ala Met Lis Ser


c.III) Fita sense: 3’ TACAACCGCTACTTTAGT 5’
     mRNA:       5’ AUGUUGGCGAUGAAAUCA 3’
     Met Leu Ala Met Lis Ser
               OU
     Fita sense: 3’ TACAATCGCTACTTTAGT 5’
     mRNA:        5’ AUGUUAGCGAUGAAAUCA 3’
     Met Leu Ala Met Lis Ser


c.IV) Fita sense: 3’ CACAAACGCTACTTTAGT 5’
     mRNA:        5’ GUGUUUGCGAUGAAAUCA 3’
      Val Fen Ala Met Lis Ser


   c.V) Fita sense: 3’ TACAAACGCCACTTTAGT 5’
        mRNA:       5’ AUGUUUGCGGUGAAAUCA 3’
        Met Fen Ala Val Lis Ser


   c.VI) Fita sense: 3’ TACAAAACGCTACTTTAGT 5’
        mRNA:       5’ AUGUUUUGCGAUGAAAUCA 3’
        Met Fen Cis Asp Glu Ile


10) a) Met Ala Leu Tre FIM
b) Leitura com sobreposição:
   5’AUGUGGGGCGCCCCUCUUUUAUAAAACACGCGUGUAUAAAACACUCUU 3’
   Met Trp Gli Ala Pro Leu Leu FIM


c) Caso a: toda a seqüência de aminoácidos muda a partir deste ponto.
  Caso b: haverá apenas a síntese de metionina, uma vez que o segundo códon
  será considerado um códon de terminação.


                                                                                            5
                    T1 – NATUREZA E FUNÇÃO DO MATERIAL GENÉTICO
                                Genética Vegetal – BG006
                                                              Prof Juarez Gabardo
                                                              Profa Lygia Vitória Galli Terasawa


     Ambas as mutações poderão ser muito prejudiciais. Mas, nesta situação
     específica o caso b seria mais prejudicial, uma vez que a síntese da cadeia
     polipeptídica (proteína) estaria comprometida. Porém, em geral, no caso a a
     mutação por adição é mais prejudicial, pois toda a seqüência de aminoácidos, a
     partir daquele ponto, é alterada e no caso b no máximo três aminoácidos.


    d) Na mutação por substituição o caso b é mais prejudicial, pois a substituição de
       um nucleotídeo pode alterar até três aminoácidos na proteína. Enquanto, no
       caso a, no máximo um aminoácido é alterado.


11) Fita 5’→3’: 20% A + 30% G + 10% C + 40% T = 100%
   Fita 3’→5’: 20% T + 30% C + 10% G + 40% A = 100%
             20  40                              30  10
    AT              100  30%     CG                  100  20%
              200                                  200

12) A ↔ T = 15%
    C ↔G = 35%


13) mRNA : 20%U 30%A 15%G 35%C
                                           20%A 30%T 15%C 35%G
   DNA :    20%A 30%T 15%C 35%G            20%T 30%A 15%G 35%C


              20  30                     15  35
    AT               100  25% C  G           100  25%
               200                         200


14) a) Quando se fala em gene, é considerada a hélice dupla do DNA. Portanto, neste
caso, há 606 bases nitrogenadas por fita do DNA. Cada aminoácido é composto por
três bases nitrogenadas. Para efeito de cálculo, exclusivamente, deste item, são
desconsideradas as três últimas bases de cada fita, pois essas não são responsáveis
pela síntese se aminoácido, mas, sim, como ponto final na síntese da cadeia
polipeptídica. Logo, 606-3= 603 bases e dividindo esse total por 3, ter-se-á o número

de aminoácidos da proteína. Portanto, 603  201aa
                                           3


   b) 606 bases.
     O número de bases do mRNA é igual ao número de bases de uma das fitas do
     DNA, a fita sense, a qual será transcrita.


   c) 201 tRNA’s.
                                                                                                   6
                  T1 – NATUREZA E FUNÇÃO DO MATERIAL GENÉTICO
                              Genética Vegetal – BG006
                                                            Prof Juarez Gabardo
                                                            Profa Lygia Vitória Galli Terasawa


     Para cada grupo de três bases, ou seja, para cada códon existe um tRNA
     específico. Logo, o número de tRNA’s envolvidos será igual ao número de
     aminoácidos sintetizados.
15) 21.960 nucleotídeos.
   A leitura da fita de mRNA sempre começa por um ponto determinado, o códon 5’
   AUG 3’, o qual sintetiza metionina. Portanto, afirmar que “o primeiro aminoácido de
   todas as proteínas não seja a metionina” significa que este aminoácido foi
   removido e o segundo passou a ser o ponto inicial da cadeia polipeptídica. No
   entanto, é imprescindível a presença do códon AUG para que a síntese da
   proteína inicie-se. Assim sendo, acrescenta-se um aminoácido ao total de 120.
   Deve-se incluir, também, as três últimas bases, o códon de terminação, que,
   embora, não sintetize aminoácido é necessária a sua presença para que a síntese
   da proteína final seja concluída. Logo, terminamos com um total de 122 códons, os
   quais   necessariamente    estão   relacionados   com   a   síntese       da    proteína.
   Multiplicando-se 122 códons por 3 teremos um total de 366 nucleotídeos.
   Finalmente, multiplicando-se 366 nucleotídeos por 60 chegaremos ao número total
   de nucleotídeos dos éxons relacionados com a síntese dessas proteínas.




                                                                                                 7

								
To top