Documents
Resources
Learning Center
Upload
Plans & pricing Sign in
Sign Out

Primer DNA Sequences

VIEWS: 5 PAGES: 3

									Primer name             Primer sequence (5'-3')    Description

for rpaR mutant construction
rpaR-No               GCCGGATCCGCAGCGGCGACCGAATTGTC
rpaR-Ni               GTCCGATCGGACAGGTCACAAACGGACGATCATACCGCCGCAAC
rpaR-Ci               GGAGGTTGCGGCGGTATGATCGTCCGTTTGTGACCTGTCCGATC
rpaR-Co               CCTCTAGATCGACAGGCCGTACTCCATC

for RpaR overexpression
rpaR-NcoIHis6                                 His6-tagged primer
                      GCGCCATGGGCCATCACCATCACCATCACATCGTCGGCGAAGATCAGETTTG
rpaR-R                                        Reverse primer
                      AACGAGATCTTCACAAACGGATCAATCCGAG

RpaR D82N mutation
rpaRD82N-F         CGCGGCACCGGATTGACCGCGCTGAAG
rpaRD82N-R         CTTCAGCGCGGTCAATCCGGTGCCGCG

rpal promoter cloning
lacZ-F                                           For lacZ cloning
                        AAAAAGCTTAGGAAACAGCTATGACCATGATTACGGATT
lacZ-R                                           For lacZ cloning
                        AAAAATCTAGATTATTATTTTGACACCAGACCAACT
rpaR-F1                                          For rpaR cloning
                        AAAAAATGCATATCACCATTTGGGACACCTC
rpaR-R1                                          For rpaR cloning
                        AAAGGTACCAAAGCTAGCCACAAACGGATCAATCCG
rpaRrpal(Lux1)-F                                 For Lux-box mutation
                        AAAGCTAGCACCTGTCCGATCGGACAG
rpaRrpal(Lux23)-F                                For Lux-box mutation
                        AAAGCTAGCACTAGTCCGATCGGACTT
rpaRrpal(Lux)-R                                  For
                        TTGGGCCCGATGAAATTCCCCTCCTG Lux-box mutation
rpaI-PF                                          For Lux-box mutation
                        AAAAAATGCATACCTGTCCGATCGGACAG
rpaI-PF(Lux2)                                    For Lux-box
                        AAAAAATGCATACTAGTCCGATCGGACTTTAG mutation
rpaI-PR                                          For Lux-box mutation
                        AAAGGTACCGATGAAATTCCCCTCCTG

footprinting experiments
rpaI-F-bind-6FAM       CGGTGAAATTCCATCTGATCG       6-FAM labeled primer
rpaI-R-bind            AGCAGACCGGCATAGAGCG         Reverse primer

S1 nuclease &primer exension assay
rpaI-priex-6FAM      ATCTGGTGACGGATGCGGAAG         6-FAM labeled primer
rpaI-S1-R            GACTGGTCGAGGGTTACTGC          Reverse primer

EMSA assays
rpa0745-PF              TGCCACGAACCGCACGGC
rpa0745-PR              TTCAAAGGCCCCCTTCGC
rpa0905-PF              AAAAAATGCATTAAACAGGCGGGCGGCCG
rpa0905-PR              AAAGGTACCGTTGTTCTCCCAGGATAGCC
rpa1096-PF              AAAAAATGCATGCGCTCTCTCTCGCGGGTC
rpa1096-PR              AAAGGTACCGGTTCCTCCCGCAGAACTAG
rpa1098-PF              AAAAAATGCATGACGCTTGTGATAGCGCCG
rpa1098-PR              AAAGGTACCAACGATCTCCTATCGGCTAC
rpa1674-PF              AAAAAATGCATTCTGATTGACGCCAGAGAC
rpa1674-PR              AAAGGTACCCACTCAGCTCCTAACCCGTC
rpa1845-PF              AAAAAATGCATACTAACGCCGCGTCACAACG
rpa1845-PR              AAAGGTACCTTAACGCCCCAATTCCAATAATTG
rpa1876-PF              GCAGCAAAGGCCGGCAAG
rpa1876-PR              CGCTTACCCCCAAATCGAG
rpa2519-PF              AAAAAATGCATGTGTGCCTCTTGTTTGCGTG
rpa2519-PR              AAAGGTACCGCCGCCTCCTAACGGAGAC
rpa2883-PF              AAAAAATGCATACCTGACTCCTTTGGCGGC
rpa2883-PR   AAAGGTACCTTCCATTCCCCTGAAGAGAAG
rpa3185-PF   AAAAAATGCATCGCACGCGATGTTCAAGGAG
rpa3185-PR   AAAGGTACCCACTGCACCTGCCTCAATATG
rpa3306-PF   AAAAAATGCATTGACGTAGCGGTGCCGAGGC
rpa3306-PR   AAAGGTACCCGTTGTAATCCCTTCGCCTG
rpa3599-PF   AAAAAATGCATTAATTCGCCTCTCGCCTCC
rpa3599-PR   AAAGGTACCTGCAACCTCCCCCGGCCG
rpa3892-PF   AAAAAATGCATCAACCGCCTGAACCATCC
rpa3892-PR   AAAGGTACCGGCGGTCGTCAGTCCAATTC
rpa3929-PF   AAAAAATGCATTTAATTATCTCTGAACGACGGGC
rpa3929-PR   AAAGGTACCTGTGATGCTACCTTCCTGG
rpa4296-PF   AAAAAATGCATGCGGTCTCCTGGAGCGTTC
rpa4296-PR   AAAGGTACCTCACGATGCGTTGACCTATC
rpa4684-PF   AAAAAATGCATTCAATGGCGAGAGACGCGG
rpa4684-PR   AAAGGTACCCTAAGCCTCTCAGGTCGAAG
rpa4713-PF   AAAAAATGCATCATCCCGTATCCTTCCTG
rpa4713-PR   AAAGGTACCAACCCCGCCCGTATCTTCC
 CATACCGCCGCAAC
GTGACCTGTCCGATC

								
To top