Table 1s. Primer sequences used for RT-PCR analyses.
Gene Size Primer Sequence (5’ to 3’)
ABCG2 684 bp hABCG2-F gtttatccgtggtgtgtctgg
hABCG2-R ctgagctatagaggcctggg
Connexin 43 295 bp hCx43-F taccatgcgaccagtggtgcgct
hCx43-R gaattctggttatcatcggggaa
Connexin 45 819 bp hCx45-F ctatgcaatgcgctggaaacaaca
hCx45-R ccctgatttgctactggcagt
DNA methyltransferase 189 bp hDNMT3L-F ctctcaagctccgtttcacc
3-like (DNMT3L) hDNMT3L-R gtacaggaagagggcatcca
Dppa 5 353 bp hDppa5-F atgggaactctcccggcacg
hDppa5-R tcacttcatccaagggccta
E-Ras 152 bp hERas-F gctgtctgtgatggtgtgct
hERas-R tctccagcagtggtcacaag
G3PDH 474 bp hGAPD-F gctcagacaccatggggaaggt
hGAPD-R gtggtgcaggaggcattgctga
Beta Actin 838 bp hACTB-F caccttctacaatgagctgcg
HACTB-R tgcttgctgatccacatctgc
*Cardiac actin 164 bp hCRD-F gccctggattttgagaatga
hCRD-R atgccagcagattccatacc
*Keratin 8 161 bp hKRT8-F tgaggtcaaggcacagtacg
hKRT8-R tgatgttccggttcatctca
*Keratin 18 164 bp hKRT18-F cacagtctgctgaggttgga
hKRT18-R gagctgctccatctgtaggg
*ß-tubulin 5 161 bp hTUBB5-F cagtgacctgcaactggaga
hTUBB5-R gattggccaaacacgaagtt
NR0B1 154 bp hDax1-F gactccagtggggaactcag
(Dax-1 protein) hDax1-R atgatgggcctgaagaacag
Oct3/4 171 bp hOct3/4-F cttgctgcagaagtgggtggaggaa
hOct3/4-R ctgcagtgtgggtttcgggca
Rex-1 559 bp hRex1-F tgaaagcccacatcctaacg
hRex1-R caagctatcctcctgctttgg
hTERT 147 bp LT5 cggaagagtgtctggagcaa
LT6 ggatgaagcggagtctgga
UTF-1 230 bp hUTF1-F accagctgctgaccttgaac
hUTF1-R ttgaacgtacccaagaacga
**PSIP1 408 bp hPSIP2101-F gagtagtgacaacagcaacagcatc
hPSIP2101-R tgtgagcagtctgaaagttcctccc
**pro-Galanin 156 bp hGal-F aaggaaaaacgaggctggac
hGal-R ggacctgtcaaagcttcctg
FBX15 172 bp hFBX15-F ctcccaccaaacatagactccgatg
hFBX15-R gccataacaaaagccagttcttcctc
Eras/Hrasp 160 bp hEras-F accagtgcttcgtggaggac
hEras-R acaccatcacagacagccag
#Zinc finger protein 43 151 bp hZNF43-F accaatgtttgccagctacc
hZNF43-R atgcaaaatgatttgccaca
#Zinc finger protein 296 193 bp hZNF342-F gaaggcatcacccaaaaaga
hZNF342-R gcggttgagcttactgctct
#Nanog 164 bp hNanog-F agtcccaaaggcaaacaacccacttc
hNanog-R atctgctggaggctgaggtatttctgtctc
#KIAA1573 protein 316 bp hKIAA1573-F ctggagaatgacagagatgaaagggac
hKIAA1573-Rggtagtggtggaacttgtgacttagtagg
#KIAA1265 194 bp hKIAA-F cctttgccctgcattgttat
hKIAA-R agatcacgcctagcaaggaa
#MGC27165 257 bp hMGC27165-F tcaacatccacagcgagacctc
hMGC27165-R tgtcagagagccgaataccagtg
#**GSH1 110 bp hGSH1-F aaggctgggctgctgtgcgtg
hGSH1-R ccgaaggctgggaaggaagc
#HNRPA1 166 bp hHNRPA1-F ctgcctgggaatctaaagggactaag
hHNRPA1-R acacacacacacacacacacacagag
#PPAT 406 bp hPPAT-F cgcctgctgctcttgcttatgc
hPPAT-R ccttctactgacagatacacaacactg
# Lamin Receptor 187 bp hLAMR-F agcatccaccacatcaaacccactgag
hLAMR-R accttccaggagccacagcatcttttc
**GDF3 311 bp hGDF3-F ttcgctttctcccagaccaaggtttc
hGDF3-R tacatccagcaggttgaagtgaacagcacc
#ARL8 355 bp hARL8-F gccaccccatagccatagtcattttg
hARL8-R gtctgcctcataaagttggtctcc
#TD-60 312 bp hTD60-F cctaaactctcttacatccaccgcttgg
hTD60-R tatcattgggaggcactgttcactcg
#TNNT1 403 bp hTNNT1-F agagccagaagaggaacgccccaaac
hTNNT1-R cttgaccaggtagccgccaaaatgg
#Numatrin 349 bp hNPM1-F tcgtttatctccatctgccttctcccctac
hNPM1- R agagcactggtggtgttatttcaaagcccc
______________________________________________________________________
*marked primers are for the atypical genes known as early stage differentiation markers,
**marked genes showed no expression in EST enumeration, and #marked genes are for
novel and zinc finger proteins. Bold primers are used as internal control in RT-PCR
analysis.
Table 2s: Functional categorization of 92 common genes over-expressed (>3 fold) in six
huES cell linesa.
Functional Gene Nameb Gene Bank ID Fold Gene Annotation
classifications Expressionc
Undifferentiated GAL# M77140 33 Galanin
cell marker (6)
POU5F1/Oct4 Z11898 28 POU domain, class 5,
transcription factor 1
PODXL U97519 14 Podocalyxin-like
GDF3# NM_020634 13 Growth differentiation
factor 3
GJA1 NM_000165 10 Gap junction protein,
alpha 1, 43kDa (connexin
43)
Nanog NM_024865 6 Nanog
(FLJ12581)
Differentiation KRT18** M26326 23 Keratin 18
markers (5)
ACTC** J00073 22 Actin, alpha, cardiac
muscle
KRT8** X74929 17 Keratin 8
TNNT1** M19309 7 Troponin T1, skeletal,
slow
TUBB-5** AF070600 5 Beta-5 tubulin
Cell signal/cell LIN-28 NM_024674 28 RNA-binding protein
cycle /cell LIN-28
development (19)
SEMA6A AF225425 25 Sema domain,
transmembrane domain
(TM), and cytoplasmic
domain, (semaphorin) 6A
CRABP2 M97815 19 Cellular retinoic acid
binding protein 2
LEFTB AF081507 18 Left-right determination,
factor B
NME2 M36981 11 Non-metastatic cells 2,
protein (NM23B)
expressed in
CCNB1 M25753 10 Cyclin B1
CDC2 X05360 9 Cell division cycle 2, G1
to S and G2 to M
SFRP2 AF311912 8 Secreted frizzled-related
protein 2
IMP-2 NM_006548 8 IGF-II mRNA-binding
protein 2 (embryogenesis
and morphogenesis)
PITX2# AF048722 7 Paired-like homeodomain
transcription factor 2
CALU AF257659 5 Calumenin
PTTG1 AJ223953 6 Pituitary tumor-
transforming 1
SET M93651 6 SET translocation
(myeloid leukemia-
associated)
BRIX AK001962 6 BRIX
PSIP1# AF063020 6 PC4 and SFRS1
interacting protein 1
CRABP1 S74445 5 Cellular retinoic acid
binding protein 1
TDGF1 X14253 5 Teratocarcinoma-derived
growth factor 1
MAD2L2 NM_006341 4 MAD2 mitotic arrest
deficient-like 2 (yeast)
STK12 AF015254 4 Serine/threonine kinase
12
Metabolism
1) DNA / RNA SNRPF X85372 23 Small nuclear
related (21) ribonucleoprotein
polypeptide F
NPM1 NM_002520 23 Nucleophosmin
(nucleolar
phosphoprotein B23,
numatrin)
SSB X69804 20 Sjogren syndrome
antigen B (autoantigen
La)
EIF4A1 D13748 18 Eukaryotic translation
initiation factor 4A,
isoform 1
RPL6 X69391 17 Ribosomal protein L6
RPS24 M31520 15 Ribosomal protein S24
DDX21 U41387 14 DEAD/H (Asp-Glu-Ala-
Asp/His) box polypeptide
21
HNRPAB U76713 12 Heterogeneous nuclear
ribonucleoprotein A/B
HMGIY L17131 12 High-mobility group
(nonhistone
chromosomal) protein
isoforms I and Y
KPNA2 U28386 11 Karyopherin alpha 2
(RAG cohort 1, importin
alpha 1)
NS NM_014366 9 Nucleostemin
NBR2 U88573 8 NBR2 (close proximity to
BRCA1: acts as bi-
directional promoter)
tumor suppressor
Jade-1 NM_024900 8 PHD protein Jade-1
RPLP0 AK001313 7 Ribosomal protein, large,
P0
HMGB2 X62534 6 High-mobility group box
2
RPL24 M94314 6 Ribosomal protein L24
RPL4 D23660 6 Ribosomal protein L4
RAMP NM_016448 6 RA-regulated nuclear
matrix-associated protein
HDAC2 U31814 5 Histone deacetylase 2
EPRS X54326 5 Glutamyl-prolyl-tRNA
synthetase
RPL7 X57958 4 Ribosomal protein L7
2) metabolic SLC16A1 AL162079 19 Solute carrier family 16
activity (23) (monocarboxylic acid
transporters), member 1
ELOVL6 NM_024090 19 ELOVL family member
6, elongation of long
chain fatty acids
(FEN1/Elo2, SUR4/Elo3-
like, yeast)
CYP26A1 AF005418 18 Cytochrome P450, family
26, subfamily A,
polypeptide 1
FABP5 M94856 18 Fatty acid binding protein
5 (psoriasis-associated)
LDHB X13794 15 Lactate dehydrogenase B
SPS U34044 14 Selenophosphate
synthetase
SMS AD001528 14 spermine synthase
KIF4A AF071592 11 Kinesin family member
4A
PSMA2 D00760 10 Proteasome (prosome,
macropain) subunit, alpha
type, 2
CCNC M74091 9 Cyclin C
HSPA4 AB023420 8 Heat shock 70kDa
protein 4
MGST1 J03746 7 Microsomal glutathione
S-transferase 1
TK1 K02581 7 Thymidine kinase 1,
soluble
PSMA3 D00762 6 Proteasome (prosome,
macropain) subunit, alpha
type, 3
MTHFD2 X16396 6 Methylene
tetrahydrofolate
dehydrogenase (NAD+
dependent),
methenyltetrahydrofolate
cyclohydrolase
IMPDH2 L33842 6 IMP (ionosine
monophosphate
dehydrogenase 2)
SERPINH1 D83174 6 Serine (or cysteine)
proteinase inhibitor, clade
H (heat shock protein
47), member 1, (collagen
binding protein 1)
MTHFD1 J04031 5 Methylenetetrahydrofolat
e dehydrogenase
(NADP+ dependent),
methenyltetrahydrofolate
cyclohydrolase,
formyltetrahydrofolate
synthetase
IDH1 AF020038 5 Isocitrate dehydrogenase
1 (NADP+), soluble
HSSG1 AF055270 5 Heat-shock suppressed
protein 1
CCT8 D13627 4 Chaperonin containing
TCP1, subunit 8 (theta)
LAPTM4B AJ276485 3 Lysosomal associated
protein transmembrane 4
beta
TUBB-4 AK001295 4 Tubulin beta -4
Zinc finger ZNF117 NM_024498 6 Zinc finger protein 117
protein (3) (HPF9)
ZNF257 AF070651 5 Zinc finger protein 257
ZNF43 X59244 4 Zinc finger protein 43
(HTF6)
Hypothetical/Nov Numatrin AL353580 17 Human DNA sequence
el protein (12) from clone RP11-248N6
on chromosome 13
Contains ESTs, STSs and
GSSs. Contains two
olfactory receptor
pseudogenes
GSH1# AL390738 12 Human DNA sequence
from clone RP11-438F9
on chromosome 13
Contains the gene for the
ortholog of mouse
MGC27165 J04164 12 Hypothetical protein
MGC27165 [interferon
induced transmembrane
protein 1(9-27)]
HNRPA1 AL050348 10 Human DNA sequence
(C20orf168) from clone RP3-447F3
on chromosome 20 and
contains TNNC2
(troponin C2, fast) gene
TD-60 AB040903 9 RCC1-like
KIAA1573 AB046793 9 KIAA1573 protein
PPAT XM_010918 9 Homo sapiens
hypothetical gene
supported by
XM_010918
(LOC65365), mRNA
C20orf1/TPX2 AB024704 8 Chromosome 20 open
reading frame 1
Ribosomal AL136306 8 Human DNA sequence
40A Lamin from clone RP3-334F4
receptor on chromosome 6
contains ESTs, STSs and
GSSs. Contains a LAM.
C20orf129 BC001068 5 Chromosome 20 open
reading frame 129
ARL8 AL133611 4 Sapiens mRNA; cDNA
DKFZp434O1317 (from
clone DKFZp434O1317)/
ADP-ribosylation factor-
like 8
C15orf15 NM_016304 8 Chromosome 15 open
reading frame 15
Others (3) NASP M97856 10 Nuclear autoantigenic
sperm protein (histone-
binding)
LRRN1 AB040930 8 Leucine rich repeat
neuronal 1
DSG2 Z26317 3 Desmoglein 2
ES cell specific *CD24, *DNMT3B,
genes over *SOX2, *ACVR2B,
expressed in 4 of *CER1
the 6 cell linesb (5)
Known markers Rex-1, Utf1, TERT,
didn’t meet our LIFR, Connexin 45,
criteria or not Fox-D3, FoxH1, ESG1
expressed (8)
a
Total RNA was extracted from five huES cell lines (TE06, GE01, GE09, BG01, BG02)
and a pooled set of subclones (derived from GE01, GE07, GE09 cell lines). Microarray
analysis was performed as described in methods.
b
Genes marked by showed over expression in four of six cell lines (3 fold expression).
These genes are also known as markers of undifferentiated ES cells. Genes marked by #
showed no expression in Geron’s database, while genes marked by ** are atypical genes
which can be termed as early differentiation markers of huES cells. Bold and italics
genes are some known markers of undifferentiated huES cells, which didn’t meet our
criteria of fold expression or not expressed in the present study.
c
Fold expression described is derived from BG02 cell line only.
Table 3s. Early differentiation marker genes expressed in 6 huES cell lines
Gene Enriched by RT- ES EB FET
microarray PCR
Keratin 8 Y ++ 9 71 *
Keratin 18 Y ++ 8 46 *
ACTC Y ++ 1 4
TUBB5 Y ++ 5 8
TNNT1 Y ++ 5 1
Y = present by microarray; ++ = present by RT-PCR
The ES and EB column indicate the number of ESTs found in the undifferentiated huES
cells (ES) and in embryoid bodies (EB) by EST enumeration. Differences in expression
levels based on the EST frequencies were evaluated for statistical significance using the
Fisher Exact Test (FET) with a p-value of p<0.05 (see Material and Methods).
Table 4s. Comparison of expression of 15 genes highly expressed by microarray and RT-
PCR but not by EST enumeration.
Gene Array ES/EB RT-PCR
PSIP1 Y 0/1 ++
Galanin Y 0 ++
GSH1 Y 0 ++
GDF3 Y 0 ++
PITX2 Y 0/2 N/D
RPL24 Y N/F N/D
RPL4 Y N/F N/D
SNRPF Y N/F N/D
HMGIY Y N/F N/D
TD-60 Y N/F N/D
HSSG1 Y N/F N/D
CALU Y N/F N/D
C20orf168 Y N/F N/D
Numatrin Y N/F N/D
Ribosomal 40A Lamin R Y N/F N/D
Y = Detected by microarray, N/F=not found, N/D=not done and + = detected by RT-
PCR
Table 5S. EST enumeration analysis of human ES cells.
a
Gene name Accession ES EB FET
number
HSPA4 AB023420 9 0 *
ELOVL6 NM_024090 5 0 *
LEFTB AF081507 4 0
PTTG1 AJ223953 4 0
CYP26A1 AF005418 4 0
PSMA3 D00762 3 0
C20orf129 BC001068 3 0
FABP5 M94856 3 0
KIAA1573 AB046793 2 0
ZNF257 AF070651 2 0
FLJ12581 NM_024865 2 0
CRABP1 S74445 1 0
POU5F1/Oct4 Z11898 24 1 *
TDGF1 X14253 20 1 *
SEMA6A AF225425 16 1 *
NASP M97856 58 7 *
CCNB1 M25753 8 1 *
SFRP2 AF311912 7 1 *
RPL17 X53777 7 1 *
Jade-1 NM_024900 6 1
RAMP NM_016448 6 1
NS NM_014366 5 1
TNNT1 M19309 5 1
MGC27165 J04164 4 1
HDAC2 U31814 4 1
KPNA2 U28386 19 6 *
SLC16A1 AL162079 22 7 *
CCNC M740914 3 1
MGST1 J03746 3 1
RPL6 X69391 36 13 *
HMGB2 X62534 18 7
PODXL U97519 59 23 *
MTHFD2 X16396 7 3
DDX21 U41387 18 9
IMPDH2 L33842 14 7
RSP24 M31520 6 3
MAD2L2 NM_006341 6 3
LIN-28 NM_024674 26 13 *
NBR2 U88573 2 1
PSMA2 D00760 6 3
TK1 K02581 4 2
STK12 AF015254 2 1
PPAT XM_010918 4 2
CRABP2 M97815 9 5
RPL7 X57958 13 8
CDC20 U05340 7 6
BRIX AK0019625 3 2
LDHB X13794 37 27
CDC2 X05360 5 4
SSB X69804 5 4
LRRN1 AB040930 6 5
MTHFD1 J04031 7 6
GJA1 NM_000165 27 23
SET M93651 18 16
KIF4A AF071592 2 2
NPM1 NM_002520 53 53
ZNF43 X59244 1 1
DSG2 Z26317 8 8
ZNF117 NM_024498 1 1
RPLP0 AK001313 154 167
LAPTM4B AJ276485 8 9
IDH1 AF020038 7 8
SERPINH1 D83174 28 32
EIF4A1 D13748 31 36
C20orf1 AB024704 9 11
EPRS X54326 8 10
CCT8 D13627 8 10
SMS AD001528 5 7
IMP-2 NM_006548 9 14
TUBB-5 AK001295 5 8
NME2 M36981 3 6
C15orf15 NM_016304 2 6
cDNA from clone AL133611 1 3
DKFZp434O1317
ACTC J00073 1 4
KRT18 M26326 8 46 *
KRT8 X74929 9 71 *
#PITX2 AF048722 0 2
#PSIP1 AF063020 0 1
#GDF3 NM_020634 Not found Not found
#GSH1 AL390738 Not found Not found
#GAL M77140 Not found Not found
RPL24 M94314 Not found Not found
RPL4 D23660 Not found Not found
SNRPF X85372 Not found Not found
HMGIY L17131 Not found Not found
TD-60 AB040903 Not found Not found
HSSG1 AF055270 Not found Not found
CALU AF257659 Not found Not found
C20orf168/HNRPA1 AL050348 Not found Not found
Ribosomal 40A Lamin R AL136306 Not found Not found
OR7E111P AL353580 Not found Not found
TUBB4 AK001295 Not done Not done
The ES and EB column indicate the number of ESTs found in the undifferentiated huES
cells (ES) and in embryoid bodies (EB) by EST enumeration. Differences in expression
levels based on the EST frequencies were evaluated for statistical significance using the
Fisher Exact Test (FET) with a p-value of p<0.05 (see Material and Methods).
a
For lower copy number (5 ESTs and below in ES and 0 in EB, or less than 7 EST in ES
and 1 in EB) the test cannot determine significance, even though the difference might be
real.
Table 6S. Comparison of 92 common genes expressed in huES cell lines with other studies.
Gene name Gene bank Gene annotation Ramalho Tanaka et Lemischka
ID Santos et al al (33/92) et al
(14/92) present (12/92)
present present
GJA1 NM_000165 gap junction protein, +
alpha 1, 43kDa (connexin
43)
POU5F1/Oct4 Z11898 POU domain, class 5, + +
transcription factor 1
CCNC M74091 Cyclin C + + +
CCNB1 M25753 Cyclin B1 +
TDGF1 X14253 teratocarcinoma-derived +
growth factor 1
NASP M97856 nuclear autoantigenic + +
sperm protein (histone-
binding)
SMS AD001528 Spermine synthase + +
RPS24 M31520 Ribosomal protein S24 +
RPL24 M94314 Ribosomal protein L24 +
RPL7 X57958 Ribosomal protein L7 + +
RPL4 D23660 Ribosomal protein L4 +
RPL6 X69391 Ribosomal protein L6 +
HDAC2 U31814 Histone Deacetylase 2 + +
IDH1 AF020038 Isocitrate dehydrogenase + +
1 (NADP+), soluble
DDX21 U41387 DEAD/H (Asp-Glu-Ala- +
Asp/His) box polypeptide
21
SSB X69804 Sjogren syndrome +
antigen B (autoantigen
La)
SET M93651 SET translocation +
(myeloid leukemia-
associated)
TUBB-5 AK001295 Tubulin beta-5 +
SLC16A1 AL162079 solute carrier family 16 + + +
(monocarboxylic acid
transporters), member 1
PODXL U97519 podocalyxin-like + +
GDF3 NM_020634 Growth differentiation + + +
factor 3
HNRPAB U76713 heterogeneous nuclear + + +
ribonucleoprotein A/B
TNNT1 M19309 troponin T1, skeletal, +
slow
CALU AF257659 Calumenin + +
PTTG1 AJ223953 Pituitary tumor- + +
transforming 1
PITX2 AF048722 paired-like homeodomain +
transcription factor 2
PSIP2 AF063020 PC4 and SFRS1 +
interacting protein 2
NPM1 NM_002520 nucleophosmin (nucleolar +
phosphoprotein B23,
numatrin)
TK1 K02581 thymidine kinase 1, +
soluble
EPRS X54326 glutamyl-prolyl-tRNA + +
synthetase
RAMP NM_016448 RA-regulated nuclear +
matrix-associated
protein
KIAA1573 AB046793 KIAA1573 protein +
SERPINH1 D83174 serine (or cysteine) +
proteinase inhibitor, clade
H (heat shock protein 47),
member 1, (collagen
binding protein 1)
HMGB2 X62534 high-mobility group box +
2
PSMA3 D00762 proteasome (prosome, +
macropain) subunit, alpha
type, 3
HSPA4 AB023420 heat shock 70kDa protein +
4
ZNF43 Zinc finger protein 43 +
MGST1 J03746 microsomal glutathione +
S-transferase 1
MTHFD1 J04031 Methylenetetrahydro- +
folate dehydrogenase
(NADP+ dependent),
methenyltetrahydrofolate
cyclohydrolase,
formyltetrahydrofolate
synthetase
MTHFD2 X16396 Methylenetetrahydro- +
folate dehydrogenase
(NADP+ dependent),
methenyltetrahydrofolate
cyclohydrolase
NME2 M36981 non-metastatic cells 2, +
protein (NM23B)
expressed in
+ marked genes were expressed in three studies: Ramalho-Santos et al.
(http://mcb.harvard.edu/melton/index.html), Tanaka et al.
(http://lgsun.grc.nia.nih.gov/microarray/data.html), and
(www.sciencemag.org/cgi/content/full/1073823/DC1) Ivanova et al.