DNA 4 by victor1527

VIEWS: 9 PAGES: 6

									                                                       Available online at www.sciencedirect.com




                                                   International Journal for Parasitology 38 (2008) 725–730
                                                                                                                           www.elsevier.com/locate/ijpara




       Human fascioliasis and the presence of hybrid/introgressed forms
           of Fasciola hepatica and Fasciola gigantica in Vietnam
     Thanh Hoa Le a, Nguyen Van De b, Takeshi Agatsuma c, Thanh Giang Thi Nguyen d,
               Quoc Doanh Nguyen d, Donald P. McManus e, David Blair f,*
                                         a
                                            Department of Immunology, Institute of Biotechnology, Hanoi, Viet Nam
                                             b
                                               Department of Parasitology, Hanoi Medical University, Viet Nam
                                    c
                                      Department of Environmental Health Sciences, Kochi Medical School, Kochi, Japan
                                                d
                                                  National Institute of Veterinary Research, Hanoi, Viet Nam
                                          e
                                            Queensland Institute of Medical Research, Brisbane, Qld 4006, Australia
                            f
                                School of Marine and Tropical Biology, James Cook University, Townsville, Qld 4811, Australia

                                 Received 19 June 2007; received in revised form 1 October 2007; accepted 2 October 2007




Abstract

   The two species common of liver fluke, Fasciola hepatica and Fasciola gigantica, cause human fascioliasis. Hybrids between these spe-
cies, and introgressed forms of Fasciola, are known from temperate and subtropical regions of eastern Asia. Here, we report the presence
of hybrid and/or introgressed liver flukes in Vietnam where it has recently been recognised that human fascioliasis is an important zoo-
notic disease. Specimens examined came from domestic stock (cattle and buffalo) at slaughter and also from human patients. DNA
sequences were obtained from the nuclear ribosomal second internal transcribed spacer (ITS-2) and from portions of two mitochondrial
protein-coding genes. Mitochondrial sequences in every case were similar to those of Fasciola gigantica. Nuclear ITS-2 sequences
belonged to one or other of the Fasciola species, or, sequences from both were found in the same individual worm. This study extends
the known range of hybrids or introgressed forms of Fasciola into tropical regions of Asia.
Ó 2007 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Keywords: Fasciola gigantica; Fasciola hepatica; Hybridisation; Internal transcribed spacer region; Introgression; Vietnam



1. Introduction                                                                 et al., 2006), but the existence of individuals with intermedi-
                                                                                ate morphological characteristics can cause confusion (e.g.
   The commonest and most widespread liver flukes of the                         Terasaki et al., 1982; Itagaki et al., 2005a) and has led to
genus Fasciola are Fasciola hepatica Linnaeus, 1758 (mostly                     the increasing use of molecular methods (e.g. Marcilla
in temperate regions) and Fasciola gigantica Cobbold, 1856                      et al., 2002) or morphometric methods (e.g. Ashrafi et al.,
(mostly tropical in distribution). Adults of both species occur                 2006) to distinguish between the species. It is desirable to
in many domestic ruminants and in humans (Mas-Coma                              know which species is the agent of human or animal disease
et al., 2005; Le et al., 2007) and can cause serious disease.                   in a given area. The two species differ in pathological and epi-
The two liver fluke species appear to be sympatric in many                       demiological characteristics (Mas-Coma et al., 2005).
subtropical and warm temperate areas, especially in Africa                         Difficulties in specific identification have been most
and Asia (Le et al., 2007). They can generally be distin-                       intensively studied in Japan and adjacent areas. Research
guished on the basis of their morphology (e.g. Ashrafi                           there has revealed not only a confusing range of morpho-
                                                                                logical forms but also the presence of worms of different
                                                                                ploidies (diploid, triploid and ‘‘mixoploid’’), all of which
 *
     Corresponding author. Tel.: +61 7 4781 4322; fax: +61 7 4725 1570.         are parthenogenetic and do not produce normal sperm
     E-mail address: david.blair@jcu.edu.au (D. Blair).                         (Terasaki et al., 1982, 2000). Genetic studies on Japanese

0020-7519/$34.00 Ó 2007 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
doi:10.1016/j.ijpara.2007.10.003
726                             T.H. Le et al. / International Journal for Parasitology 38 (2008) 725–730

and Korean worm populations have detected individuals                     Adult worms of Fasciola sp. of Vietnamese origin, col-
that have both nuclear and mitochondrial sequences typi-               lected during 2001–2005 from human patients and animals
cal of F. hepatica and others that appear on the same                  (cattle and buffaloes), were preserved in 70% ethanol and
grounds to be F. gigantica. Individuals also occur that                kept at À20 °C until used for extraction of DNA. Of 21
resemble one species in their nuclear DNA (usually assayed             Vietnamese samples, 12 were of human origin, of which
using ribosomal RNA gene or spacer sequences) but have a               two (FspN-VN and FspQB-VN) were from the cases
mitochondrial genotype typical of the other species (Agat-             involving unusual cutaneous migration of worms reported
suma et al., 2000; Itagaki et al., 2005a,b). Individuals have          in Le et al. (2007). Specimens from eight human cases were
also been found that have, in their tandem array of nuclear            obtained surgically. In two further cases, eggs morpholog-
ribosomal genes, copies of genes apparently derived from               ically identified as being of a Fasciola sp. were recovered
both liver fluke species (Agatsuma et al., 2000 in Korea;               from faeces of human patients serologically positive for
Huang et al., 2004 in north eastern China; Itagaki et al.,             fascioliasis. These eggs were allowed to develop and hatch
2005a,b in Japan and Korea; Lin et al., 2007 in China).                in water (1–2 weeks) and 10–20 miracidia from each patient
An obvious conclusion is that hybridisation and introgres-             were collected for subsequent DNA extraction.
sion (definitions in Dowling and Secor, 1997) are common
in Fasciola populations in this part of Asia, processes that           2.2. Genetic markers
can lead to production of polyploid and parthenogenetic
individuals (Dowling and Secor, 1997). Such individuals                   Genetic markers including mitochondrial genes (cox1,
are often aspermic. There have been no convincing demon-               nad1) and the nuclear second internal ribosomal spacer
strations of hybrid/introgressed liver fluke populations out-           (ITS-2) sequences were obtained. ITS-2 is a useful marker
side Asia, although aspermic triploid individuals of ‘‘pure’’          for distinguishing between F. gigantica and F. hepatica. It
F. hepatica are now known from Britain (Fletcher et al.,               is rather conserved, especially in F. hepatica. There are
2004). Examples of triploid Fasciola sp. are also known                seven sites at which the two species typically differ. One
from Assam and Hawaii (reviewed in Terasaki et al.,                    of these is a deletion in F. gigantica relative to F. hepatica
2000) and Vietnam (Itagaki et al., 2005a). In addition to              that appears to be a diagnostic difference between the spe-
Japan and Korea, aspermic Fasciola spp. of unknown                     cies (e.g. Adlard et al., 1993; Semyenova et al., 2005). There
ploidy are present (but generally uncommon) in the Philip-             is some variability, especially in F. gigantica, that can be
pines, Vietnam, Thailand, Taiwan, India, Nepal and                     confusing (Le et al., 2007). Sequence data from mitochon-
Hawaii (Terasaki et al., 1982).                                        drial genes are more variable than is the case for ITS-2, but
   In Vietnam, fascioliasis (caused by morphologically                 also provide unambiguous recognition of the two species
identified F. gigantica) is very common in cattle and water             (Le et al., 2007).
buffaloes, with prevalences of more than 50% in the Red
River and Mekong deltas, as well as in other coastal                   2.3. DNA extraction, PCR and sequencing
regions (Bui et al., 2003). In recent years, an extraordinary
number of human cases of fascioliasis has been reported, to                 Total genomic DNA was extracted from adult worms
such an extent that this zoonotic infection has become a               and miracidia using the commercial QIAamp DNA extrac-
major public health concern in Vietnam. More than 500                  tion kit (QIAGEN Inc.) according to the manufacturer’s
human cases were recorded in the three years from 1997                 instructions. In the case of adult worms, only a single spec-
to 2000 based on serological tests (Tran et al., 2001). Prior          imen was used in each DNA extraction. Genomic DNA
to 1991, fascioliasis had been regarded as rare in Vietnam.            was diluted to a working concentration of 50 ng/lL and
For example, only two cases were reported in 1978 (Tran                2 lL of this was used as template in a PCR reaction of
et al., 2001). Unusual cases of cutaneous fascioliasis have            50 lL.
also been described (e.g. Xuan et al., 2005; Le et al.,                     PCR was used to amplify the entire nuclear ITS-2 and
2007). Morphologically, the adult flukes found in animals               two mitochondrial genetic markers (a portion of each of
and human patients in Vietnam fall into two categories,                cox1 and nad1). Primers 3SF (forward) (5 0 GGTACCG
one typical of F. gigantica and the other closely resembling           GTGGATCACTCGGCTCGTG3 0 ) and BD2R (reverse)
F. hepatica. Here we report data indicating that hybrid/int-           (5 0 TATGCTTAAATTCAGCGGGT3 0 ) were used for
rogressed populations of Fasciola occur in Vietnam and                 amplification of ITS-2; JB3F (forward) (5 0 TTTTTTGG
that these are implicated in human infection.                          GCATCCTGAGGTTTAT3 0 ) and JB4.5R (reverse)
                                                                       (5 0 TAAAGAAAGAACATAATGAAAATG3 0 ) for cox1
2. Materials and methods                                               as previously published (Bowles and McManus, 1993;
                                                                       Bowles et al., 1995). Primers FND1F (forward) (5 0 TGG
2.1. Sources of Fasciola specimens                                     GGTCTGTTGCAGAGATTTGC3 0 )                  and      FND1R
                                                                       (reverse) (5 0 ATCCAATGGAGTACGGTTACA3 0 ) for
   Parasite material and nucleotide sequences of Fasciola              nad1 were designed for use in this study.
species, their host and geographical origin used in this                    PCR amplification was carried out in a final volume of
study are listed in Table 1.                                           50 lL, including 100 ng template, 10 pmol of each primer
                                       T.H. Le et al. / International Journal for Parasitology 38 (2008) 725–730                                    727

Table 1
List of Fasciola specimens and sequences used in this study, their host and geographical origins
Species               Country         Code of samples                  DNA Extracted from      Host      Markers used             Genbank no/Refs
                                                                                                         cox1      nad1   ITS-2
                                                                                                         p         p      p
F.   sp          G    Vietnam         FspBD-VN                         Adult                   Human                              EU260063
                                                                                                         p         p      p
F.   sp          G    Vietnam         FspPY-VN                         Adult                   Cattle                             EU260074
                                                                                                         p         p      p
F.   spa         H    Vietnam         FspH1-VN                         Adult                   Human                              EU260068
                                                                                                         p         p      p
F.   spa         H    Vietnam         FspH2-VN                         Adult                   Human                              EU260069
                                                                                                         p         p      p
F.   spa         H    Vietnam         FspCB1-VN                        Adult                   Cattle                             EU260064
                                                                                                         p         p      p
F.   spa         H    Vietnam         FspFG1-VN                        Adult                   Human                              EU260066
                                                                                                         p         p      p
F.   spa         H    Vietnam         FspFG2-VN                        Adult                   Human                              EU260067
                                                                                                         p         p      p
F.   spa         H    Vietnam         FspNA-VN                         Adult                   Cattle                             EU260071
                                                                                                         p         p      p
F.   sp          G    Vietnam         FspTH-VN                         Adult                   Cattle                             EU260076
                                                                                                         p         p      p
F.   spb         H    Vietnam         Fsp1-VN                          Adult                   Human                              EU260059
                                                                                                         p         p      p
F.   spb         H    Vietnam         Fsp2-VN                          Adult                   Human                              EU260060
                                                                                                         p         p      p
F.   sp          G    Vietnam         FspB3-VN                         Adult                   Cattle                             EU260061
                                                                                                         p         p      p
F.   sp          G    Vietnam         FspBDB-VN                        Adult                   Cattle                             EU260057
                                                                                                         p         p      p
F.   sp          ?    Vietnam         FspM-VN                          miracidia               Human                              EU260070
                                                                                                         p         p      p
F.   sp          G    Vietnam         FspNB-VN                         Adult                   Cattle                             EU260072
                                                                                                         p         p      p
F.   sp          G    Vietnam         FspT4-VN                         Adult                   Buffalo                             EU260075
                                                                                                         p         p      p
F.   sp          ?    Vietnam         FspX-VN                          miracidia               Human                              EU260077
                                                                                                         p         p      p
F.   spa         H    Vietnam         FspBD1-VN                        Adult                   Human                              EU260062
                                                                                                         p         p      p
F.   spa         H    Vietnam         FspCB2-VN                        Adult                   Buffalo                             EU260065
                                                                                                         p         p      p
F.   spa         H    Vietnam         FspN-VN                          Adult                   Humand                             EU260073
                                                                                                         p         p      p
F.   sp          H    Vietnam         FspQB-VN                         Adult                   Humand                             EU260078
                                                                                                         p         p      p
F.   hepatica         Australia       Fh-AU                            Adult                   Cattle                             EU260058
                                                                                                         p         p      p
F.   hepatica         Uruguay         Fh-UR                            Adult                   N/A                                AB010974
                                                                                                                          p
F.   hepatica         Spain           FhCa-SP                          N/A                     Cattle                             AJ272053
                                                                                                                          p
F.   hepatica         France          Fh-FR                            Adult                   Cattle                             AJ557567
                                                                                                                          p
F.   hepatica         China           Fh(Si)-CN                        Adult                   N/A                                AJ557568
                                                                                                                          p
F.   hepatica         Ireland         Fh-IR                            Adult                   N/A                                AB207148
                                                                                                                          p
F.   hepatica         C. Asia         FhSemyenovaH1                    Adult                   N/A                                Semyenova et al., 2005
                                                                                                                          p
F.   hepatica         Armenia         FhSemyenovaH2                    Adult                   N/A                                Semyenova et al., 2005
                                                                                                                          p
F.   hepatica         Austria         Fh_AT                            N/A                     N/A                                DQ683546
                                                                                                                          p
F.   gigantica        C. Asia         FgSemyenovaG5, G6, G7, G8        Adult                   N/A                                Semyenova et al., 2005
                                                                                                         p         p      p       c
F.   gigantica        Indonesia       Fg(IndoA)-ID                     Adult                   N/A
                                                                                                         p         p      p
F.   gigantica        Indonesia       Fg-ID                            Adult                   N/A                                EU260080
                                                                                                         p         p      p
F.   gigantica        China           Fg(GxB10)-CN                     Adult                   Buffalo                             EU260079
                                                                                                                          p
F.   gigantica        China           Fg(Gx)-CN                        Adult                   Buffalo                             AJ557569
                                                                                                                          p
F.   gigantica        Indonesia       Fg(IndoT)-ID                     Adult                   Cattle                             AB010977
                                                                                                                          p
F.   gigantica        Thailand        Fg-TL                            Adult                   Cattle                             AB207149
                                                                                                                          p
F.   gigantica        Burkina Faso    Fg(Bobo)-BF                      Adult                   Cattle                             AJ853848
                                                                                                                          p
F.   gigantica        Zambia          FgZamI-ZA                        Adult                   N/A                                AB010975
                                                                                                                          p
F.   gigantica        Zambia          FgZamII-ZA                       Adult                   N/A                                AB010976
                                                                                                                          p
F.   sp               China           Fsp(He1)-CN                      Adult                   Sheep                              AJ557570
                                                                                                                          p
F.   sp               China           Fsp(He2)-CN                      Adult                   Sheep                              AJ557571
                                                                                                                          p
F.   sp               Japan           FspI-JP                          Adult                   N/A                                AB010978
                                                                                                                          p
F.   sp               Japan           FspII-JP                         Adult                   N/A                                AB010979
                                                                                                                          p
F.   sp               Japan           FspKochi1-JP                     Adult                   Cattle                             AB207152
                                                                                                                          p
F.   sp               Japan           FspSaita-JP                      Adult                   Cattle                             AB207151
                                                                                                                          p
F.   spa              Japan           FspHokai-JP                      Adult                   Cattle                             AB207150
                                                                                                         p         p      p
F.   spa              Korea           Fsp(Kor2)-KR                     Adult                   N/A                                c
                                                                                                         p         p      p       c
F.   sp               Korea           Fsp(Kor4)-KR                     Adult                   N/A
                                                                                                         p         p      p       c
F.   sp               Korea           Fsp(Kor5)-KR                     Adult                   N/A
                                                                                                         p         p      p       c
F.   sp               Japan           FspKochi2-JP                     Adult                   N/A
N/A: not available.
  a
    Indicates apparent hybrid/ introgressed specimens (see text).
  b
    Indicates two worms known to have ITS-2 sequences of both Fasciola hepatica and Fasciola gigantica type. For Vietnamese worms, G = F. gigantica –
like and H = F. hepatica - like.
  c
    Indicates data from Agatsuma et al. (2000).
  d
    Indicates specimens that had undertaken cutaneous migration in humans as reported in Le et al. (2007).


and a mix of the remaining PCR components (PCR Master                         for cox1 with initiation at 94 °C for 5 min, then 35 cycles
Mix from Promega). The PCR reactions were carried out                         including denaturation at 94 °C for 1 min, annealing at
in a MJ Thermal Cycler PTC-100 (MJ Research, USA)                             37 °C for 1 min, extension at 72 °C for 2 min. For ITS-2
728                             T.H. Le et al. / International Journal for Parasitology 38 (2008) 725–730

and nad1 the above conditions were used, except that                   which has many probable errors near the 5 0 end. Sequences
annealing was at 50 °C for 1 min. Finally, all reactions were          reported by Adlard et al. (1993) (F. gigantica from Indone-
held for 10 min at 72 °C to complete the amplification.                 sia and Malaysia; F. hepatica from Australia, New Zea-
   The PCR products were purified using QIAquick Purifi-                 land, Hungary and Mexico; Fasciola sp. from Japan) are
cation kit (QIAGEN). PCR products were initially sub-                  shorter than those presented here and have not been
jected to direct sequencing using the PCR primers as                   included. Their inclusion would not have altered the con-
sequencing primers. However, when traces with ambigui-                 clusions reached. All ITS-2 sequences reported by Huang
ties were obtained (ITS-2), PCR products were cloned                   et al. (2004; AJ557567- AJ557571) include a pair of sites
using a TA cloning kit (Invitrogen, USA) and recombinant               near the 3 0 end that are inverted relative to all other avail-
plasmid DNAs subjected to sequencing using Big Dye Ter-                able sequences. However, Prof. Zhu Xing-Quan (personal
minator Cycle Sequencing technology on an automated                    communication), one of the authors of that paper, has con-
sequencer (ABI 3100 Avant Genetic Analyzer) using M13                  firmed that this inversion is a sequencing error: their
forward and reverse primers.                                           sequences have been corrected as used in this paper (note
                                                                       that Alasaad et al. (2007), have used the uncorrected
2.4. Data analysis and phylogenetic construction                       sequences). Sequences for some haplotypes from Turkmen-
                                                                       istan and adjacent regions of West and Central Asia
    The sequences were edited in SeqEd v 1.03, aligned                 reported by Semyenova et al. (2005) have been recon-
using AssemblyLIGN v 1.9c and analysed using the Mac-                  structed from information in that paper: none was avail-
Vector 8.2 package (Accelrys) in a Macintosh computer                  able from any database. Immediately prior to submission
system. Specific identification was confirmed by compari-                 of this paper, a further sequence of F. gigantica, from
son with known sequences of the corresponding species                  Meghalaya, India, appeared in the public databases. This
in GenBank or by reference to our previous published data              is EF027103, identical in sequence to the Indonesian refer-
Le et al., 2001; Le and Nguyen, 2002.                                  ence sequence of F. gigantica mentioned below. Sequences
    The multiple alignment of sequences was performed                  of F. hepatica from Bolivia (Mas-Coma et al., 2001) are
using GeneDoc v2.5 (Nicholas and Nicholas, 1997. Gene-                 identical to those from Spain.
Doc: A tool for editing and annotating multiple sequence                  For reference, F. gigantica from Indonesia (Fg_ID) and
alignment. Distributed by author) and/or ClustalW incor-               F. hepatica from Australia and Europe (Fh_AU) are
porated into the MacVector 8.2 package. Modeltest v3.7                 regarded as representing genetically pure forms of each
(Posada and Crandall, 1998) was used to find the best sub-              species that have not experienced introgression or hybrid-
stitution model. This model (HKY+G) was then specified                  isation (Agatsuma et al., 2000) (indicated by arrows on
for likelihood analyses in PAUP* v4.0b10 (Swofford, D.                  Fig. 1).
L. 2000. PAUP*. Phylogenetic Analysis Using Parsimony
(*and Other Methods). Version 4. Sinauer Associates, Sun-              3. Results
derland, Massachusetts). PaupUP graphical interface (Cal-
endini, F., Martin J.-F. 2005. PaupUP v1.0.3.1 A free                     Excluding flanking regions in the 5.8S and 28S genes,
graphical frontend for PAUP* Dos software. Available                   the length of the ITS-2 alignment was 362 bp. For the mito-
from       http://www.agro-montpellier.fr/sppe/Recherche/              chondrial markers, partial sequences were obtained from
JFM/PaupUp/main.htm) was used to facilitate working                    cox1 (423 bp) and nad1 (435 bp).
with PAUP*. The dataset was resampled 100 times using                     The main purpose of the phylogenetic analyses was to
the bootstrap method. Phylogenetic analyses are presented              compare species-of-origin of nuclear and mitochondrial
only for the nuclear ITS-2 sequences. Outgroups                        sequences in a number of individual worms from Vietnam
(sequences from Fascioloides magna DQ683545 and Fasci-                 and elsewhere. This is easily done by presenting a tree
olopsis buski DQ341852) were used in some analyses to                  based on one marker on which can be indicated, for each
confirm monophyly of each Fasciola species.                             individual, species-of-origin of the other marker(s). Here
    As far as possible, all available published ITS-2, cox1            we present only the tree of the ITS-2 sequences (Fig. 1).
and nad1 sequences have been included. Some sequences                  Given the small number of differences between the species
have been omitted – this is especially so for ITS-2 in which           in the ITS-2 region, and the slight variation within each
there are relatively few variable sites. Sequences with                species, it is not surprising that bootstrap values are rather
ambiguous sites or incomplete sequences can bias the tree              low. However, the two species are clearly distinguished
dramatically. Available ITS-2 sequences not used were:                 (and remain so in analyses using other fasciolids as out-
AB207153 (Hiroshima and Kagoshima, Japan), which                       groups). It is immediately apparent that the Vietnamese
includes several ambiguous sites reflecting the fact that               worms fall readily into the F. gigantica or the F. hepatica
ITS-2 sequences of both Fasciola species are present (Itag-            cluster based on ITS-2 data. However, all Vietnamese
aki et al., 2005a); AB259058 (Kyoto, Japan), which is                  worms had mitochondrial sequences (both cox1 and
incomplete; L07844, one of the earliest reported sequences             nad1) typical of F. gigantica only. Mitochondrial genomes
of F. hepatica, which has possible sequencing errors at the            in animals are maternally inherited. Our data thus demon-
3 0 end, and DQ383512 from Egyptian F. gigantica and                   strate that hybridisation or introgression has occurred
                                         T.H. Le et al. / International Journal for Parasitology 38 (2008) 725–730                         729

                                                                                had probably not experienced introgression/hybridisation,
                                                                                were placed where expected on the tree (Fig. 1). However,
                                                                                for many of these worms, ITS-2 only was available and
                                                                                nothing was known about their mitochondrial genome.
                                                                                The exceptional sequence was from a specimen of F. gigan-
                                                                                tica from Zambia (AB010975). This sequence had the sin-
                                                                                gle-base deletion characteristic of F. gigantica, but at
                                                                                most other variable sites it possessed the base typical of
                                                                                F. hepatica. We are uncertain how to interpret this.
                                                                                   Individual worms from human patients were distributed
                                                                                in both clades of the tree (Fig. 1).

                                                                                4. Discussion

                                                                                   It is clear that hybridisation and/or introgression has
                                                                                occurred in Vietnam involving both of the common species
                                                                                of Fasciola. In every case in that country, the mitochon-
                                                                                drial genome was typical of F. gigantica, whereas the
                                                                                nuclear genome could be from either species. Distinguish-
                                                                                ing between hybridisation and introgression requires more
                                                                                data than we have available. We regard hybrids as the F1
                                                                                offspring of a mating between the two species. In such a
                                                                                case, all offspring will carry the mitochondrial genome of
                                                                                the maternal parent. However, their nuclear ribosomal
Fig. 1. Tree inferred from ITS-2 sequences. Specimen codes are those used
                                                                                RNA cluster will contain copies from both parents.
in Table 1. GenBank accession numbers are included where available.
Sequences from human cases are shown in bold-italic type. Arrows point          Back-crossing of hybrids and of subsequent generations
to reference sequences from ‘‘pure’’ Fasciola gigantica or Fasciola hepatica.   with one parent species (=introgression) should homoge-
With the few exceptions discussed in the text, sequences fall into two          nise the ribosomal array so that sequences of the other spe-
groups corresponding to F. gigantica and F. hepatica. Sequences are             cies will eventually disappear. However, the non-
labeled according to the species name or code given to them in the relevant
                                                                                recombining nature of the mitochondrial genome means
original publications: Fg = F. gigantica, Fh = F. hepatica and Fsp for
those not assigned to a species. Specimens from Vietnam are indicated by        that it will be passed on largely unchanged from generation
the letters ‘‘VN’’ after the specimen code. Other country codes: AR,            to generation. If back-crossing of hybrids is with the pater-
Armenia; AT, Austria; AU, Australia; BF, Burkina Faso; BV, Bolivia;             nal species, then the mitochondrial genome of the maternal
CA, Turkmenistan and adjacent regions of Central Asia; CN, China; FR,           species will introgress into the paternal species (reviewed in
France; ID, Indonesia; IN, India; IR, Ireland; JP, Japan; Kr, Korea; RU,
                                                                                Blair, 2005). All this assumes that the organisms involved
Russia, and neighbouring countries; SP, Spain; TL, Thailand; UR,
Uruguay; ZA, Zambia. Specimens known to have F. gigantica-like                  reproduce sexually and undergo normal meiosis. For many
mitochondrial sequences (this study or from the literature) are indicated       eastern Asian populations of Fasciola species, this assump-
by *. Similarly, specimens with F. hepatica-like mitochondrial sequences        tion seems to be false. If hybrids are parthenogenetic, then
are indicated with # after the specimen code. Neither symbol appears if         worms should carry ribosomal repeats from both parents,
mitochondrial data are not available for that individual. The two
                                                                                as well as the mitochondrial genome of the maternal par-
sequences marked with Ù came from the same worm specimen in north
eastern China (Huang et al., 2004). The symbol à indicates worms from           ent, for as many generations as the clonal lineage persists.
Vietnam for which direct-sequencing traces indicated the presence of both       We do not yet know the ploidy of any of the Vietnamese
F. hepatica and F. gigantica ITS-2 sequences. Clean sequence for only one       worms, nor do we know if any are parthenogenetic. How-
type of ITS-2 was subsequently obtained from cloned PCR products,               ever, in at least some cases, individual worms carried ribo-
which is why the worms are included in only one clade. Bootstrap values
                                                                                somal sequences from both parent species, suggesting
(as percentage support for each branch) are shown.
                                                                                either that they were F1 hybrids, had undergone recent
involving the two Fasciola species and that F. gigantica was                    introgression, or that these worms were from parthenoge-
the maternal parent in each case.                                               netic lineages of unknown age.
   Direct sequencing of PCR products from some of the                              Not all human infections are due to hybrid/introgressed
Vietnamese worms yielded traces with ambiguities indicat-                       worms. Some were apparently due to ‘‘pure’’ F. gigantica
ing the presence of both F. hepatica and F. gigantica ITS-2                     infection. In addition, worms from human patients were
sequences (data not shown). Clean sequence for only one                         scattered in both clades in the tree (Fig. 1), suggesting that
type of ITS-2 was subsequently obtained from cloned                             multiple genotypes of Fasciola in Vietnam are capable of
PCR products, which is why each of these worms is                               infecting humans. We have no information on whether
included in only one clade in Fig. 1.                                           the mixing of genetic material of the two Fasciola species
   All ITS-2 sequences (except one) from populations of                         in Vietnam is a recent phenomenon. Nor do we know if
either species that, because of their geographical origins,                     ‘‘pure’’ F. hepatica is present in the country.
730                                    T.H. Le et al. / International Journal for Parasitology 38 (2008) 725–730

   In conclusion, we have demonstrated the presence in                        Fletcher, H.L., Hoey, E.M., Orr, N., Trudgett, A., Fairweather, I.,
Vietnam of hybrid and/or introgressed populations of liver                        Robinson, M.W., 2004. The occurrence and significance of triploidy in
                                                                                  the liver fluke, Fasciola hepatica. Parasitology 128, 69–72.
flukes bearing genetic material from both F. hepatica and                      Huang, W.Y., He, B., Wang, C.R., Zhu, X.Q., 2004. Characterisation of
F. gigantica. Some of these worms were from human                                 Fasciola species from mainland China by ITS-2 ribosomal DNA
patients. This appears to be the first demonstration from                          sequence. Vet. Parasitol. 120, 75–83.
a tropical country of the presence of liver flukes containing                  Itagaki, T., Kikawa, M., Sakaguchi, K., Shimo, J., Terasaki, K.,
genetic material from both common species of Fasciola.                            Shibahara, T., Fukuda, K., 2005a. Genetic characterization of
                                                                                  parthenogenetic Fasciola sp. in Japan on the basis of the sequences
                                                                                  of ribosomal and mitochondrial DNA. Parasitology 131, 679–685.
Acknowledgments                                                               Itagaki, T., Kikawa, M., Terasaki, K., Shibahara, T., Fukuda, K., 2005b.
                                                                                  Molecular characterization of parthenogenic Fasciola sp. in Korea on
   This investigation received financial support from IC-                          the basis of DNA sequences of ribosomal ITS1 and mitochondrial
GEB (Project No. CRP/VIE05-02 awarded to Thanh                                    NDI gene. J. Vet. Med. Sci. 67, 1115–1118.
                                                                              Le, T.H., Blair, D., McManus, D.P., 2001. Complete DNA sequence and
Hoa Le) and the Wellcome Trust (Grant No. 068762                                  gene organization of the mitochondrial genome of the liverfluke,
awarded to Le, McManus and Blair). We thank our collab-                           Fasciola hepatica L. (Platyhelminthes; Trematoda). Parasitology 123,
orators for their kind provision of materials used in this                        609–621.
study and staff in Dr Le’s Laboratory (Institute of Biotech-                   Le, T.H., De, N.V., Agatsuma, T., Blair, D., Vercruysse, J., Dorny, P.,
nology, Hanoi, Vietnam) for their laboratory work.                                Nguyen, T.G.T., McManus, D.P., 2007. Molecular confirmation that
                                                                                  Fasciola gigantica can undertake aberrant migrations in human hosts.
                                                                                  J. Clin. Microbiol. 45, 648–650.
References                                                                    Le, T.H., Nguyen, V.D., 2002. Molecular-based identification of Fasciola
                                                                                  gigantica in Vietnam using mitochondrial-encoded nad1 sequence as
Adlard, R.D., Barker, S.C., Blair, D., Cribb, T.H., 1993. Comparison of           genetic markers. J. Malaria Parasit. Dis. Control 3, 41–48.
   the second internal transcribed spacer (Ribosomal DNA) from                Lin, R.Q., Dong, S.J., Nie, K., Wang, C.R., Song, H.Q., Li, A.X., Huang,
   populations and species of Fasciolidae (Digenea). Int. J. Parasitol.           W.Y., Zhu, X.Q., 2007. Sequence analysis of the first internal
   23, 423–425.                                                                   transcribed spacer of rDNA supports the existence of the intermediate
Agatsuma, T., Arakawa, Y., Iwagami, M., Honzako, Y., Cahyaningsih,                Fasciola between F. hepatica and F. gigantica in mainland China.
   U., Kang, S.Y., Hong, S.J., 2000. Molecular evidence of natural                Parasitol. Res. 101, 813–818.
   hybridization between Fasciola hepatica and F. gigantica. Parasitol.       Marcilla, A., Bargues, M.D., Mas-Coma, S., 2002. A PCR-RFLP assay
   Int. 49, 231–238.                                                              for the distinction between Fasciola hepatica and Fasciola gigantica.
Alasaad, S., Huang, C.Q., Li, Q.Y., Granados, J.E., Garcı ´a-Romero, C.,          Mol. Cell. Probes 16, 327–333.
     ´
   Perez, J.M., Zhu, X.Q., 2007. Characterization of Fasciola samples         Mas-Coma, S., Bargues, M.D., Valero, M.A., 2005. Fascioliasis and other
   from different host species and geographical localities in Spain by             plant-borne trematode zoonoses. Int. J. Parasitol. 35, 1255–1278.
   sequences of internal transcribed spacers of rDNA. Parasitol. Res. 101,    Mas-Coma, S., Funatsu, I.R., Bargues, M.D., 2001. Fasciola hepatica and
   1245–1250.                                                                     lymnaeid snails occurring at very high altitude in South America.
Ashrafi, K., Valero, M.A., Panova, M., Periago, M.V., Massoud, J., Mas-            Parasitology 123, 115–127.
   Coma, S., 2006. Phenotypic analysis of adults of Fasciola hepatica,        Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model of
   Fasciola gigantica and intermediate forms from the endemic region of           DNA substitution. Bioinformatics 14, 817–818.
   Gilan, Iran. Parasitol. Int. 55, 249–260.                                  Semyenova, S.K., Morozova, E.V., Vasilyev, V.A., Gorokhov, V.V.,
Blair, D., 2005. Ribosomal DNA variation in parasitic flatworms. In:               Moskvin, A.S., Movsessyan, S.O., Ryskov, A.P., 2005. Polymorphism
   Maule, A.G., Marks, N.J. (Eds.), Parasitic Flatworms: Molecular                of internal transcribed spacer 2 (ITS-2) sequences and genetic
   Biology, Biochemistry, Immunology and Control. CABI, Wallingford,              relationships between Fasciola hepatica and F. gigantica. Acta Paras-
   Oxfordshire, pp. 96–123.                                                       itol. 50, 240–243.
Bowles, J., Blair, D., McManus, D.P., 1995. A molecular phylogeny of the      Terasaki, K., Akahane, H., Habe, S., Moriyama, N., 1982. The
   human schistosomes. Mol. Phylogenet. Evol. 4, 103–109.                         geographical distribution of common liver flukes (the genus Fasciola)
Bowles, J., McManus, D.P., 1993. Rapid discrimination of Echinococcus             with normal and abnormal spermatogenesis. Jpn. J. Vet. Sci. 44, 223–
   species and strains using a PCR-based RFLP method. Mol. Biochem.               231.
   Parasitol. 57, 231–239.                                                    Terasaki, K., Noda, Y., Shibahara, T., Itagaki, T., 2000. Morphological
Bui, K.L., Do, T.T., Le, N.M., Osamu, S., Shinobu, Y., 2003. Application          comparisons and hypotheses on the origin of polyploids in partheno-
   of agar gel diffusion test to the diagnosis of fasciolosis in cattle and        genetic Fasciola sp. J. Parasitol. 86, 724–729.
   buffaloes in the Red River delta in Vietnam. Jpn. Ag. Res. Quart. 37,       Tran, V.H., Tran, T.K., Nguyen, H.C., Pham, H.D., Pham, T.H., 2001.
   201–205.                                                                       Fascioliasis in Vietnam. SE. Asian J. Trop. Med. Pub. Health 32
Dowling, T.E., Secor, C.L., 1997. The role of hybridization and                   (Suppl 2), 48–50.
   introgression in the diversification of animals. Ann. Rev. Ecol. Syst.      Xuan, L.T., Hung, N.T., Waikagul, J., 2005. Cutaneous fascioliasis: a case
   28, 593–620.                                                                   report in Vietnam. Am. J. Trop. Med. Hyg. 72, 508–509.

								
To top