1
UNIVERSITY OF ABERDEEN
SCHOOL OF MEDICAL SCIENCES
THE BIOCHEMISTRY OF AIDS
http://www.abdn.ac.uk/~bch118/index.htm WFL
September 2008
I HUMAN RETROVIROLOGY: GENERAL INFORMATION AND
STATISTICS
Events
1908 and 1911 Causative agents of chicken leukaemia and sarcoma shown to be filterable (i.e. virus-
like). Later shown to be retroviruses.
1951 Murine leukaemia virus discovered. Later shown to be the first of many mammalian
retroviruses.
Thereafter Several animal RNA viruses shown to be carcinogenic.
1964 Provirus hypothesis proposed to account for this (Temin, University of Wiscosin)
[virion RNA double-stranded DNA integrated into cell genome.]
1970 Reverse transcriptase (rtase) found in virions of carcinogenic animal RNA viruses by
Temin, Baltimore (NY College of Medicine). (Awarded joint Nobel Prize in 1975).
Thereafter Massive inconclusive search for human retroviruses.
1978-80 Discovery of IL-2 makes long-term T cell culture possible. First human retrovirus
found in such cultures (Gallo, National Cancer Institute, Bethesda): human T-cell
leukaemia virus (HTLV-I); causes a leukaemia/lymphoma and myelopathy in Japan,
SE USA, Caribbean.
1982 Second human retrovirus isolated from T-cell cultures (Gallo): HTLV-II; not yet
shown to be disease-causing agent.
05.06.1981 Center of Diseases Control USA reports 5 cases of Pneumocystis carinii
(widespread, normal harmless protozoon) -associated pneumonia during previous 8
months in previously healthy, homosexual men in LA. Such disease seen usually
only when immune system artificially depressed (as in transplant operations).
Late 1981-1982 Similar outbreaks in LA, NY, SF. Initially called „gay-related immunodeficiency‟
(GRID). Patients all homosexual men or iv drug abusers. Later, pattern extends to
haemophiliacs, blood transfusion recipients and sex partners of those at risk.
Considered likely that causative agent was a virus, spread through genital
secretions/blood. Possibly a retrovirus, as some animal retroviruses were known to
cause immunodeficiency as well as cancer.
December 1981 First UK GRID case (Middlesex Hospital, London).
July 1982 Term „AIDS‟ first used.
Early 1983 Rtase and retrovirus-like virions detected in T cells cultured from lymph glands of
patient by Montagnier in Institut Pasteur, Paris. Called lymphoadenopathy-associated
virus (LAV).
November 1983 Retrovirus-like virions isolated from T cells of AIDS patient (Levy, University of
California, SF). Called AIDS-related viruses (ARFs)
Early 1984 Retrovirus-like virions isolated from T cells of AIDS patient (Gallo). Called HTLV-
III.
23.04.84 US Government Press Conference implies Gallo is discoverer of „the AIDS virus‟.
1985 HTLV-III genome sequenced.
LAV, ARVs, HTLV-III shown to be variants of the same virus.
Replication of HTLV-III in bulk culture allows production of virus antigens used to
show that blood of many AIDS patients contains antibodies to the virus: later (1985)
used to develop test kit for the virus.
May 1986 Virus re-named „HIV‟ (now „HIV-1‟).
1985-86 Related less virulent virus causing AIDS symptoms found in W Africa; HTLV-IV
(now HIV-2).
1987 First Aberdeen AIDS case diagnosed at Foresterhill.
Thereafter Other primate retroviruses found: HTLV-V (causes another T cell lymphoma);
spumaretroviruses (cause foamy vacuolation of cultured cells; not linked to disease);
several simian immunodeficiency viruses (SIVs).
2
Families of retroviruses
Oncoretroviruses
Cause neoplasia. Some have acquired cell genes and inserted them into their own genomes (viral
„oncogenes‟). Their re-integration into cell DNA leads to cancer. Others activate a cell oncogene by
integration nearby.
Spumaretroviruses
Probably cause persistent infections in mammals. The disease caused, if any, is unclear. They often
contaminate primary cell cultures, causing massive vacuolation of the cells, hence the foamy
appearance, and their name.
Lentiretroviruses
Cause chronic, gradually degenerative diseases. They include HIV-1, HIV-2 and the SIVs.
Statistics
Worldwide
(WHO Annual AIDS Epidemic Update December 2007)
HIV+ people alive in 2007 3.3 x 107 including 2.3 x 107 in sub-Saharan Africa.
+
HIV people infected during 2007 2.5 x 106
People dying of AIDS during 2007 2.1 x 106
1.1% of all people world-wide aged 15-49 are currently HIV+.
UK
(Public Health Service (UK) Reports December 2007; cumulative figures)
HIV+ people 93231
of whom 23956 have/had AIDS
of whom 13867 have died.
Of the total AIDS cases 7173 probably acquired the virus heterosexually;
of these 6123 were probably exposed to the virus outside the UK.
Epidemiology
„Unprotected sexual intercourse between men and women is the predominant mode of transmission of
the virus‟ (WHO, May 2004). However, the disease pattern is often referred to as „The Two Epidemics‟.
1 N America, Europe, Australasia.
During 2006, 5.6 x 105 people were HIV+.
Mainly homosexual men, iv drug abusers, their sex partners and neonates.
As early as 1993, heterosexual risk said to be „exaggerated‟.
Perception, particularly in the US, that the AIDS crisis is over.
2 Sub-Saharan Africa and, increasingly, Asia.
Mainly heterosexually acquired. HIV strains in Asia seem to be adept at attaching to mucosal
cells (Section II): perhaps this contributes to the different infection pattern.
In the following discussion, unless otherwise stated, observations apply to HIV-1
replicating in T lymphocytes, and nucleotide and amino acid residue numbering refers
to the isolate HIV-1 IIIBH10 (the base sequence of which is attached to these sheets).
II VIRUS BINDING AND ENTRY
3
gp120-CD4 affinity
This is much higher than many antigen-antibody interactions, and higher than the CD4-human
leukocyte antigen (HLA; major histocompatibility complex) class II interaction.
Normal function of CD4
CD4 is part of the T cell antigen receptor. This recognises the HLA II/foreign peptide combination
displayed on the surface of an antigen-presenting cell. CD4 is that part of the receptor which binds the
HLA II complex; other parts interact with the foreign peptide. Interaction leads to T cell activation,
proliferation and cytokine production. In turn, these lead to production of effector immune elements:
antibodies made by B cells and cytotoxic T cells.
What cells are CD4+?
Helper/inducer T cells
and the following monocyte-derived cells:
macrophages
dendritic cells (antigen-presenting cells mucosal surfaces, lymph nodes, spleen)
Langerhans cells (antigen-presenting cells mucosal surfaces, skin)
microglial cells (phagocytic cells CNS)
myeloid precursor cells (monocyte precursors bone marrow)
follicular dendritic cells (B cell stimulators spleen, lymph nodes).
HIV replicates in non-proliferating macrophages, but replication in HIV-infected T cells requires
activation of the cell. This is probably required for effective HIV provirus integration and transcription
(Sections III, V).
HIV infection depends on CD4 being displayed on „rafts‟, which are moving platforms of cholesterol-
and cell signalling protein-rich membrane microdomains.
CD4 structure
1 4 „variable‟ domains having Ig-like sequences and sheet folding.
2 V1 (and possibly V2) required for HLA II binding.
3 V1 required for gp120 binding; sequence 40-60 critical.
4 V2/V3 important in membrane fusion?
5 V3/V4 important in some post-fusion event?
X-ray pictures of V1/V2 section reported in 1991.
gp120 structure
gp120 is synthesised with an N terminal 30-amino acid signal peptide that is cleaved off during virus
maturation (Section XI).
1 105-117 interacts with virion protein gp41.
2 296-331 is a hydrophilic exposed loop („V3‟), one of 5
„hypervariable‟ regions. It includes the major antigenic site
on the HIV surface (304-308). Disappointing for vaccine
production that this major site is hypervariable. During
AIDS progression, HIV strains with changes here develop,
as the virus eludes the host immune response.
3 Sections towards the C terminus interact with CD4.
4
gp41 structure
gp120 is bound to the virion surface through another virion glycoprotein, gp41 (Section XI).
N C
572-591 681-705 729
___________________________________________________________________________
512 856
1 Derived from same precursor (gp160) as gp120 (Section XI), hence numbering starts at 512.
2 572-591 interacts with gp120.
3 681-705 is hydrophobic, and spans the viral envelope. (N terminus outside, C terminus inside).
4 gp41 may be cleaved at 729-730 during maturation, so that 730-856 is not present in the virion.
Some chemokine receptors act as co-receptors for HIV
Two cell-surface chemokine (proinflammatory chemoattractant protein cytokine) receptors, CCR5 and
CXCR4, were shown (1996) to be necessary for HIV entry into macrophages and T cells respectively.
gp120 (possibly through V3) binds to these receptors.
HIV strains adept at person-person transmission interact mostly with CCR5. After infection, over time,
strains interacting mostly with CXCR4 develop. The reason (and mechanism) of this switch is unknown.
Discovery of chemokine receptor involvement initiated new approaches to therapy (Section XV) and
understanding of natural immunity (Section XX). About 15 chemokine receptors have now been
identified (questionably) as minor HIV binding sites.
How CXCR4 and CCR5 were discovered
Current model of attachment and entry
gp120 (mostly C terminal domains) binds N terminal domain of CD4
gp120 conformational change brings gp120 chemokine-receptor-binding domain close to receptor
gp120 binds receptor
Another gp120 conformational change, perhaps triggered by reduction of gp120 S-S bonds by a cell-
surface enzyme, exposes hydrophobic section of gp120
This embeds in membrane
gp41 now spans gap between virion and cell surface as „pre-hairpin intermediate‟
gp120 perhaps shed
N regions of 3x gp41 molecules interact with their C regions to form a 6-helix „triple hairpin‟ that brings
virion and cell surface together
5
Membrane and envelope fuse
Nucleocapsid enters cell through „fusion pore‟ made of several gp41 molecules
HIV entry into the body: dendritic cells as Trojan horses
III REVERSE TRANSCRIPTION
Virion +RNA
R repeated sequence of 98 nucleotides 1- 98
U5 unique 5‟ sequence of 85 nucleotides 99- 183
PBS tRNA- (primer-) binding sequence of 18 nucleotides 183- 200
U3 unique 3‟ sequence of 455 nucleotides 8661- 9115
R repeated sequence of 98 nucleotides 9116- 9213
A human tRNALys, not charged with activated amino acid, is bound to the virion RNA.
Sequence complementary to PBS
Sites important for rtase binding
Uniquely among viruses, two copies of the genome are present in the virion.
H-bonding (….) between the RNAs may involve interaction between self-complementary 6-mers (255-
260), forming a „kissing loop‟.
Having 2 RNA copies may enable recombination during reverse transcription, allowing avoidance of
otherwise lethal mutations, while enhancing genetic diversity.
6
Steps in reverse transcription
1 Virion +RNA
5‟ 3‟
R U5 PBS U3 R
2 tRNA acts as a primer for virion rtase, producing „strong stop‟ -DNA:
Rtase may incorporate some monomers beyond the 5‟ end, contributing to HIV hypervariability.
3 RNase H activity of rtase removes RNA part of the DNA-RNA hybrid:
4 „First jump‟: the R‟ sequence of -DNA binds the complementary R sequence at the other end of
the RNA; (or, it binds to a second RNA molecule: the model below involves a single virion RNA.)
R
5 -DNA is extended by rtase:
6 RNA is removed by RNase H, except for 2 resistant, purine-rich 19-mers:
4361 4379 8642 8660
7 These 2 RNA sequences act as primers for rtase, producing (incomplete) +DNA:
PBS
8 RNase H removes the 2 primers and the tRNA. „Second jump‟: the PBS of +DNA binds the
complementary PBS‟ region at the other end of the -DNA:
PBS‟
PBS
9 Rtase extends the two +DNA 3‟ ends and the -DNA 3‟ end. Cell ligase links the +DNA fragments:
7
Rtase polymerase activity
The enzyme lacks proof-reading exonuclease activity, and is therefore error-prone. On average, perhaps
one mistake is made per genome synthesised. This contributes to high HIV genetic variability. Cell RNA
pol II, which catalyses transcription of the provirus (Section V), also lacks a proof-reading facility.
Rtase RNase H
This is said to have endo- and 3‟ exo-nuclease activity. Analysis of products suggests it is a processive 3‟
5‟ endonuclease.
Rtase structure
Rtase is synthesised as part of a polyprotein (Section XI), which is cleaved to give p66 (and other
products). p66 dimerises, and then one of the monomers is cleaved in its C terminal region to give a p66-
p51 heterodimer, which is the active enzyme.
X-ray pictures of the heterodimer were reported in 1992. It was only the second polymerase (the first was
the E. coli DNA pol I Klenow fragment) so examined.
The cleavage site of p66 is hidden in the heterodimer, so p51.p51 is not produced.
There is a single pol site, in the N terminal part of p66. In p51 of the heterodimer, this site is buried and
inactive. The pol active site is in a cleft very similar to that of the Klenow fragment.
RNase H activity also resides in the p66 of the heterodimer.
p51 of the heterodimer binds the tRNA primer.
p66
RNA template
New DNA
p51
tRNA primer
Such structural analysis has been important in designing antivirals and potentially understanding virus
resistance to rtase inhibitors (Section XV).
Fate of the DNA product
Reverse transcription occurs in the cytoplasm, with the nucleoprotein complex attached to actin filaments.
The double-stranded DNA produced moves to the nucleus, probably along microtubules, and is integrated
into cell DNA. The migrating complex (about the size of a ribosome), as well as virion rtase and
proteinase (Section XI) and cell proteins, contains virion integrase (Section IV) and Vpr (Section XI),
both of which, like the NFB, Tat and Rev proteins (Sections V, VII and IX) contain a 4-5 base nuclear
signal sequence. In resting T cells, migration requires cell activation. This is clinically relevant: most
circulating T cells are not dividing, and any attempt to treat AIDS by activating T cells (and so boost the
immune response) might increase their capacity to replicate HIV. Vpr may help nuclear localisation by
binding the complex to cell nuclear import machinery, including importins and nucleoporins. It has been
suggested that the double-stranded DNA produced by reverse transcription may have a short triple-helical
structure (not considered in the scheme described in this Section), and that this „flap‟ may have something
to do with nuclear entry.
8
The product of reverse transcription
Double-stranded DNA
U3 455 nucleotides -455 to –1 U3 455 nucleotides 8661 to 9115
R 98 nucleotides 1 to 98 R 98 nucleotides 9116 to 9213
U5 85 nucleotides 99 to 183 U5 85 nucleotides 9214 to 9298
[PBS 18 nucleotides 183 to 200]
IV INTEGRATION
Integration is probably required for virus replication and occurs preferentially within genes normally
transcribed by cell RNA pol II (the enzyme that transcribes the provirus). Chronically infected cells have
1-4 provirus/cell, although up to 20/cell have been reported.
Steps in integration
1 Viral double-stranded DNA
3‟ 5‟
- TGAC GTCA
+ ACTG CAGT
5‟ 3‟
2 Virion integrase catalyses cleavage of dimers from the 3‟ ends:
AC GTCA
ACTG CA
3 Integrase produces a 5-mer-staggered cut in the cell DNA:
5‟ 3‟
HIJKL
H‟I‟J‟K‟L‟
3‟ 5‟
4 Integrase links 3‟ ends of viral DNA to 5‟ ends of the cut cell DNA:
A
C
HIJKLAC GT
TG C A H‟I‟J‟K‟L‟
C
A
5 Integrase catalyses cleavage of dimers from the 5‟ ends of the viral DNA:
HIJKLAC GT
TG C A H‟I‟J‟K‟L‟
6 A cell DNA pol fills the gaps. Finally, a cell ligase catalyses linkages on the 2 strands:
H I JK LAC GTHIJKL
H‟ I‟ J‟K‟L‟T G C A H‟I‟J‟K‟L‟
9
The product of integration
This is an integrated provirus, which has 2 bp less at each end than the unintegrated provirus, and is
flanked by a 5 bp cell DNA repeat. The loss of the two bp is unimportant, as they are non-coding. The
provirus now looks like this (compare with the product of reverse transcription in Section III):
U3 at the 5‟LTR is now 453 nucleotides –451 to –1
U5 at the 3‟ LTR is now 83 nucleotides 9214 to 9296.
V TRANSCRIPTIONAL CONTROL ELEMENTS IN THE 5’LTR
In T cells, after integration, viral transcription is minimal until the cell is activated by antigen
presentation, mutagens or cytokines. This repression in part involves a nucleosome at the 5‟ LTR
restricting transcriptional machinery access. Activation stimulates provirus transcription, leading to
synthesis of early viral proteins (Section VI), two of which, Tat and Rev, then further stimulate provirus
transcription (Section VII, IX), leading to synthesis of the late viral proteins (Sections X, XI).
All transcription starts at a single promoter, located in U3 of the provirus 5‟ LTR. Over 15 different cell
proteins have been shown to interact specifically in or around this area, and hence may positively or
negatively affect provirus transcription. Methods used to characterise these interactions include (1)
comparison of HIV sequences with those of cells/other viruses to which such proteins are known to bind;
(2) in vitro protein-binding studies in which the DNA is rendered nuclease-resistant or undergoes
electrophoretic mobility shifts; (3) a plasmid containing part of the 5‟ LTR followed by a reporter gene is
placed in a cell containing a plasmid encoding the supposed interacting protein.
TATA box
This structure, characteristic of many cell and virus promoters, occurs at –24 to –27. It is a binding site
for the constitutive cell protein TFIID, which recruits a multioligomeric set of cell proteins that are
different for each of the various cell RNA polymerases. For HIV provirus transcription, the cell RNA pol
II, which normally catalyses cell mRNA synthesis, is used.
The enhancer
An enhancer is loosely defined as a sequence(s), at variable distance from, and which may be placed on
either side of a promoter, that enhance(s) transcription. For HIV, the sequence GGGACTTTCC occurs
twice, at –81 to –90 and at –95 to –104. These sequences are binding sites for the cell protein NFB,
originally discovered as a constitutive protein in B cells able to bind close to and enhance transcription of
the k-Ig gene, and now known to be present in many cells, controlling expression of many genes in
response to various extracellular signals. Below is a scheme of how NFB operates, with particular
reference to T cells.
Cell activation
stimulates cell protein kinase C,
which catalyses phosphorylation and inactivation of IB.
IB is normally complexed to NFB, a constitutive cytoplasmic protein.
When IB is inactivated, NFB is able to move to nucleus (it has a nuclear signal sequence, like those in p17, Vpr, Tat and Rev
Sections III, VII).
In the nucleus, NFB binds to enhancers at the start of different genes in different tissues.
10
HIV has „adopted‟ this cell control system, allowing its early transcription to be triggered when T cells
are activated. Presumably an activated cell is well equipped metabolically to support virus replication.
Any AIDS therapy geared to activate T cells (and hence boost the immune system) might activate the
provirus.
The ‘negative regulatory element’ (NRE)
This is a 5‟ LTR sequence, upstream of the TATA box and enhancer sequences, of ill-defined length,
deletion of which is reported to increase the rate of HIV replication. Several cell proteins (and perhaps
HIV protein Nef, although this is disputed (Section VIII)) bind here and hence perhaps influence provirus
transcription.
Positions of TATA box, enhancer and NRE at the 5’ LTR
Only the +DNA shown.
Activation of HIV transcription by heterologous viruses
Co-infection by several other viruses seems to trigger HIV provirus transcription. In some cases, there is a
simple observation of increased HIV gene expression following infection with a second virus. In others, a
plasmid containing the HIV 5‟ LTR followed by a reporter gene has been inserted into a cell with another
plasmid encoding the heterologous virus protein in question. In some cases, the heterologous virus protein
has been identified. Some bind directly to the HIV 5‟ LTR; others seem to work through the NF B
pathway.
Major viruses involved are herpesviruses (cytomegalovirus (CMV), Epstein-Barr virus, human
herpesvirus–6 (HHV-6), herpes simplex viruses 1 and 2, varicella-zoster virus, pseudorabies virus),
vaccinia virus, papillomavirus, hepatitis B virus, HTLV-1 and human spumaretrovirus. The observations
mainly come from studies on cultured cells, but many of these viruses are commonly found in AIDS
patients, presumably as opportunistic infections or because, as the immune system fails, normally
harmless, endogenous viruses become virulent. However, only a few of the viruses are probably capable
of infecting the kinds of cells in which HIV replicates. These include CMV, HHV-6 (originally isolated in
1986 from T cells of AIDS patients), HTLV-1 and possibly human spumaretovirus. HHV-6 has been
shown to induce CD4 expression in CD8+ cells, and may therefore expand the host cell range for HIV in
co-infected patients.
Thus, there is a possibility that heterologous viruses may be co-factors in AIDS development.
VI EARLY TRANSCRIPTION
The action of various cell (and perhaps heterologous virus) proteins at the 5‟LTR produces a low level of
HIV provirus transcription. There is a tendency for the transcribing complex to be not very processive;
that is, transcription often aborts after a few 100 nucleotides or less. This tendency is corrected later by
the action of Tat (Section VII). However, even before Tat is produced and starts working, a few copies of
the entire viral +RNA (1-9213) are transcribed from the – DNA of the provirus.
3‟ U3‟ R‟ U5‟ U3‟ R‟ U5‟ 5‟
- +
+ -
5‟ U3 R U5 U3 R U5 3‟
5‟ +RNA 3‟
1 9213
R U5 U3 R
cap poly A tail
11
The two R regions of the +RNA both have an AAUAAA poly A tailing signal (occurring at 74 to 79 and
9189 to 9194). This signals: add tail ~20 nucleotides downstream. The 5‟ LTR signal is ignored, perhaps
because Tat binding to TAR (Section VII) occludes the signal. Capping and tailing are by conventional
cell machinery. Tailing requires the presence of the 3‟ R region TAR sequence (Section VII; 9116-9174)
and a U3 sequence (9096-9113) not present at the 5‟ end.
HIV genetic map
Simple retroviruses have 3 genes (sometimes in different frames).
+RNA (or +DNA)
5‟ ____________________________________________________________________________ 3‟
gag pol env
gag (group-specific antigen) encodes virion core proteins
pol encodes enzymes (most, if not all, virion)
env encodes virion envelope proteins.
HIV has additional genes, shown below, in 3 frames, on the +DNA.
Early, spliced virus mRNA production
mRNAs encoding the three early proteins, Tat, Nef and Rev, are made from the full-length +RNA by
splicing catalysed by cell machinery.
Tat (2 exons) is encoded in nucleotides 5411 to 5625 and 7956 to 7998
Nef is encoded in nucleotides 8374 to 8991
Rev (2 exons) is encoded in nucleotides 5550 to 5625 and 7956 to 8227.
The +RNA contains 4 major splice donor sites and 7 major splice acceptor sites:
DI between 287-288 A1 between 4492-4493
D2 between 4542-4543 A2 between 4969-4970
D3 between 5043-5044 A3 between 5357-5358
D4 between 5625-5626 A4a between 5534-5535
A4b between 5540-5541
A5 between 5540-5541
A6 between 7955-7956.
R U5 U5R
D1 D2 D3 D4
A1A2A3 A4abA5 A6
Combinations of various splice donor and acceptor sites generate a range of multiply spliced products
from the +RNA, that encode the early virus proteins Tat, Rev and Nef.
Combinations encoding Tat
D1/A3 D4/A6
D1/A1 D2/A3 D4/A6
D1/A2 D4/A6
D3/A3
12
Combinations encoding Rev
D1/A4 D4/A6
D1/A1 D2/A4 D4/A6
D1/A2 D3/A4 D4/A6
Combinations encoding Nef
D1/A6
D1/A5 D4/A6
D1/A1 D2/A5 D4/A6
D1/A2 D3/A5 D4/A6
The function of the non-coding sections is unclear. This set of 10 mRNAs represents just some of >40
species produced. Obviously, there is much structural and functional redundancy, the reason for which is
unclear.
VII Tat
„Tat‟ stands for „transactivator of transcription‟. The protein, consisting of 86 residues in HIV-1 IIIBH10
and 101 in most clinical isolates, is encoded in two exons (Section VI). The polypeptide (below) encoded
by the first exon contains all known Tat activity.
N C
__________________________________________________________________________________
1 72
Pro-rich Cys-rich GlyArgLysLysArg
Pro region extended coil?
Cys region Tat expressed in E. coli dimerises, and this possibly involves this region, but it is
unclear whether dimerisation is important in virus replication.
GlyArgLysLysArg nuclear signal sequence (like those in p17, Vpr, NF B and Rev proteins;
Sections III, V, IX);
also interacts with TAR (Tat-responsive element) of viral RNA.
Tat-TAR interaction
Unlike most transcriptional activators, Tat does not work by binding to DNA. It is found in the nucleolus,
bound to the TAR („transactivator responsive‟) region of nascent virus RNA. TAR is a 59-nucleotide
sequence (1-59), present, in the first exon, at the 5‟ end of all HIV transcripts (however spliced they may
be). (TAR at the 3‟ end of the transcripts is necessary for poly A tailing – Section VI).
13
Tat appears to bind to the bulge. Several cell nuclear proteins appear to bind to
(The bulge kinks the stem – not shown in the diagram). the loop (and to Tat on the bulge).
C
1 UU CU
m7GpppGGGUCUCUCUGGUUAGACCAGA GAGC G
. . . . . . . . . . . . . . . . . . . . . . G
CCCA AGGGAUCAAUC GGUCU CUCG G
59 A
Other cell nuclear proteins appear to bind to the
stem.
The function of Tat
In the absence of Tat, most transcripts terminate after incorporation of a few 100 or less nucleotides
(Section VI). Tat allows most to be efficiently completed. Thus Tat increases HIV expression 40- to
1000-fold. It was thought that TAR was a terminator sequence, and Tat an antiterminator, but deletion of
TAR does not increase transcription, and insertion of TAR into heterologous systems does not decrease
transcription.
Current model of Tat activity
VIII Nef
„Nef‟ stands for „negative early factor‟. This early protein was originally thought to inhibit gene
expression by binding to NRE (Section V); now there is dispute about this. The protein, consisting of 206
residues, is encoded in a single cistron (Section VI). Unlike the other two early proteins, Nef is
cytoplasmic. It has a myristoylation sequence (Gly XXX Ser) immediately following the initial Met at the
N terminus. This signals a cell enzyme to remove the Met and add myristic acid (n-tetradecanoate) to the
N terminus. This happens quite normally to many cell proteins destined for the surface of the cell. The
modification allows Nef to associate with the inner surface of the infected cell.
The function of Nef
14
IX Rev
„Rev‟ stands for „regulator of virion protein synthesis‟. The protein, consisting of 116 residues, is encoded
in two exons (Section VI).
exon link
N C
1 Arg-rich region Leu-rich region 116
Arg region interacts with RRE (Rev-responsive element) of virus RNA.
(Arg)4Trp included in the above region is a nuclear signal sequence (like those in p17, Vpr, NFB
and Tat proteins; Sections III, V, VII).
On either side of the Arg region are sequences required for the Rev tetramerisation
necessary for its activity.
Leu region necessary for transport of Rev-bound transcripts from nucleus to cytoplasm.
Rev-RRE interaction
Rev is found in the nucleolus, bound to the RRE region of nascent viral RNA. RRE is a 234-nucleotide
sequence (7346 to 7579).
RRE (shown on +DNA; Section VI)
RRE is present in the original, whole +RNA, but splicing (Section VI) removes it from all the early
mRNAs. Computer maximisation of possible intra-strand H bonding suggests the following structure for
RRE.
Position at which Rev binds
The function of Rev
Rev is concerned with the switch from early to late viral mRNA synthesis. Early mRNAs are produced by
multiple splicing of the initial, complete +RNA (Section VI). For late mRNA synthesis, the initial
transcript must be unspliced (or only singly spliced ) (Section X).
Primary transcripts accumulate in the nucleolus, waiting to be spliced. It is suspected that incompletely
defined „cis-acting repressive sequences‟ (CRSs) present in them, act as nuclear retention signals.
15
Co-ordinated action of Rev and Tat
Low-level HIV transcription does not produce enough Rev to allow late viral protein synthesis. Only
when Tat accumulates and stimulates transcription does [Rev] increase sufficiently to allow late viral
protein synthesis to take over. This Tat/Rev interaction means that the late viral proteins are not made and
inserted into the cell surface (Section XI), where they might be recognised by the host immune system,
until the final explosive burst of viral replication. This is bad news for potential AIDS therapies relying
on recognition and killing of infected cells before progeny virus is released.
X LATE TRANSCRIPTION
This involves the production of unspliced or singly spliced virus RNA.
vif tat
gag tat vpu rev
pol env nef
vpr rev
Unspliced RNA encodes Gag/Pol
Vif-encoding mRNA
D1/A1
Vpr-encoding mRNA
D1/A2
Single-cistron Tat-encoding mRNA
D1/A3
Vpu and Env-encoding mRNAs
D1/A4a, A4b or A5
16
Translation of the late mRNAs
The unspliced transcript is translated into Gag polyprotein or Gag-Pol polyprotein. In the overlap region
between gag and pol, a poly U sequence encourages ribosome slippage, and a frame-shift in codon
reading, as shown below.
Because slippage occurs with only a ~ 5% frequency, the catalytic pol gene products are made in only
small amounts.
The single (first) exon Tat is fully active. Its production as a late protein means that a high level of
transcription can continue even when production of the multiply spliced early mRNAs encoding Tat is
stopped.
In the Vpu/Env mRNAs, although the Vpu start codon is closest to the 5‟ end (5642-5644), it is often
missed by the ribosome, which then continues until it reaches the Env start codon (5802-5804).
Possible additional genes
A conserved ribosome slippage sequence (AAAAA at 5492 to 5496) occurs soon after the start of the first
Tat exon. This suggests that some Tat-encoding transcripts might be used to produce another protein
(„Vpt‟) of unknown function.
All the viral mRNAs are produced of course, by transcription of the provirus – DNA. Recently,
transcripts of unknown function from the + DNA have also been found.
XI THE LATE PROTEINS
Gag and Gag-Pol polyproteins
These have a common N terminal sequence, the end of which, like that of Nef (Section VIII), has a
myristoylation sequence immediately following the initial Met. Following myristoylation, the
polyproteins move to the cell surface.
Both Gag and Gag-Pol have two zinc-finger-like sequences at 392-405 and 413-426:
N------------Cys X2 Cys X4 His X4 Cys -----------C
These interact with a largely non-coding sequence (nucleotides 295-340), called , at the 5‟ end of
unspliced viral RNA. The main splice donor site, D1, is between 287 and 288 (Section VI), and the start
of the gag gene is at 334. Because is downstream of D1, it is removed from all spliced transcripts (both
early and late), and only unspliced RNA can interact with the zinc finger-like sequences of Gag and Gag-
Pol. The polyproteins thus bind unspliced virus +RNA and carry it to the cell surface, where it will
become progeny virion RNA. thus acts as an RNA packaging signal. Computer maximisation of
possible intra-strand H bonding suggests the following structure for .
17
Cleavage of Gag and Gag-Pol polyproteins
This occurs late, as virions bud from the cell surface. It is catalysed by the viral p10 proteinase, the
sequence of which is itself part of Gag-Pol. p10 acts as a dimer: this explains why the polyproteins are not
immediately cleaved by the p10 domain of Gag-Pol. Suitable orientation of two p10 domains is rare when
the domains are still included in Gag-Pol. It is only when a little cleavage occurs, and when some free p10
is released, that efficient dimerisation can occur, and substantial polyprotein cleavage start. This means
that major cleavage is avoided until Gag and Gag-Pol are at the site of progeny virus assembly at the cell
surface.
Cyclophilin A
This cell protein, a chaperonin, binds Gag and is incorporated into progeny virions. When the virion
enters a cell, cyclophilin A counteracts the action of a host restriction factor.
p10 proteinase
This is an aspartyl proteinase, like mammalian pepsin, renin, gastricsin and cathepsins D and E. These are
much larger than p10, and fold to place two trimer sequences, both AspThrGly at the active site. X-ray
pictures (1989) of the p10 dimer show it to form a very similar structure, with two AspThrGly sequences,
one from each monomer, at the active site.
Knowledge of p10 structure has enabled rationale design of antivirals (Section XV).
Products of Gag cleavage
N ------------------------------------------------------------------------------- C
1 132-133 363-364 448-449 512
Tyr-Pro Leu-Ala Phe-Leu
377-378 433-434
Met-Met Phe-Leu
-----------------------------------------------------------------
p17 p24 p2 p7 p1 p6
(MA) (CA) (NC) (maturase)
See the structure of the virion later in this Section to check on the identity/function of these products.
Products of Gag-Pol cleavage
N------------------------------------------ ____________________________________________________________________________C
1 500-501 599-600 1159-1160 1447
Phe-Pro Phe-Pro Leu-Phe
---------------------------------____________>
p17 p24 p1 p15 p10 p66 p32
(proteinase) (rtase) (integrase)
first 56 amino acids
of p15 are the first 56
amino acids of p7 1039-1040
p51 p15
See the structure of the virion later in this Section to check on the identity/function of these products.
18
Assembly of the nucleocapsid
In reading this description, refer to the products of Gag and Gag-Pol cleavage and the structure of the
virion discussed elsewhere in this Section.
The p24 domains of Gag and Gag-Pol fold around the virion RNA. Eventually, the RNA is enclosed in a
nucleocapsid shell, built of the by then free p24 proteins. Two RNA molecules are enclosed, each still
bound through the sequence to the zinc finger-like sequences, which by now are part of free p7 (from
Gag) or free p15 (from the fewer Gag-Pol) molecules.
Cell tRNALys is enclosed, bound to the PBS of the RNA.
Also enclosed in the nucleocapsid are
p6 This is a Pro-rich protein, mutations in which produce virions that bud from the cell surface
ineffectively. Therefore p6 is called „maturase‟.
p10 The proteinase discussed earlier in this Section.
p66/p51 The rtase (Section III).
p32 The integrase (Section IV).
The fate of p15 (from p66 cleavage) is unknown. p1 and p2 are probably „spacer‟ peptides. The final
cleavages probably occur after the progeny virus has been released from the cell.
The myristoylated N termini of Gag and Gag-Pol become the N terminus of p17 when the polyproteins
are cleaved. Still associated with the cell membrane, p17 proteins enclose the nucleocapsid as part of the
virion envelope.
Env
This late protein of 856 amino acids is encoded between nucleotides 5802 and 8369 in a single exon.
Once made, it is glycosylated in the rough ER. Here, Env can bind to CD4, contributing to its down-
regulation at the cell surface (Nef also probably decreases cell surface [CD4] (Section VIII)). Env is now
a glycoprotein, gp160, which oligomerises. 5-10% is directed to the cell surface by a signal peptide
(residues 1-30) at its N terminus. The rest is degraded in lysosomes.
At the cell surface, the N terminal region is transferred through the membrane, and the signal peptide then
cleaved off. Transfer continues until about half of the sequence is extracellular. A cell proteinase (not
p10) then catalyses cleavage of gp160 between residues 511 and 512. The N terminal region becomes
gp120, outside the cell, and the C terminal region gp41, which is partly outside, spans the membrane, and
has its C terminus still within the cell. N terminal regions of gp120 and of gp41 interact to form the spikes
of the virion (refer to Section II and to the virion structure shown elsewhere in this Section).
gp120
C N N gp41 outside
cell membrane
inside
C
Some gp120 fails to bind to gp41 and is shed from the cell. However, the gp120-gp41 interaction results
in a modified cell membrane that encloses the nucleocapsid as it buds from the cell, and becomes the
virion envelope.
The other late proteins
Vif
This stands for „virion infectivity factor‟. The protein, of 192 residues, is encoded between nucleotides
4621 and 5196. Vif enhances degradation of APOBEC3G, a cell enzyme otherwise packaged into HIV
virions, which, on infection, potentially disarms HIV DNA by cytosine deamination. Vif may also cleave
the C terminal part of gp41 (Section II). It is found associated with Golgi and other vesicles.
Vpr
This virion protein, of 78 residues, is encoded between nucleotides 5139 and 5372 in HIV-1 IIIBH10, but in
most clinical strains it contains 96 residues. It is reported to activate transcription from HIV and other
promoters weakly. It seems to arrest some cells in G2, and, possibly independently of this, to induce
apoptosis. It is not clear how this might be advantageous to the virus. The protein aids movement of the
pre-integration complex to the nucleus (Section III).
19
Vpu
This non-virion protein, of 81 residues, is encoded between nucleotides 5642 and 5884. In cells, it is
membrane-associated. It may dissociate gp160 from intracellular CD4 in the ER, enhancing gp160
movement to the cell surface and inducing CD4 degradation in the ER. It seems to aid virion release. It is
not present in HIV-2.
Tat
This is the single (first) exon form. It allows continued high-level transcription late in the replicative cycle
(Section VII).
The structure of the virion
phospholipid bilayer derived from cell
gp120
gp41
The spike is composed
of 3 molecules each
of gp120 and gp41.
There are 72 spikes/virion
p17 (MA)
forms an icosadeltahedral,
outer capsid (or ‘matrix’)
p24 (CA)
forms a tapered, conical,
inner capsid
Within the inner capsid: 2 copies of virion RNA
(capped, poly A tailed, bound to cell tRNALys)
p7 (NC) (and some p15 from Gag-Pol cleavage)
interacting with region of RNA
p10 (proteinase)
p66/p51 (rtase)
p32 (IN; integrase)
Within the matrix, probably outside the inner capsid: p6 (maturase)
Virion-free spread of HIV
Many enveloped viruses spread in vitro and in vivo by inducing cell-cell fusion, so that infection does not
require production of free virions. For HIV, gp120 production at the cell surface allows an infected cell to
interact with an uninfected CD4+ cell, although such an interaction, lacking involvement of chemokine
receptors and gp41, is not the same as that occurring when a free virion interacts with a cell. Nevertheless,
virion RNA, presumably as a ribonucleoprotein complex, could move to an uninfected cell. It is also
possible that cell-to-cell spread of HIV could occur through cell fusion not involving expression of virus
protein at the cell surface. Such spread is unlikely in circulating cells, but could be important in lymph
nodes, spleen and the CNS. Possible virion-free spread of HIV may limit efficacy of vaccines directed
against virions.
20
XII FROM HIV INFECTION TO AIDS
Infection is followed by the „acute phase‟, a 3-21 day period, 1-6 weeks after infection, of fever, rashes,
headaches and lethargy. Viral antigens, particularly p24, are detected in the blood, and [CD4 + T cell]
temporarily decreases.
„Seroconversion‟ follows. Anti-HIV antibodies are detected, and HIV antigens disappear. [CD4+ T cell]
increases and clinical improvement occurs. The patient is now HIV + but asymptomatic.
After 9-11 y, viral antigens reappear in the blood, [CD4 + T cell] decreases, and, when it falls below 200
cells/mm3, opportunistic infections occur and „AIDS‟ develops.
For a previously healthy person undergoing HAART chemotherapy (Section XV), times from
seroconversion to onset and from onset to death are usually about 12-15 and 1-2 y respectively.
XIII CLINICAL TESTING FOR HIV-1
This is usually done on blood.
1 For HIV antibodies (ELISA). This was introduced in 1985. There has been controversy over
patenting rights and hence the „discovery‟ of HIV. It now appears that HTLV-III used by Gallo
to develop the original test was (inadvertently?) the French LAV. (Section I). Modern
commercial kits use purified recombinant antigen mixes, usually of gp120, gp41 and p24. HIV-2
is routinely checked at the same time, although there have been very few cases outside W Africa.
2 For HIV antibodies (Western blotting). This was introduced in 1986. It is routinely used to check
positive results in (1). It checks activity against a range of recombinant viral antigens. Different
criteria are set by CDC (US), WHO and kit manufacturers as to what, precisely, constitutes a
„positive‟ result. However, positive results in (1) and (2) make a patient HIV +.
3 For HIV antigens (ELISA). This was introduced in 1987. It is of use to check infection very
early, before seroconversion (Section XII), and also after onset of AIDS, to follow its
progression. It is also used to test whether a neonate of a mother at risk showing positive in (1)
and (2) has simply acquired HIV antibodies passively rather than being truly HIV +.
4 CD4+ T lymphocyte counts. These are routinely made to follow disease progression. The 600-
1200 cells/L count of a healthy person falls to < 200 cells/L as AIDS symptoms occur.
5 Because of the slow development of AIDS, surrogate markers are variously used to indicate
disease progression before conventional symptoms appear. These include [2 microglobulin] (a
HLA I component), [neopterin] (a macrophage product), [various interferons], delayed-type
hypersensitivity, and early symptoms (thrush, weight loss, etc).
6 PCR to amplify and hence detect viral nucleic acid sequences is also used, where feasible.
Controversies and practicalities
Should those „at risk‟ (e.g. in health service, sex industry, etc) be compulsorily tested? In UK, everyone
wanting to be tested is. Nearly all UK life insurance applications require a statement about whether an
HIV test has been sought. ~50 countries (not UK) require HIV tests on long-term visitors. Failure to
disclose a positive test to a sex partner is an offence in many countries. In UK, all blood transfusion units
screen collected samples (anonymously).
XIV PRE-CLINICAL TESTS ON POTENTIAL ANTI-HIV AGENTS
1 In cell culture, measurements of effects on HIV-caused cytopathic effect, syncytium formation,
antigen production, rtase activity.
2 Rodent models of AIDS (cheap; lots of experimental animals; results within months) would be
very attractive. Rodents are generally not susceptible to HIV, however. SCID-hu mice
(genetically immunodeficient mice having a human haemotopoietic tissue graft) produce
„human‟ CD4+ T cells and are susceptible to HIV infection, but the virus causes acute rather than
chronic disease. Transgenic mice with HIV provirus sequence in the germ-line develop AIDS-
like symptoms. Work continues to develop an experimental model.
3 Primate models (expensive; few animals; results in years; ethics) are problematic. Non-human
primates are generally not susceptible to HIV. „SHIV‟, a hybrid virus, contains HIV-1 env, rev
and tat genes; the rest is from an SIV genome. It infects the relatively plentiful cynomolgus
monkey. It is not yet clear whether immunodeficiency develops.
21
XV CHEMOTHERAPY
Currently, there are 24 licensed drugs, developed in the US and increasingly used elsewhere All but three
act on the rtase or proteinase. There are about 30-50 at various stages of clinical trials.
Phase I trials pilot work, in which gradually increasing doses are given to a few patients (usually with
advanced disease) to establish pharmacokinetics and tolerated doses.
Phase II trials involve several 100 patients.
Phase III trials involve several 1000 patients.
There are several potentially susceptible events in the virus replicative cycle.
Inhibitors of attachment, co-receptor binding or membrane fusion
1 Soluble, recombinant CD4 (sCD4)
A stop triplet, placed before that part of the CD4 gene that encodes the membrane portion of the protein,
when inserted into a bacterium, produces a „soluble‟ (that is, free) version of the extracellular part of
CD4. sCD4 competes with cell-associated CD4 for HIV and inhibits HIV replication in cell culture.
However it works poorly in vivo. This may be because, although laboratory and clinical strains of HIV
bind sCD4 equally well, only in the former does the binding strip gp120 from the surface of the virus,
making it less infective.
sCD4, fused at the C terminus to ricin or a bacterial exotoxin, has been designed to deliver these toxic
materials specifically to cell surfaces expressing gp120. sCD4 similarly fused to the heavy chain of IgG
may bind specifically to gp120-expressing cells and attract antibody-dependent cytotoxicity. A drawback
to these approaches is that uninfected cells, to which free gp120 is attached, would be attacked. However,
such gp120 is already attached to (cell) CD4, and might be less susceptible.
2 Anionic polymers
A variety of anionic polymers, in cell culture, inhibit HIV attachment, perhaps by binding to V3 of gp120
(Section II). They are poorly absorbed from the gut, however, and, once in blood, bind non-specifically to
many sites.
3 Inhibitors of CXCR4/CCR5 binding (Section II)
Although natural peptide chemokines inhibit HIV binding, agents that do so and do not simultaneously
activate cells are needed. Such agents are already being studied in the treatment of inflammatory
disorders. Several non-peptide drugs are being developed. One, maraviroc, which inhibits HIV-CCR5
interaction, was approved for clinical use in August 2007.
4 Inhibitors of gp41-mediated membrane fusion (Section II)
Inhibitors of reverse transcription
This process is essential to the virus, and is (probably) not required by the cell, so it appears a very
promising target. However, an agent against it is ineffective once the provirus is integrated, and only
effective against a new round of virus replication.
1 Nucleoside analogues
There are 7 of these (and 1 recent nucleoTide analogue) in clinical use. The first (licensed 1987), and
most widely used, is Zidovudine (Retrovir; Azidothymidine; AZT), manufactured by Wellcome.
22
Reverse transcription is somewhat more sensitive than cell DNA replication to inhibition because Rtase
binds AZT(TP) better than natural dXTPs, and because at least some DNA polymerases bind AZT(TP)
worse than natural dXTPs. Nevertheless, the side-effects of AZT are principally associated with cell DNA
polymerase inhibition. Most serious of the side-effects is bone-marrow suppression. AZT is taken orally
as capsules, twice a day, often over very long periods. HIV strains resistant to AZT develop because of 4-
5 specific amino acid substitutions in the rtase, located at the active site.
The current view is that AZT is largely of use in prolonging life in advanced AIDS. It also seems useful
in reducing transmission from HIV+ mothers to neonates. It seems of little use (when used in isolation) in
stopping progression to AIDS, although this is disputed.
There is thus a dilemma: should AZT (and similar drugs) be given to HIV + asymptomatic patients? The
answer depends on whether one believes AZT slows progression to AIDS. Certainly in the US, it (and
similar drugs) are administered very early on. However, the earlier that it is given, the earlier resistant
strains may develop. And why subject an asymptomatic person to the toxicity effects? In the UK, at
present, treatment is generally delayed until the [CD4 + cell] drops to < 350 cells/mm3.
2 Non-nucleoside rtase inhibitors
The first was licensed in 1996 and there are now 3 in clinical use. They are chemically divergent
polycyclic compounds that bind to a hydrophobic pocket close to the rtase active site.
Inhibitors of integration
Integration represents a viral-specific process necessary for HIV replication. Inhibitors of it have been
sought since the early 1990s. One, raltegravir, was approved for clinical use in October 2007.
Inhibitors of the viral proteinase (p10; Section XI)
23
Overview of chemotherapy
Over the years, the field of AIDS chemotherapy has been characterised by careful pre-clinical testing but
scrappy clinical research. AZT was licensed in circumstances that would not have allowed a drug treating
any other illness to have been approved. An additional concern is that clinical trial patients, particularly in
the US, are predominantly white homosexual men. This may be a poor „experimental sample‟ on which to
evaluate a drug for use in a wider spectrum of the population. The terms „HIV exceptionalism‟ and „fast-
track approval‟ have been used to express the way in which early work on anti-HIV agents was carried
out. „Parallel-track‟ drug use describes prescription on compassionate grounds, in the absence of normal
clinical evaluation, to those lacking therapeutic options. Because strains of virus resistant to rtase
inhibitors and proteinase inhibitors develop in infected individuals, there is now a move towards
combination therapies involving both kinds of agent. This is known as „highly-active antiretroviral
therapy‟ (HAART). For many patients, it produces at least temporary clinical improvement. The cost of
the regimen is about $12-20K/year in the US (equivalent in UK). Currently, <10 6 people are receiving
antiretroviral therapy.
XVI THERAPY OF OPPORTUNISTIC INFECTIONS
This is often the most feasible option.
Pneumocystis carinii-associated pneumonia
Even before the emergence of AIDS, experience of treating this condition was acquired in cases
of iatrogenically induced immunodeficiency. Anti-protozoal agents and methotrexate analogues
are used.
Herpesvirus-associated diseases
Acyclovir, a purine analogue is used. Converted to the triphosphate, it inhibits viral DNA
synthesis.
Tuberculosis
This is by far the most widespread and dangerous opportunistic infection associated with AIDS
in developing countries. Caused by a mycobacterium present at sub-clinical levels in perhaps a
quarter of the world‟s population, its effects are treated with a cocktail of antibiotics.
XVII AIDS VACCINES
In general, preventative measures are less immediately attractive than therapeutic ones. Additionally,
there are too few cases in the developed West to make the option economically attractive, and vaccines
are likely to be too expensive for developing countries.
Additional problems:
1 HIV has considerable genetic and hence antigenic variability. „Swarms‟ of HIV variants, varying
as the disease progresses, can be isolated from individual patients.
2 There is no clear correlation between antiviral immunity and disease progression. Development
of other viral vaccines has been based on the premise that those recovering from an acute
infection develop immunity: no-one is known to have completely recovered from and cleared an
HIV infection. (However, see Section XX.)
3 There are no well-established, economical animal models on which potential vaccines can be
trialled.
4 A therapeutic rather than preventative vaccine is the ideal, and this is a developing area.
However, the only such vaccine currently used is for rabies (because of the delay, peculiar to this
disease, between introduction of the virus into the bloodstream and its infection of cells).
5 Virus spread in a patient may not involve the production of free virions susceptible to a vaccine
(Section XI).
Approaches:
1 „Live‟ attenuated or inactivated whole virus. Some human viral vaccines use inactivated virus.
There is good immunogenic response, but a (slight) risk of infection or reversion to active virus.
2 Natural virus protein. This is an expensive option.
3 Recombinant virus protein. This is used in some human vaccines. It is cheap. A protein
synthesised in a prokarotic cell will not be glycosylated, and may not be (so) immunogenic.
4 Synthetic peptides. These are cheap, but tend not to be very immunogenic.
5 Recombinant „live‟ non-HIV virus (or other vector) carrying HIV antigen(s). Several such
organisms are being developed, including, most recently (but unsuccessfully), a recombinant
adenovirus expressing Gag, Pol and Nef.
24
6 DNA „vaccines‟ encoding HIV proteins, injected intramuscularly, have some immunogenicity in
humans.
7 Various immunostimulatory molecules (e.g. IL-2) could be used to boost [T cell] generally.
However, such stimulation tends to activate HIV replication (Sections III, V).
Currently, approaches 5 and 6 are receiving most attention. Partly because of the difficulty of eliciting an
effective antibody response, and partly because a potent CD8 + cytotoxic T cell response seems to be a
feature of some forms of „natural immunity‟ (Section XX), vaccines aimed at generating the latter
response are receiving most attention. There are about 20 potential vaccines in some kind of clinical trial
at present.
XVIII HOW DOES HIV CAUSE IMMUNODEFICIENCY?
HIV infects, replicates in, and kills CD4+ T cells. However, early work suggested that only about 1 in 10 2-
104 cells of a patient became infected with virus. This was an unexpected finding, as the number of T cells
decreases much more than this as AIDS develops (Section XIII). More recently, enhanced-PCR work
suggests that the virus, or, at least, viral nucleic acid, is present in a much higher proportion of a patient‟s
T cells. Nevertheless, HIV does seem to „disappear‟ for a long period after the initial infection. Recent
work on lymphoid tissue, however, suggests that there are large reservoirs of HIV in CD4 + T cells and
macrophages, and also extracellular reservoirs attached to the outside of follicular dendritic cells (Section
II) that could infect other CD4+ cells as they pass through lymphoid tissue. Currently, it is believed that,
in asymptomatic HIV+ patients apparently having few infected CD4+ cells, HIV is, in fact, rapidly
replicating. It has been estimated that ~1010 virions are generated daily. However, the infected cells are
rapidly cleared and replaced, so the effects of this massive viral activity are hidden. Eventually, when this
is no longer possible, AIDS develops.
XIX SOME OTHER CLINICAL EFFECTS IN AIDS
CNS abnormalities
Some patients experience cognitive impairment/dementia. This seems especially true of neonates. HIV is
carried to the CNS by monocytes. Macrophages and microglia (Section II) seem to be the main CNS cells
affected. Late in AIDS, neuron loss occurs, although HIV does not replicate in these cells. gp120 may
compete with neurotrophic factors, and/or increase neuron intracellular [Ca 2+]. Tat and Nef are neurotoxic
in vitro. Infected macrophages may release neurotoxic cytokines. Opportunistic infections may contribute
to the clinical effects seen.
Kaposi‟s sarcoma
This is ordinarily a rather rare cancer arising from the endothelium of blood and lymph vessels. Because
AIDS-associated Kaposi‟s occurs predominately in homosexual men, it was suspected that another, sex-
transmitted factor was required. This has recently been shown to be a human herpesvirus (HHV-8).
Perhaps because of changing life-styles, AIDS-associated Kaposi‟s is becoming rarer.
XX HOW DO SOME PEOPLE ‘ESCAPE’ AIDS?
Many cell proteins (intra- and extra-cellular) influence (positively or negatively) HIV replication.
Potentially, genetic variation in any of them might affect susceptibility of an individual or population to
HIV infection and progression to AIDS.
25
XXI ORIGIN OF HIV
05.06.1981 First report of AIDS in US (Section I).
Late 70s-early 80s Clusters of diseases in African heterosexual people in Belgium, and in „high-risk‟
men in NY, Miami that are retrospectively diagnosed as AIDS.
1968 Earliest stored sera/autopsy material in US retrospectively registering HIV +.
1960s-1970s Sporadic case reports in Africa retrospectively diagnosed as AIDS.
1959 Tissue from a young UK man who died of a „wasting disease‟ retrospectively
reported to be HIV+ (but this is disputed).
1959 Earliest HIV+ stored serum sample (from the Congo).
Some estimates, from analyses of HIV genetic variability, suggest that virulent HIV could have evolved
within the past few decades; others suggest that it may have been slowly spreading in Africa for the last
100-200 years or even longer. Molecular phylogeny suggests that a species jump (from chimpanzee to
man) occurred on at least 3 occasions, possibly as a result of the butchering and consumption of
chimpanzees.
Relationship between HIV and SIV
On the basis of base sequence comparisons, four groups have been distinguished:
1 HIV-1, SIV-CPZ (chimpanzees);
2 HIV-2, SIV-SMM (sooty mangabeys);
3 SIV-MND (mandrills);
4 SIV-AGM (African green monkey).
Most HIV-1 strains belong to a main (M) group. An outlier (O) group is found in Cameroon, Gabon and
Equatorial Guinea. In 1998, a new (N) group was identified in Cameroon. It is likely that the three groups
represent three different transfers from chimpanzee to man. Group M has radiated into a number of
„clades‟: A, D, F, G, H, J, K (Africa); B (USA, Europe); C (Africa, Asia, India); E (Thailand);
recombinants between clades also occur.
Possible relatives of HIV (and other retroviruses)
Endogenous retroviruses were discovered in eukaryotic cells in the 1970s. Unlike exogenous retroviruses,
they are transmitted vertically, in the germ-line, integrated in the cell genome. They occasionally emerge
(often under artificial cell culture conditions) as virus particles.
Eukaryotic retrotransposons were discovered in the 1980s. They are pieces of DNA, transcripts of which
are retrotranscribed and re-integrated into the chromosome using retrovirus-like machinery.
26
ADDITIONAL READING
In order to check and update information given here, you may want to scan databases. In this field,
PubMed, Medline, PreMedline and Web of Science are particularly useful. Keywords to use are „HIV‟
and „HIV-1‟, and you may want to restrict your search to recent years, to English language material, and,
perhaps, to reviews. In addition, it is worth scanning Nature, Science, New Scientist, Trends in
Biochemical Sciences, Trends in Genetics, Trends in Microbiology, Trends in Molecular Medicine and
Nature (Medicine) on a regular basis. The following few varied references are mostly reviews. They are
NOT more important than many others, nor do they „cover‟ all the topics dealt with here. It is not
suggested that all or any of them are essential reading. They are, however, recent and relevant, and some
might be good starting material if you want to read further.
Biswas, P., Tambussi, G. & Lazzarin, A. (2007) Access denied? The status of co-receptor inhibition to
counter HIV entry. Expert Opinion on Pharmacotherapy 8 923-933.
Butler, I.F., Pandrea, I., Marx, P.A. & Apetrei, C. (2007) HIV genetic diversity: biological and public
health consequences. Current HIV Research 5 23-45.
Citterio, P. & Rusconi, S. (2007) Novel inhibitors of the early steps of the HIV-1 life cycle. Expert
Opinion on Investigational Drugs 16 11-23
De Clercq, E. (2007) The design of drugs for HIV and HCV. Nature Reviews: Drug Discovery 6 1001-
1018.
Deeks, S.G. & Walker, B.D. (2007) Human Immunodeficiency Virus controllers: mechanisms of durable
virus control in the absence of antiretroviral therapy. Immunity 27 406-416.
Este, J.A. & Telenti, A. (2007) HIV entry inhibitors. Lancet 370 81-88.
Greene, W.C. (2007) A history of AIDS: looking back to see ahead. European Journal of Immunology 37
S94-S102.
Liu, S., Wu, S. & Jiang, S. (2007) HIV entry inhibitors targeting gp41: from polypeptides to small-
molecule compounds. Current Pharmaceutical Design 13 143-162.
Quivy, V., de Walque, S. & van Lint, C. (2007) Chromatin-associated regulation of HIV-1 transcription.
Implications for the development of therapeutic strategies. Subcellular Biochemistry 41 371-396.
Piguet, V. & Steinman, R.M. (2007) The interaction of HIV with dendritic cells: outcomes and pathways.
Trends in Immunology 28 503-510.
Reiche, E.M.V., Bonametti, A.M., Voltarelli, J.C., Morimoto, H.K. & Watanabe, M.A.E. (2007) Genetic
polymorphisms in the chemokine and chemokine receptors: impact on clinical course and
therapy of the human immunodeficiency virus type 1 infection (HIV-1). Current Medicinal
Chemistry 14 1325-1334.
Repik, A., Richards, K.H. & Clapham, P.R. (2007) The promise of CCR5 antagonists as new therapies for
HIV-1. Current Opinion in Investigational Drugs 8 130-139.
Saez-Cirion, A., Pancino, G., Sinet, M., Venet, A. & Lambotte, O. (2007) HIV controllers: how do they
tame the virus? Trends in Immunology 28 532-540.
Suzuki, Y. & Craigie, R. (2007) The road to chromatin – nuclear entry of retroviruses. Nature Reviews
Microbiology 5 187-196.
Titti, F., Cafaro, A., Ferrantelli, F., Tripiciano, A., Moretti, S., Caputo, A., Gavioli, R., Ensoli, F., Robert-
Guroff, M., Barnett, S. Ensoli, B. (2007) Problems and emerging approaches in HIV/AIDS
vaccine development. Expert Opinion on Emerging Drugs 12 23-48.
Tsibris, A.M.N. & Kuritzkes, D.R. (2007) Chemokine antagonists as therapeutics: focus on HIV-1.
Annual Review of Medicine 58 445-459.
Chiu, Y.-L. & Greene, W.C. (2008) The APOBEC3 cytidine deaminases: an innate defensive network
opposing exogenous retroviruses and endogenous retroelements. Annual Review of Immunology
26 317-353.
Cohen, M.S., Hellmann, N., Levy, J.A., deCock, K. & Lange, J. (2008) The spread, treatment, and
prevention of HIV-1: evolution of a global pandemic. Journal of Clinical Investigation 118
1244-1254.
Geeraert, L., Kraus, G. & Pomerantz, R.J. (2008) Hide-and-seek: the challenge of viral persistence in
HIV-1 infection. Annual Review of Medicine 59 487-501.
Kuhmann, S.E. & Hartley, O. (2008) Targeting chemokine receptors in HIV: a status report. Annual
Review of Pharmacology 48 425-461.
Schoenly, K.A. & Weiner, D.B. (2008) Human Immunodeficiency Virus type 1 vaccine development:
recent advances in the cytotoxic T-lymphocyte platform “spotty business”. Journal of Virology
82 3166-3180.
Walker, B.D. & Burton, D.R. (2008) Towards an AIDS vaccine. Science 320 760-764.