Basic Genetics by HC111123194236

VIEWS: 15 PAGES: 62

									         Introductory Genetics




http://www.stats.gla.ac.uk/~paulj/intro_genetics.ppt
                          Overview of talks

• This talk: broad overview of genetics
• Future talks: genetic data analysis
    – Important general genetic concepts
        • heritability, penetrance, linkage/linkage disequilibrium, Hardy-
          Weinberg equilibrium
    – Types of genetic analysis
        • association analysis
            – family-based vs population-based
            – candidate gene vs genome scan
            – genotype v haplotype
            – problems: population stratification, missing data, data errors,
               inferring haplotypes
        • twin studies
    – “Omics”: genomics, proteomics, metabolomics, genetical genomics,
      integrative genomics
                   Overview of this talk

•   Why genetics is important
•   How genes work
•   Mendel’s laws of inheritance for simple genetic traits
•   “Post-genomic” genetics
Why genetics is important
                 Genetics




                 G×E
              interaction


Environment                 Health
                                                 ISI Web of Science topic search for "genetic AND disease"

                            8000


                            7000


                            6000
Number of journal records




                            5000


                            4000


                            3000


                            2000


                            1000


                               0
                                   1991



                                          1992



                                                   1993



                                                          1994



                                                                 1995



                                                                        1996



                                                                               1997



                                                                                      1998



                                                                                             1999



                                                                                                    2000



                                                                                                           2001



                                                                                                                  2002



                                                                                                                         2003



                                                                                                                                2004



                                                                                                                                       2005
How genes work
                         What is a gene?
• A gene is a stretch of DNA whose sequence determines
  the structure and function of a specific functional
  molecule (usually a protein)
             …GAATTCTAATCTCCCTCTC                        …function
             AACCCTACAGTCACCCATTT                        sf(){document.
    DNA      GGTATATTAAAGATGTGTTG   Computer program
                                                         f.q.focus()}…
             TCTACTGTCTAGTATCC…


   mRNA                               Working copy



   Protein                           Specific function
Genes are located in the cell nucleus on chromosomes


                                   Karyotype
Down syndrome karyotype (trisomy 21)
         DNA                     Protein
(deoxyribonucleic acid)




                          mRNA
Transcription movie
Translation
Translation
Translation
Translation movie
Gene expression movie
                       Summary

• A gene is a length of DNA that contains instructions for
  making a specific protein
• Genes are arranged along 23 pairs of chromosomes in
  the cell nucleus
• Genes work by specifying the amino acid sequence of a
  protein
Mendel’s laws
Genetic knowledge used for 1000s of years: agriculture
Patterns of disease inheritance known for 1000s of years,
                     e.g. haemophilia
Mendel deduced the underlying principles of genetics from
                    these patterns

  1. Segregation
  2. Dominance
  3. Independent assortment
Mendel’s experiments
Mendel’s data
               Mendel’s law of segregation
•   A normal (somatic) cell has two variants (alleles) for a Mendelian
    trait.
•   A gamete (sperm, egg, pollen, ovule) contains one allele,
    randomly chosen from the two somatic alleles.
•   E.g. if you have one allele for brown eyes (B) and one for blue
    eyes (b), somatic cells have Bb and each gamete will carry one
    of B or b chosen randomly.
                                    Sperm


                                  B      b
                           B BB Bb
                  Eggs
                            b    Bb bb
                Mendel’s law of dominance

• If your two alleles are different (heterozygous, e.g. Bb), the trait
  associated with only one of these will be visible (dominant) while the
  other will be hidden (recessive). E.g. B is dominant, b is recessive.




                                    Sperm


                                   B     b
                            B BB Bb
                   Eggs
                            b     Bb bb
                Mendel’s law of dominance

• If your two alleles are different (heterozygous, e.g. Bb), the trait
  associated with only one of these will be visible (dominant) while the
  other will be hidden (recessive). E.g. B is dominant, b is recessive.




                                    Sperm


                                   B     b
                            B BB Bb
                   Eggs
                            b     Bb bb
                     Terminology…



• Haploid:
  containing one
  copy of each                      • Diploid:
  chromosome               Sperm      containing two
  (n=23)                              copies of each
                          B   b       chromosome
                                      (2n=46)
                      B BB Bb
              Eggs
                      b   Bb bb
                        Terminology…

• Genotype: the states of the two alleles at one or more locus
  associated with a trait
• Phenotype: the state of the observable trait




                 Genotype             Phenotype
               BB (homozygous)         Brown eyes
              Bb (heterozygous)        Brown eyes
               bb (homozygous)          Blue eyes
       Mendel’s law of independent assortment

• Knowledge of which allele has been inherited at one locus gives no
  information on the allele has been inherited at the other locus




                        S/s         Y/y




              SY          Sy         sY         sy


              25%         25%        25%        25%
  Mendel’s law of independent assortment


Gametophytes   S       Y
(gamete-
producing      s       y
cells)

                   Segregation

               S       Y

               s       y
Gametes
               A       b
                                 Recombinants
               a       B
  Mendel’s law of independent assortment


Gametophytes   S       Y
(gamete-
producing      s       y
cells)
                   Recombination
                   Segregation

               S       Y

               s       y
Gametes
               S       y
                                   Recombinants
               s       Y
        Statistical aside:
Mendel’s data too good to be true?
                       Human eye colour

• Simplified view of eye colour inheritance: biallelic
  Mendelian trait

   – Brown dominant:         BB, Bb

   – Blue recessive:         bb                 Sperm


                                               B    b
                                         B BB Bb
                                  Eggs
                                         b    Bb bb
Human eye colour




            ?

What is the probability of a child
being born with blue eyes?
Human eye colour




       ?
          Human eye colour


                     B?        bb
B?         B?



     bb     B?
                          B?




                 ?
          Human eye colour


                     B?        bb
Bb         Bb



     bb     B?
                          Bb




                 ?
     Human eye colour


Bb    Bb



       B?
                    Bb




            ?
     Human eye colour


Bb    Bb



           P(BB)=1/3
           P(Bb)=2/3   Bb




                  ?
            Human eye colour


Bb             Bb



                    P(BB)=1/3
                    P(Bb)=2/3              Bb



     P(b)=2/3x1/2=1/3           P(b)=1/2

                           ?
            Human eye colour


Bb             Bb



                    P(BB)=1/3
                    P(Bb)=2/3              Bb



     P(b)=2/3x1/2=1/3           P(b)=1/2

                           ?

                P(bb)=1/3x1/2=1/6
         Non-Mendelian inheritance: Haemophilia


• Haemophilia A
• Males with a mutant gene are
  affected
• Females with one mutant gene
  are unaffected carriers
Non-Mendelian inheritance: additive traits


                               Dominant vs additive inheritance

                    100%

      Trait value




                                                                      Dominant
                    50%
                                                                      Additive




                     0%
                           0                   1                  2
                                 Number trait alleles inherited
Non-Mendelian inheritance: additive traits
      Brown eye colour is dominant
                               Dominant vs additive inheritance

                    100%

      Trait value




                                                                      Dominant
                    50%
                                                                      Additive




                     0%
                           0                   1                  2
                                 Number trait alleles inherited
Non-Mendelian inheritance: additive traits
    Snapdragon red colour is additive
                               Dominant vs additive inheritance

                    100%

      Trait value




                                                                      Dominant
                    50%
                                                                      Additive




                     0%
                           0                   1                  2
                                 Number trait alleles inherited
Non-Mendelian inheritance: polygenic traits

                    Distribution of trait measures for single gene additive trait

              0.6


              0.5


              0.4
  Frequency




              0.3


              0.2


              0.1


               0
                          0                        1                       2
                                             Trait value
Non-Mendelian inheritance: polygenic traits

                     Distribution of trait measures for polygenic additive trait (2 loci)


               0.4

              0.35

               0.3

              0.25
  Frequency




               0.2

              0.15

               0.1

              0.05

                0
                          0              1              2              3              4
                                                  Trait value
Non-Mendelian inheritance: polygenic traits

                    Distribution of trait measures for polygenic additive trait (10 loci)


              0.2

             0.18

             0.16

             0.14
 Frequency




             0.12

              0.1

             0.08

             0.06

             0.04

             0.02

               0
                                                   10

                                                          12

                                                                 14

                                                                        16

                                                                               18

                                                                                       20
                0

                        2

                               4

                                      6

                                             8




                                                  Trait value
Non-Mendelian inheritance: polygenic traits
           For example, height
Non-Mendelian inheritance: mtDNA
    Phenotypes associated with mtDNA mutations

•   Longevity
•   Optic neuritis
•   Occipital stroke in migraine
•   Asthenozoospermia
•   Migraine without aura
•   Cyclic vomiting syndrome
•   Bipolar disorder
•   Athletic performance
                         Summary

• Mendel deduced three simple laws of inheritance:
   – Segregation
   – Dominance
   – Random assortment
• The majority of traits don’t follow these rules but
  Mendel’s laws are nevertheless crucial to understanding
  almost all genetic inheritance
“Post-genomic” genetics
                 Human Genome Project

• Sequenced almost all 3 billion DNA base pairs (2003)
• Current work includes:
   – ENCODE Project (ENCyclopedia Of DNA Elements) to
     characterise functional elements in genome
      • 20,000-25,000 genes (1.5% of genome)
      • The bits in between (98.5% of genome)
   – Characterise human DNA sequence variation
      • Find and describe DNA sequence variation (International
        HapMap Project)
      • Find significance of sequence variation (e.g. contribution to
        complex diseases)
HapMap project
        Frequency
Case    0.200       Odds ratio: 1.26
Control 0.165
1. Eye-catching headline
   of the form “Gene
   for…”

2. Highly qualified factual
   paragraph
   HTR1D




HTR1D
                             Summary

• Post-genomic genetics has enormous promise for
  tracking down the genes involved in common complex
  diseases
• Currently our ability to exploit this potential is limited by
   – study size
   – difficulty of correcting for confounding factors

								
To top