Presentations

Document Sample
Presentations Powered By Docstoc
					   A study into the urgent
endoscopy referral system for
   patients with suspected
   gastrointestinal cancer
        Christopher Jump
    3rd Year Medical Student
       Background information
• With the aim of improving the detection of cancers at
  an early stage and therefore survival rates the 2-
  week referral system was introduced in 2000 by the
  Department of Health and was revised in 2005 by
  NICE
• This included a referral form which specified
  symptoms that needed to be present in order for the
  patient to be urgently referred to a specialist
  consultation or directly to endoscopy
Reasons the study was needed
• Many patient’s specimens referred as urgent to the
  histopathologist are not diagnosed with malignancy.
  This displaces ‘correctly’ referred urgent patients
  down the waiting list, potentially causing them a
  worse prognosis due to the delay of diagnosis and
  subsequent treatment
 Reasons the study was needed
• Each colonoscopy costs about £900

• Each oesophagogastroduodenoscopy (OGD) costs about £500-
  600

• Histopathology costs are about:

   o £67 per single biopsy site

   o £100 for 2 biopsy sites

   o £133 for 3 biopsy sites

• The PCT pays for each one they refer for, so if they are not
  necessary it is a waste of their limited budget
Reasons the study was needed
• There are significant complications associated with
  all types of endoscopy, which patients are being
  needlessly exposed to if they are incorrectly referred

• E.g. Perforation, haemorrhage, infection, pain and
  discomfort, sedation associated (cardio-pulmonary
  events), etc.
        Current evidence base
• Limited number of studies investigating urgent
  referral for endoscopy in GI cancer patients, most of
  which look into therapeutic endoscopy
• Many studies looking into the effectiveness of the
  guidelines for urgent referral to a specialist in
  secondary care. Have shown mixed results
  regarding if the guidelines are specific enough to
  detect early cancer presentation and their effect on
  the outcome of patients
       Main aims of the study
• To investigate:
  o The number of patients that are correctly and
    incorrectly referred for urgent endoscopies

  o The differences in outcome between the patients
    who were correctly and incorrectly referred
                          Method
• 50 patients included in the study, 25 who underwent an upper GI
  endoscopy and 25 who had a lower GI endoscopy between the
  25th February and 17th March 2009 at Southport and Formby
  District General Hospital.
• Patients were identified by urgent histopathology referral forms.
• Medical records were then accessed and data collected.
• Urgent referrals were deemed to be correct or incorrect using
  ‘NICE referral for suspected cancer guidelines’.
• Outcomes were recorded by assessing their progress since their
  endoscopy.
                    Results
• Mean age of 72.1 years

• 25 males and 25 females in total sample

• When divided:

  o 14 females and 11 males in upper GI group

  o 11 females and 14 males in lower GI group
    Results- Source of referrals
• 43 (86%) of the 50 patients were referred from a GP

• 4 from hospital wards

• 1 from A&E, 1 referred by MDT, 1 surveillance
                                 50
                                 45
                                 40
            Number of patients




                                 35
                                 30
                                 25
                                 20
                                 15
                                 10
                                  5
                                  0
                                      GP   Hospital Ward     A&E            MDT   Surveillance
                                                       Source of referral
                           Results- Number of correct and
                                 incorrect referrals
                • 18 (36%) of 50 patients were referred in accordance with NICE
                          guidelines
                • When divided:
                          o Upper GI= 4 correct and 21 incorrect referrals
                          o Lower GI= 14 correct and 11 incorrect referrals
                                                                                                Figure 3. Number of patients correctly and
                           Figure 2. Number of patients correctly and                           incorrectly referred for an urgent lower GI
                            incorrectly referred for an urgent OGD                                               endoscopy
                                                                                               25
                     25

                                                                          Number of patients   20
                     20
Number of patients




                                                                                               15
                     15

                     10                                                                        10

                      5                                                                         5

                      0                                                                         0
                                   Correct                    Incorrect                                     Correct                     Incorrect
                                              Referral type                                                             Referral type
         Results- what the upper GI
         referrals should have been
• Of the 21 incorrect referrals:
    o 12 should have been given an urgent outpatient referral
    o 5 should have been considered for an urgent outpatient referral
    o 4 should have been routinely referred for an outpatient appointment
                                             Figure 4. Amended referrals for patients incorrectly referred for
                                                                     urgent OGD
                                   14
                                   12
              Number of patients




                                   10
                                    8
                                    6
                                    4
                                    2
                                    0
                                        Urgent outpatient referral      Consider urgent outpatient   Routine outpatient referral
                                                                                 referral
                                                                     Type of amended referral
     Results- Outcomes of correct
               referrals
• Upper GI:
   o 1 patient with a benign polyp, now on surveillance
   o 1 patient with an oesophageal ulcer and gastritis (PPI and
     discharged)
   o 1 patient with duodenitis, duodenal ulcer, gastritis and 2 gastric
     ulcers (PPI and discharged)
   o 1 patient with gastritis and duodenitis (PPI and discharged)
• Lower GI:
   o 5 cancers; 3 died, 1 is treated palliatively and 1 had surgical
     excision and is now under surveillance
   o 2 patients with Diverticular Disease discharged
   o 2 patients with benign polyps discharged
   o 5 patients normal, discharged
                           Results-Outcome of correct
                                    referrals
                                               Figure 8. Outcomes of correct urgent referrals in total sample
                     6



                     5



                     4
Number of patients




                     3



                     2



                     1



                     0
                         Normal   Diverticular Disease   Lower GI polyp   Lower GI malignancy   Upper GI polyp   Oesophageal ulcer and Duodenitis, duodenal     Gastritis and
                                                                                                                       gastritis       ulcer, gastritis and 2    duodenitis
                                                                                                                                          gastric ulcers.

                                                                                       Diagnosis
      Results-Outcome of incorrect
               referrals
• Upper GI
   o 3 patients died (2 cancers, 1 unknown)
   o 13 patients treated for an inflammatory condition (oesophagitis,
     gastritis or duodenitis) with a PPI and discharged.
   o 2 patients normal
   o 2 treated for malignancy (partial gastrectomy, oesophageal stent)
   o 1 patient continued on surveillance for Barrett’s oesophagus
                                        Figure 9. Outcomes of incorrect urgent OGD referrals
                                   14

                                   12
              Number of patients




                                   10

                                    8

                                    6

                                    4

                                    2

                                    0
                                         Died       Malignancy   PPI, discharged   Surveillance    Normal,
                                                     treated                          OGD         discharged
                                                                   Outcome
      Results-Outcome of incorrect
               referrals
• Lower GI:
   o 3 malignancies detected; 2 had successful surgical excisions,
     1 treated palliatively
   o 3 patients had adenomatous polyps excised, now under
     surveillance
   o 2 normal patients
   o 1 with haemorrhoids, discharged
   o 2 treated for ulcerative colitis (both medication, 1 also had a
     colectomy)Figure 10. Outcomes of incorrect urgent lower GI endoscopy referrrals

                                    4
               Number of patients




                                    3

                                    2

                                    1


                                    0
                                        Ulcerative colitis   Normal, discharged   Polyp excised,   Haemorrhoids,   Malignancy treated    Malignancy,
                                             treated                               surveillance     discharged                          palliative care

                                                                                             Outcome
              What has it shown
• Minority (36%) of urgent referrals comply with guidelines

• Majority (81%) of incorrect referrals are from GPs

• There are considerably more upper GI than lower GI incorrect
  urgent referrals for endoscopy (21/25- 11/25)

• Minority of patients who are urgently referred for endoscopy
  are diagnosed with cancer (24%)

• The incorrect referrals detected more cancers than the correct
  referrals (7-5)
               What has it shown
• Correct upper GI referrals detected no cancers, incorrect
  detected 4

• Correct lower GI referrals detected 5 cancers, incorrect
  detected 3

• Incorrect lower GI referrals had a higher curative treatment
  rate for cancer than correct lower GI referrals (66.7%-20%)

• 3 patients out of 50 had life saving surgical resection of their
  cancer over the 3 weeks this study observed

• Equates to 52 patients a year saved at an annual cost of
  about £718,363 for endoscopy and histopathology only
                       Conclusions
• The existing guidelines are not effective as originally hoped in

   detecting patients with gastrointestinal cancer

• This study suggests that for a cancer to meet the current urgent

   referral guidelines it has to be at a late enough stage to exhibit

   enough symptoms to fulfil the criteria, with the majority of the time

   this being too late to cure the patient

• Guidelines need to be reviewed and amended with the aim of

   detecting more cancers at an early stage

• Guidelines need to be made compulsory for all GPs as this is where

   the main problem lies
                   Limitations
• Symptoms in urgent referral form not specified,
  which meant many patients may have been eligible
  for urgent referral but were deemed not, as form not
  filled in extensively enough. E.g. ‘rectal bleeding’ but
  duration not specified
• Handwriting on some referral forms illegible so
  patient may have met criteria
                 Limitations
• Some patients had missing histology reports in their
  medical files so information had to be taken from
  consultants letter to GP, which contains less specific
  information

• Sample size in this study is not large enough to
  draw significant conclusions, so a possible future
  study could expand on these findings with more
  patients from a wider region
Thank you for listening
    Audit of Lung Biopsies
Received at Whiston Hospital
Histopathology Department in
             2009


                     Dr S Kelly
                   Dr L Forsyth
                Dr S A Melmore
                      Aim
• To review all lung biopsies received at Whiston
   in 2009.
• To assess adequacy.
• Try to further differentiate the non-small cell
  carcinomas (NSCC) into adenocarcinoma
  (adenoca) and squamous cell carcinoma (SCC)
   – on morphology, and
   – with the aid of immunohistochemistry.
               Background
• Biopsy interpretation limited by
   – Sampling error,
   – Sample size,
   – Tumour heterogeneity.
• BTS guidelines (2001)recommend 90%
  adequacy with 5+ biopsies in cases of
  suspected malignancy.
• Small cell carcinoma (SMCC) → chemotherapy.
• NSCC → surgery.

• New medical treatments for adenoca
  – without squamous differentiation (folate
    antimetabolite chemotherapy drugs under
    assessment by NICE), and
  – with EGFR-TK mutations (EGFR-TK
    inhibitors).
• Immunohistochemistry (IHC) may aid further
  differentiation.
• Limitations include;
   – inadequate sample size,
   – crush artefact,
   – positive staining of normal lung constituents,
   – overlapping immunophenotypes, and
   – previous studies conducted on resection
     specimens and cytology but not biopsies.
         Immunohistochemistry
• Squamous cell carcinoma; CK5, p63 and
  34βE12.
• Adenocarcinoma; CK7, CK20 and TTF1.
• P63
  – Nuclear, SCC 78-100%, adenoca 1-33%, SMCC
    77%.
• CK 5/6
  – SCC 100%.
• TTF1
  – Nuclear, adenoca 68-85%, SMCC 84%, 5-21%
    SCC.
  – Poorly differentiated more likely to be negative.
      SCC


H&E

            TTF -ve




             P63 +ve
  Adenoca



      TTF +ve


H&E




      P63 -ve
                  Method
• Telepath search for all lung biopsies in 2009.
• All cases reviewed by 2 consultants and 1 SpR.
• Number of biopsy fragments counted.
• Morphological diagnosis given.
• All carcinoma NOS, 6 adenoca and 6 SCC →
   – TTF-1 and p63.
• TTF1 and p63 - ve →
   – CK5/6
   – Case notes and reports from RLBUHT
     reviewed.
                     Results
• Pieces        1      2    3    4         5         6

• Negative (9) 2       4    2    0         1         0
• Suspicious (1) 0     0    1    0         0         0
• Malignant (49) 4     12   17   7         5         4

• Total (64)    6      16   20 7           6         4
• % of total    9.4    25   31.3 11        9.4       6.3
                                 Number of adequate = 15.7 %
• Total                        64

•   Inadequate                 5
•   Negative                   9
•   Low grade dysplasia,       1
•   Adenocarcinoma             9
•   Squamous cell carcinoma,   17
•   Carcinoma (NOS)            11
•   Small cell carcinoma       8
•   Metastatic or other        4
          Not          TTF1+   TTF1+ TTF1 – TTF1-     TTF1 +
          satisfactory p63+    p63-  p63 +  p63 -     p63 +/-


Adenoc    0           1        5       0      0       0
                      (17%)    (83%)


sqcc      2           0        0       4      0       0
                                       (100%)


Carcinoma 2           0        4       0      4       1 (11%)
NOS                            (44%)          (44%)
• 83% of adenocarcinoma TTF1 + (75-85% in
  studies).
• 1 adenocarcinoma TTF1 + p63 + (1-33%
  literature).
• 100% of satisfactory biopsies of sqcc p63 +.
• 4 cases of carcinoma NOS TTF1 +, p63 -
  probably adenocarcinoma.
• 1 case p63 +/- , showed a positive internal
  control. (Patient with cerebral metastases so no
  resection performed).
 H&E         TTF +ve




CK 5/6 -ve   P63 +/-ve
• 4 cases TTF1 - ve, p63 – ve,
   – all internal controls for p63 + ve, and
   – all CK5/6 – ve.
   – 1 was small cell marker - ve on biopsy,
     • resection showed a squamous cell carcinoma.
  – 3 showed possible squamous morphology,
     • no resection due to the patient’s co-morbidities,
       metastases or locally advanced disease.
                Conclusion
• We diagnosed 5/64 cases as inadequate on
  H&E.
• Only 10/64 (15.7%) of the remaining cases
  contained 5+ fragments of tissue.( vs. 90%).
• We made a morphological diagnosis of
  malignancy on 49/64 cases, (9/49 had 5+
  biopsies), and
• Differentiated type on H&E in 38/49 cases (6/38
  had 5+ biopsies).
• 4/23 cases sent for IHC were inadequate.
  – diagnosed on H&E as 2 x SCC, 2 x carcinoma NOS
• Our cases are comparable with the literature for
  these robust IHC stains.
• For morphologically classic adenocarcinoma
  TTF1 and p63 can be used in combination to
  confirm the absence/presence of squamous
  differentiation.
• For poorly differentiated NSCC cells the use of
  TTF1 and p63 may aid further differentiation.
• Immunohistochemistry should be interpreted
  together with morphology and clinical history.
• Sub classification should be avoided if uncertain.
• Limitations include;
  – small sample size,
  – difficult morphology,
  – variable immunohistochemical staining and
    interpretation,
  – tumour heterogeneity,
  – previous studies done on resection
    specimens.
                   The future
• As the prospect of mutational analysis on
  more/all of these tumours draws closer, and
• The use of IHC is used increasingly to choose
  the tumours that will benefit from treatment,
• Clinicians will need to be aware of
  – The need for an adequate sample, and
  – The impact on turnaround times will mean
     • waiting for a delayed report, or
     • receiving preliminary and supplementory reports.
             Recommendations
• Use TTF1 and p63;
    – to confirm squamous differentiation in
      morphologically diagnosed adenocarcinoma,
    – in poorly differentiated NSCC but be aware of the
      limitations.
•   Cut spare sections on all levels for IHC.
•   Check results of subsequent resections.
•   Comment on BTS adequacy in reports.
•   Disseminate this information to all
    histopathologists and relevant clinicians.
        Take Home Message
• For clinicians
   – An adequate sample is required for accurate
     diagnosis, and
   – extensive IHC and mutational testing is time
     consuming.
• For pathologists
   – Immunohistochemistry should ALWAYS be
     interpreted together with morphology and
     clinical history.
Thank you
  Any questions?
 Cancer Data for Outcomes

Desperately Seeking               NHS North West
                                  Supplier Data
Your Support                      Report 2010/11




                                            Data Supply
‘We can only be sure to improve
                                            Data Quality
what we can actually measure’
– Lord Darzi
               Poor Survival
              Key Questions?
• Stage at Presentation
  – Does my population have a problem with late stage
    presentation? (not amenable to healthcare)
  – Do I know where and with whom there are delays in
    presentation/delays in diagnosis?
  – Am I able to make informed investment/disinvestment
    decisions?
• Access to Diagnosis and Treatment
  – Does the population and sub-populations of my PCT
    access the right services at the right time?
        March 2011 – Electronic Path
                                   Pipe delimited txt files
             PROVIDER                    Pathology                    Comment

AINTREE UNIVERSITY HOSPITALS NHS
     FOUNDATION TRUST                     GREEN
ALDER HEY CHILDREN'S NHS FOUNDATION                  04/10/2010 First electronic send. Received
    TRUST
                                                         a file from Jan 2009 to June 2010.
                                          GREEN          Receiving monthly sends thereafter
COUNTESS OF CHESTER HOSPITAL NHS
    FOUNDATION TRUST                      GREEN
ROYAL LIVERPOOL AND BROADGREEN                       Receipt re-established
    UNIVERSITY HOSPITALS NHS TRUST        GREEN
SOUTHPORT AND ORMSKIRK HOSPITAL NHS                  Still sending paper
    TRUST                                  RED
ST HELENS AND KNOWSLEY HOSPITALS NHS
     TRUST                                GREEN
WALTON CENTRE FOR NEUROLOGY AND                      Still sending paper
    NEUROSURGERY NHS TRUST                 RED
WARRINGTON AND HALTON HOSPITALS NHS
   FOUNDATION TRUST
                                          GREEN
WIRRAL UNIVERSITY TEACHING HOSPITAL                  NO DATA RECEIVED SINCE MARCH 2010
    NHS FOUNDATION TRUST
                                           RED
Pathology Mark Up

     Breast


    Size


       Laterality




      Grade




           No of Nodes
                Timeliness
• Timeliness of Data Supply
• Timeliness of Data Quality Feedback
  – Don’t want to study history
• Timeliness of commentary on services as
  they are currently configured and delivered
               Summary
• Outcomes Framework a key driver for
  regular, high quality, timely cancer data
• Informed service planning depends upon
  high quality data – across patient pathway
• Need to achieve full electronic data
  supply by March 2011
• Leverage vital for a step change in data
  capture and reporting
Emerging technologies and
targeting treatments: EGFR

               JR Gosney
    Consultant Thoracic Pathologist
   Royal Liverpool University Hospital
 Epidermal growth factor
     receptor (EGFR)
• EGFR (HER-1;
  ErbB1)
• HER-2 (neu;
  ErbB2)
• HER-3 (ErbB3)
• HER-4 (ErbB4)
EGFR gene mutations
   and gefitinib
Sensitising mutations of
      EGFR gene
            • Classically in
              peripheral, well
              differentiated, acinar,
              non-mucinous
              adenocarcinomas with
              a bronchioloalveolar
              component
            • About 60% of non-
              smoking, Eastern Asian
              women with
              adenocarcinoma
            • About 10% of Western
              subjects with NSCLC
EGFR protein expression

            • Immunochemical
              detection of EGFR
              protein is not
              currently a reliable
              indicator of
              sensitising
              mutations nor of
              sensitivity to TKIs
EGFR gene amplification
            • High EGFR gene
              copy number is an
              imprecise reflection
              of mutational status
              and sensitivity to
              TKIs and its
              detection by in situ
              hybridization is time
              consuming and
              technically
              demanding
   Detecting mutations
• Mutations are detectable by
  screening or targeted detection
  – Trials of gefitinib employed an
    amplification-refractory mutation
    system (ARMS)-based kit that targets
    29 mutations in the EGFR gene
  – This technique is sensitive and
    robust and does not require a high
    level of technical expertise
EGFR mutational analysis
 In the Merseyside & North
      Cheshire Network
• About 750 new cases of NSCLC diagnosed by histo-
  or cytopathology per annum
• Paraffin wax block with accompanying report and
  H&E-stained section sent by referring pathologist to
  Department of Pathology at RLUH
• Histological assessment with possible
  microdissection followed by DNA extraction and
  mutational analysis
• Return of report of analysis to managing oncologist
  and to referring histopathology laboratory for
  integration with histopathology report
• Correlation of histopathology with mutational status
  for quality control, audit and development of service
         December 2009-
         November 2010
• Phillipe Tanière, University of
  Birmingham
• Funded by AstraZeneca
• Non-small cell lung cancer
• Any stage
• 200 cases sent for analysis
         December 2009-
         November 2010
• 96 male
• 190 adenocarcinoma, 9 squamous, 1 LCNEC
• 170 tissue biopsies, 15 cytology (10 FNAs (8
  EBUS), 4 pleural fluid, 1 washing), 15 from
  resections
• 11 sensitizing mutations (5%)
• 2 mutations conferring resistance (1%)
• Mean turnaround time 15 days (8-34)
       Eleven sensitizing
           mutations
• Six male, five female
• Two of Chinese, one of Pakistani origin
• Eight new diagnoses: three needle cores, two
  bronchial biopsies, one lymph node, one bronchial
  washings, one from wedge resection
• Three recurrent disease: one original needle biopsy,
  one vertebral metastasis, one from previous
  resection
• Six point mutations (one 719 exon 18; one 861 exon
  21, four 858 exon 21), five deletions (all exon 19)
• Nine adenocarcinoma, two non-small cell carcinoma
  not otherwise specified
    From December 2010
• Mutational analysis at Royal Liverpool
  University Hospital
• Budget for analysis (and gefitinib) held
  at Clatterbridge Centre for Oncology
• Locally advanced or metastatic disease
  (according to license and NICE
  guidance)
• Non-squamous tumours only
            Pooja Jain
 Consultant Clinical Oncologist
Clatterbridge Centre for Oncology
• EGFR in NSCLC
• Targeting EGFR
  – Tyrosine Kinase Inhibitors



• John Gosney
                • Key drivers in the
                  process of
                    – Cell growth
                    – Proliferation

                • EGFR activating
                  mutation
                    – promotion of tumour cell
                      growth
                    – blocking of apoptosis
                    – increasing the production
                      of angiogenic factors
                    – facilitating the processes
                      of metastasis
Tyrosine kinase inhibition
• Initially developed as second line therapy
  – BR 21
  – Increase in the objective response rate (9%
    <1 %)
  – Increase in overall survival (6.7 versus 4.7
    months)
  – Improvement in symptoms & physical
    function


• Early indication of selection
• First line therapy
  – Platinum doublet
    • RR 30%
    • 65% of patients would be suitable


• Second line chemotherapy
  – 30% of patients would be suitable
    • Single agent docetaxel/gemcitabine/vinorelbine
    • RR < 10%
• Phase II studies: objective response
  rates of 55 to 90%

• IPASS study

• Phase III studies were in Far East
  – IPASS
  – WJTOG3405
                                                                            Endpoints
   Patients                                                                 Primary
   •Chemonaïve                                                              • Progression-free survival (non-
                                               IRESSA                       inferiority)
   •Age ≥18 years

   •Adenocarcinoma
                                          (250 mg daily)
                                                                            Secondary
    histology                                                               • Objective response rate
   •Never orlight                                                           • Overall survival
    ex-smokers*                           1:1 randomisation                 • Quality of life
                                                                            • Disease-related symptoms
   •Lifeexpectancy                         Carboplatin
    ≥12 weeks                                                               • Safety and tolerability
                                          (AUC 5 or 6) /
   •PS   0-2                                paclitaxel
   •Measurable stage IIIB   /             (200 mg / m2)                     Exploratory
    IV disease                                                              • Biomarkers
                                            3 weekly#                            • EGFR mutation
                                                                                 • EGFR-gene-copy number
                                                                                 • EGFR protein expression


* Never smokers, <100 cigarettes in lifetime; light ex-smokers, stopped 15 years ago and smoked 10 pack
years; # limited to a maximum of 6 cycles
Carboplatin / paclitaxel was offered to IRESSA patients at progression
PS, performance status; EGFR, epidermal growth factor receptor                         Mok et al 2009, Fukuoka 2009
                                                                        1.0
                                                                                                                                            Carboplatin /
                                                                                                                               IRESSA
                                                                                                                                            paclitaxel
                                                                                                 N                            609           608
                                                                        0.8                      Events                       453 (74.4%)   497 (81.7%)
IPASS: Progression Free Survival (ITT)



                                                   Probability of PFS



                                                                                                      HR (95% CI) = 0.741 (0.651, 0.845) p<0.0001
                                                                        0.6
                                                                                                 Median PFS (months)               5.7           5.8
                                                                                                 4 months progression-free         61%           74%
                                                                                                 6 months progression-free         48%           48%
                                                                                                 12 months progression-free        25%           7%
                                                                        0.4


                                                                        0.2


                                                                        0.0
                                               At risk :                      0     4     8     12            16              20            24 Months
                                              IRESSA                          609   363   212   76            24              5              0
                                          Carboplatin /                       608   412   118   22             3              1              0
                                             paclitaxel

                                              •        IPASS exceeded it’s primary endpoint and demonstrated
                                                       superiority for IRESSA in PFS compared to doublet
                                                       chemotherapy
                                                 • PFS effect was not 361:947-995
                                         Mok T, Wu TL, Thongprasert S et al. N Engl J Med 2009; consistent over time
                                     Overall Response Rate, ITT population
                                                                         50
                                           Overall R es pons e R ate %   45         43
                                               (IT T P opulation)        40
                                                                         35                                               32
                                                                         30
IPASS: Overall Response Rate (ITT)




                                                                         25
                                                                         20
                                                                         15
                                                                         10
                                                                          5
                                                                          0
                                                                                 IR E S S A            C arboplatin/P ac litaxel
                                                                              Odds ratio = 1.59 (95% CI 1.25, 2.01) p=0.0001


                                      IRESSA produced a greater ORR than doublet chemotherapy in a clinically
                                      selected group of patients

                                                                                                   Mok T, Wu TL, Thongprasert S et al. N Engl J Med 2009; 361:947-995
                                                PFS in the EGFR M+ population
                                                                                                                 IRESSA EGFR M+ (n=132)
                                                                      1.0                                        IRESSA EGFR M- (n=91)
IPASS: Progression Free Survival (EGFR M+)




                                                                                                                 Carboplatin / paclitaxel EGFR M+ (n=129)
                                                                                                                 Carboplatin / paclitaxel EGFR M- (n=85)
                                                                      0.8
                                                                                                                                EGFR M+
                                                                                                                                HR=0.48, 95% CI 0.36, 0.64, p<0.0001
                                                 Probability of PFS




                                                                      0.6                                                       EGFR M-
                                                                                                                                HR=2.85, 95% CI 2.05, 3.98, p<0.0001


                                                                      0.4


                                                                      0.2
                                                                                                                                                             Treatment by subgroup
                                                                                                                                                             interaction test,
                                                                                                                                                             p<0.0001
                                                                      0.0
                                                                            0       4          8          12                   16           20              24
                                                                                 Time from randomisation (months)

                                                                      •     IRESSA halved the relative risk of progression compared with
                                                                            carboplatin/ paclitaxel in EGFR M+ patients1
                                                                      •     Median PFS was over 3 months longer with IRESSA in EGFR M+
                                                                            patients than carboplatin/paclitaxel (9.5 vs 6.3 months)2
                                             Mok T, Wu TL, Thongprasert S et al. N Engl J Med 2009; 361:947-995. Iressa SmPC
                                         Superior ORR in the EGFR M+ population


                                                                          80
IPASS: Overall Response Rate (EGFR M+)




                                                                                 71
                                                                                                   IRESSA
                                           O verall R es pons e R ate %


                                                                          70                       Carboplatin / paclitaxel
                                                                          60                       EGFR M+ odds ratio (95% CI) = 2.75
                                                                                                   (1.65, 4.60), p=0.0001
                                                                          50               47
                                                                                                   EGFR M- odds ratio (95% CI) = 0.04
                                                                                                   (0.01, 0.27), p=0.0013
                                                                          40

                                                                          30                                                23.5
                                                                          20
                                                                               (n=132)   (n=129)             (n=91)
                                                                          10                                                (n=85)
                                                                                                               1.1
                                                                           0


                                                                                  E G F R M+                      E G F R M-
                                                                                                   Mok T, Wu TL, Thongprasert S et al. N Engl J Med 2009; 361:947-995
                                                                                                   Iressa SmPC
The NEJ002 and WJTOG3405
         studies
Progression-    100
free survival
(%)
                 80                       HR=0.30,
                                          95% CI 0.22 - 0.41, p<0.001
                                          Median PFS : 10.8 vs 5.4 months
                 60


                 40
                                                               IRESSA
                                    Carboplatin/               (n=114)
                 20                     paclitaxel
                                         (n=110)
                  0
                      0   3   6     9        12      15   18     21         24      27
                                  Months since randomization



                                                                             Maemondo et al 2010
Proportion          100
                                                                                 IRESSA               Cisplatin and
without
                                                                                                        docetaxel
progression
(%)                   80                                    n                      86                       86

                                                            Median PFS    9.2 months (8.0-13.0)   6.3 months (5.8-7.8)
                                                            (95% CI)
                      60
                                                            HR=0.49, 95% CI 0.34-0.71; p<0.0001

                      40


                      20
                                   p<0.0001
                          0
                              0               10                20                   30                      40
                                                   Months since randomization
        Number at risk
               IRESSA         86        63    22       11        4         3            2         2           0
Cisplatin and docetaxel       86        49    11        7        3         0            0         0           0

PFS: progression-free survival                                                                        Mitsudomi et al 2010
                                                                 STUDY                       Line of   EGFR M+   ORR (%)    Median     Median
IRESSA: Efficacy Independent of Ethnicity




                                                                                            Treatmen     (n)                 PFS        OS
                                                                                                t                          (months)   (months)
                                                          Sequist et al 2008                  1st        31       55%       9.2m       17.5m
                                                       Journal of Clinical Oncology 2008;
                                                               26(15): 2442-2449

                                                          Cortes-Funes et al                   Pre-      10       60%       12.3m       13m
                                            NON-ASIA




                                                                2005                         treated
                                                         Annals of Oncology 2005; 16:
                                                                  1081-1086

                                                        Cappuzzo et al 2007                  Mixed       24       62%         -          -
                                                       Journal of Clinical Oncology 2007;
                                                                25(16): 2248-55

                                                            Yang et al 2008                   1st        55       69%        8m          -
                                                       Journal of Clinical Oncology 2008;
                                                                26(16): 2745-53
                                            ASIA




                                                          Tamura et al 2008                   1st        28       75%       11.5m        -
                                                        British Journal of Cancer 2008;
                                                                  98(5): 907-14

                                                            Sone et al 2007                  Mixed       17       59%       7.3m       18.9m
                                                         Cancer 2007; 109(9): 1836-44


                                                           Oshita et al 2006                 Mixed       11       91%         -          -
                                                        British Journal of Cancer 2006;
• Understanding biology and biomarkers is
  key to improve the management of lung
  cancer

• Targeting the EGFR pathway represents
  a major advance in the management of
  NSCLC

• Mutation rates are low in the Western
  world (local population is ~ 5%)
 6th   May 2010 –   2nd   Dec 2010

 Andrew Purvis, Clinical Scientist

Cheshire and Merseyside Regional
 Molecular Genetics Laboratory
   Liverpool Women’s Hospital
                        KRAS
• KRAS – small GTPase                               EGF
                                                        cell
  • Signal transducer downstream of                EGFR membrane

    EGFR (RAS/RAF/MAPK
    pathway)                        P                     P   KRAS

    • Regulator of cell proliferation and
      survival
                                                              RAF
  • Somatic mutations in KRAS
    abolish GTPase activity =                                 MEK
    uncontrolled proliferation
    • Pathway isolated from EGFR
                                                              MAPK
    • Anti-EGFR therapy ineffective
                            Cell proliferation and survival
  • ~40% of mCRC have a somatic
       KRAS – sequence and
 1
            mutations
      ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGAC
     .-M--T--E--Y--K--L--V--V--V--G--A--G--G--V--G--K--S--A--L--T

60 GATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTA
20 --I--Q--L--I--Q--N--H--F--V--D--E--Y--D--P--T--I--E--D--S--Y

120 CAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGG
 40 --R--K--Q--V--V--I--D--G--E--T--C--L--L--D--I--L--D--T--A--G

180 TCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTG
 60 --Q--E--E--Y--S--A--M--R--D--Q--Y--M--R--T--G--E--G--F--L--C

240 TGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAAT
 80 --V--F--A--I--N--N--T--K--S--F--E--D--I--H--H--Y--R--E--Q--I



>90% of mutations in mCRC found in codons 12 and 13
~5% of mutations found in codon 61
detection of KRAS mutations at
              LWH
• Why Pyrosequencing?
  • Unambiguous detection of ALL possible
    mutations in codons 12, 13 and 61
  • Sensitive
    • Detects 5%-10% mutant depending on the
      mutation
  • Results obtainable from DNA isolated from
    PETs
    • DNA of poor quality
    • DNA of low quantity
  • Proven technology
Example KRAS Pyrosequencing
          results
                  Non-mutated patient (normal
                   sequence)
 Visible light




                 Gene sequence (codons 12 and 13)
KRAS mutation +ve and –ve
        results
                 c.34G>T,
                    p.Gly12Cys




                 No mutation




                 c.38G>A, p.Gly13Asp
KRAS testing            6th
                May 2010 to                 2nd

           Dec 2010
• 28 referrals (cut sections or tissue blocks)
  from 5 pathology laboratories:
  •   Arrowe Park       6
  •   Chester                 7
  •   Royal Liverpool   3
  •   Southport               8
  •   Whiston                 4


• KRAS results obtained for 28/28 referrals
KRAS testing 6th May 2010 to 2nd
           Dec 2010
• Reporting times of 28 referrals
  • Mean reporting time 5.5 working days
  • 18 (64%) reported within 5 working days
                                       KRAS reporting times
       Number of referrals




                             8

                             6

                             4

                             2

                             0
                                 2    3    4     5     6     7     9     10
                                  Working days taken to report results
KRAS testing 6th May 2010 to 2nd
           Dec 2010
• 16/28 - no detectable KRAS mutation
• 12/28 (43%) - detectable KRAS mutation
                             34G>T
  • 10 in codon 12            (Gly12Cys), 2

  • 2 in codon 13
                                                 35G>T
  • 0 in codon 61                             (Gly12Val), 6




           Normal, 16
                                                 35G>A
                                              (Gly12Asp), 2

                                          38G>A
                                      (Gly13Asp) , 2
             Proportion of KRAS mutations
               detected
  Sensitivity / UKNEQAS (quality
      assessment scheme)
• Mutations can be present at low level
  • Tumour heterogeneity
  • Accompanying normal tissue
• Pyrosequencing detects mutations down
  to 5-10% depending on mutation
• Current mutation detection rate is 43%
  • Agrees with published data
  • Suggests we have not missed any mutations
• Full marks in recent UKNEQAS scheme
  • Not all participating labs received full marks
  • ? include % neoplastic cells on KRAS reports
12, 13 and 61 have the same effect
      on anti-EGFR therapy?




  De Roock et al., JAMA. 2010;304(16):1812-1820
                 BRAF V600E ?
• A proportion of tumours with no KRAS
  mutation will not respond to anti-EGFR therapy
• Other biomarkers?
• BRAF V600E detected in 5-12% of mCRC
  • Same pathway as KRAS
  • V600E increases BRAF activity ~10 fold
     • Predicts resistance to anti-EGFR therapy
                                           34G>T
                                         (Gly12Cys), 2


                                                            35G>T
                                                         (Gly12Val), 6




                         Normal, 16
                                                            35G>A
                                                         (Gly12Asp), 2

                                                     38G>A
                                                 (Gly13Asp) , 2
Colorectal Cancer
 Place of K-ras testing
         Colorectal Cancer
Stage        Incidence    5yr survival
Dukes A         10%           90+%
Dukes B         22%           60-80%
Dukes C         39%           30-60%
Metastatic      29%           <5%

 65% of patients with CRC will eventually
 die from advanced disease
 19,000pts annually in UK
     Systemic therapy for CRC
1957                              1994            2005

Best supportive care
5FU
                                   Irinotecan
                                     Capecitabine
30                                       Oxaliplatin
25
20
                                         Bevacizumab
15                                        Cetuximab
10
5
0      Median survival - months
             Cetuximab - 2003
• Chimeric mouse monoclonal ab
• Targeted against EGFR receptor
• Entry point to signal transduction pathway
  – cell proliferation
  – cell migration
  – cell adhesion
  – cell survival
                     EGFR signaling




Baselga. Eur J Cancer 2001;37 Suppl 4:S16-S22.
                   Cetuximab
• active in CTX resistant colorectal xenografts
• synergistic with
  – Irinotecan
  – radiotherapy
 NCI of Canada ph III Cet vs BSC
             CO.17
572 pts, egfr expression +ve
Non responders to Ctx

          Cetuximab      BSC
MS        6.1m           4.6m
PR        8%             0%
                         BOND study
                      Time to progression
       Patients free of progression (%)
100


 80


 60

 40


 20


  0
      0         2     4       6       8       10     12    ERBITUX + irinotecan
                Time to progression (months)               ERBITUX
      p<0.001

      Cunningham et al. N Engl J Med 2004; 351:337-345.
         Cetuximab - Toxicity
• Acneiform rash
  – Gd >1 76%
  – Gd 3/4 12%
  – maximal at wk3 then improves
  – ? Rash associated with improved survival
      CRYSTAL – Ph III Ist line
• 1198 pts
• FOLFIRI +/- cetuximab

Pfs      8.9m             8m
RR       47%              39%
OS       23.5m            20m ns
   COIN – first line 3 arm trial
• FOLFOX/XELOX + cet continuous
• FOLFOX/XELOX       continuous
• FOLFOX/XELOX + cet intermittent

• 1630pts randomised
• No difference in OS or PFS
              EGFR expression

• Not a useful predictive factor
  – Heterogeneity of EGFR expression
  – Variable affinity of EGFR for cetuximab
  – Inconsistency in measurement
             K-ras oncogene
•   Encode proteins downstream from EGFR
•   Essential component of EGFR signalling
•   Can acquire activating mutations in exon 2
•   Does mutation status of K-ras affect
    response to anti-EGFR monoclonals?
               CO.17
394/572 samples available for K-ras
analysis

K-ras mutation detected in 40%
                  CO.17
                Cetuximab   BSC

Mutated   ms        4.5m    4.6m
          1yr       13%     19%
          RR        1%      0%

Wild Type ms        9.5m    4.8m
          1yr       28%     20%
          RR        12%     0%
CO.17 - Survival
                     EGFR signaling




Baselga. Eur J Cancer 2001;37 Suppl 4:S16-S22.
     CRYSTAL K-ras WT pts
• Post hoc analysis for NICE (TA176)
• 348pts FOLFIRI + cetuximab

        WT         Mutant
PFS     9.9        8.7m      p=0.0167
MS      24.9m      21 m      ns
RR      66%        43%       p=0.0028
Surgery 7%         3.7%
       COIN – WT analysis
• 729 WT pts OXFp +/- cetuximab

• PFS ns
• OS ns
• RR 64% vs 57% p=0.049
      OPUS – first line Ph II
• 336pts 134 K-ras WT
• FOLFOX +/- cetuximab

        WT       Mutant
PFS     7.7 m    7.2 m    p=0.01
RR      60%      37%      p = 0.011
Surgery 11%      4.1%     sig not reported
             CELIM – first line
•   Randomised ph II
•   114 pts
•   Initially unresectable liver metastases
•    folfiri + cetuximab vs folfox + cetuximab
•   RR 68% vs 57%
•   Subsequent resection 43 vs 40%
     1st line cetuximab + Ctx
• Variable effect on survival
• ? Consistently higher response rates
        Liver metastases - down sizing




     Inoperable                                        Operable
  liver metastasis                                 liver metastasis
                                  Chemotherapy

    5yr survival< 5%                                   5yr survival 30-40%


• Systemic therapy may render tumours operable
• 95/701 (13.5%) rendered resectable
   – Reason unresectable
        •   60% (too large),
        •   49% (ill located),
        •   34% (multinodular),
        •   18% (extrahepatic)                   Adam Ann Surg Oncol 2001
  Survival after chemotherapy-facilitated
  resection of metastases is the same as
   that for initially resectable metastases
       Proportion surviving
1.0


0.8
                    54%
0.6

                    50%       34%
0.4                                     27%

                              34%
0.2                                     29%
                                                      19%

0.0
                                                             Resectable (n = 425)
       0    1   2    3    4    5    6   7     8   9    10
                    Survival time (years)                    Initially unresectable (n = 95)



      Adam R. Ann Oncol 2003;14:ii13-ii16.
  Resection rate correlates with tumor response rate in both
             selected and non-selected patients


       Resection rate                                       Studies including selected
                                                            patients
0.6
                                                            (liver metastases only,
0.5                                                         no extrahepatic disease)
                                                            (r=0.96, p=0.002)
0.4
                                                            Studies including all
0.3
                                                            patients with mCRC
0.2                                                         (solid line)
                                                            (r=0.74, p<0.001)
0.1

0.0                                                         Phase III studies including
      0.3     0.4     0.5     0.6     0.7     0.8     0.9   all patients in mCRC
                       Response rate                        (dashed line)
                                                            (r=0.67, p=0.024)


      Folprecht et al. Ann Oncol 2005;16:1311-1319.
                      NICE guidance TA176

•   Recommended Cetuximab + Chemotherapy for patients

    – With inoperable CRC metastases confined to the liver
    – Who were fit for surgery
    – Who might be downsized to surgery following systemic therapy
CCO – Survival from I-CET

             44pts
             MS 10m (6 – 13)
CCO – Survival from     1st       line
          CTX

               44pts
               MS 36m (32 – 39)
Nov 08




         Xelox x 12 weeks
Feb 09
May 09




         Irinotecan x 12 wks
Oct 09
Jan 10




         I-Cetux
          Adjuvant Cetuximab
• FOLFOX +/- cetuximab
• NCCTG Intergroup phase III trial NO147
• 1760pts st III colon cancer wild type K-ras

               Folfox     Fotfox + cet
3yr dfs        74%             73%
3yr os         87%             82%
           Cetuximab 2010
• Downsizing liver metastases to resection
   In combination with oxaliplatin/5FU/Irinotecan


• Third line treatment in pts previously
  responding to chemotherapy
   In combination with Irinotecan


 Adjuvant cetuximab not of value
The National Cancer Dataset
          Project
   - especially pathology!
               Di Riley
   Director for Clinical Outcomes
CRS, December 2007


.....Better information on cancer services and
outcomes will enhance patient choice, drive up
service quality and underpin stronger commissioning;

.....Collection of defined datasets on all cancer
patients will be mandated through the national model
contract. PCTs will be responsible for ensuring that
this information is collected by MDTs and sent to
cancer registries
CRS, December 2007


  .....We particularly need to collect and
  use high quality data on:


  .....Clinical outcomes, including survival,
  with adjustments for co-morbidity and
  stage of disease.
                         60
                         50
Risk-adjusted APE rate




                         40
                         30
                         20
                         10




                              0   100           200              300            400     500
                                  Number of surgically treated rectal cancer patients
Five-year relative survival for colorectal cancer patients (diagnosed 1996-
   2002) by stage at diagnosis, England
Number of cases (1996-2006) and five-year relative survival of colorectal
  cancer patients (diagnosed 1996-2002) by stage at diagnosis, England
     Project Purpose

• To redevelop the National Cancer Dataset for
  use as a full operational standard in England

• To review the current business needs for the
  collections and make sure that the output is fit
  for purpose
                      NCIN ‘Data Views’

                                  Patient Pathway
                                 Refer-   Diag Stage   Rx Rec/Mets Rx   Pall.   Death
                                  ral                                   Care
                   Diagnostics
Datasets/Sources




                   CWT

                   MDT

                   RTDS

                   HES
                   NCASP

                   Ca. Reg
      SSCRG progress
• Approved mandated datasets
  –   Cancer registration – additional review
  –   GFoCW
  –   Radiotherapy
  –   CDS
• 12 SSCRGs identified ‘site specific’ items
  – Link to ‘output’ requirements
  – Based on existing datasets e.g. NCASP, BAUS
  – Period of definitional testing

• Mandated for NHS from October 2012
       Challenges....
• Clinical data from MDTs?
• Transport via standard NHS data flows
   – SUS, Open Exeter (Cancer Waits)
   – Direct Cancer Registries & Nat. Repository
   – Direct to NCASP
• Linking activity and ‘care record’ data
   – OPCDS + radiotherapy
   – CWT + ‘registration’
   – NHS number linked data views
• Coded data from path/radiology/etc
     Pathology Data
• Patient care & management
  – MDT
  – Staging
  – Ongoing care

• Cancer Outcomes/Registration
  – Staging
  – Morphology, topography, grade
  – Risk adjusted analysis
NCRD – pathology
   items -1
Diagnosis
DIAGNOSIS DATE (CANCER)
PRIMARY DIAGNOSIS (ICD)
TUMOUR LATERALITY
BASIS OF DIAGNOSIS (CANCER)
HISTOLOGY (SNOMED)
GRADE OF DIFFERENTIATION (AT DIAGNOSIS)

Staging
T CATEGORY (FINAL PRETREATMENT)

STAGING CERTAINTY FACTOR (T CATEGORY)

N CATEGORY (FINAL PRETREATMENT)

STAGING CERTAINTY FACTOR (N CATEGORY)

M CATEGORY (FINAL PRETREATMENT)

STAGING CERTAINTY FACTOR (M CATEGORY)

TNM CATEGORY (FINAL PRETREATMENT)

STAGING CERTAINTY FACTOR (TNM CATEGORY)

SITE SPECIFIC STAGING CLASSIFICATION
TNM CATEGORY (INTEGRATED)
T CATEGORY (INTEGRATED STAGE)
N CATEGORY (INTEGRATED STAGE)
M CATEGORY (INTEGRATED STAGE)
NCRD – pathology
   items -2
  Pathology Details
  PATHOLOGY INVESTIGATION TYPE
  SAMPLE RECEIPT DATE
  INVESTIGATION RESULT DATE
  CONSULTANT CODE (PATHOLOGIST)
  ORGANISATION CODE (OF REPORTING PATHOLOGY)
  PRIMARY DIAGNOSIS (ICD)
  TUMOUR LATERALITY
  INVASIVE LESION SIZE
  SYNCHRONOUS TUMOUR INDICATOR
  HISTOLOGY (SNOMED)
  GRADE OF DIFFERENTIATION
  CANCER VASCULAR OR LYMPHATIC INVASION
  EXCISION MARGIN
  NODES EXAMINED NUMBER
  NODES POSITIVE NUMBER
  T CATEGORY (PATHOLOGICAL)
  N CATEGORY (PATHOLOGICAL)
  M CATEGORY (PATHOLOGICAL)
  TNM CATEGORY (PATHOLOGICAL)
  SERVICE REPORT IDENTIFIER
  SERVICE REPORT STATUS
  SPECIMEN NATURE
  ORGANISATION CODE (REQUESTED BY)
  CARE PROFESSIONAL CODE (REQUESTED BY)
  T CATEGORY EXTENDED (PATHOLOGICAL)
  M CATEGORY EXTENDED (PATHOLOGICAL)
    RCPath Datasets
• Guidelines for good clinical reporting
  – Specific for different cancer sites
• What proportion of pathologists use
  proforma-based reporting tools?
• How to or should we progress to encoded
  data?
• Cancer registration & outcomes analysis
  would benefit from it?
• Would MDTs also benefit - MDT dataset?
NCIN/RCPath Pathology
       Project
• Structured or proforma reporting
• Codify & mandate ‘Core’ items
• Direction of travel too great
  – Systems not available
  – Change in clinical practice
  – Patient management v outcomes analysis

• What is the solution?
  – Professional & Clinical Record Standards
 Professional Standard -
         Stage 1
• Clarification of content to be provided within
  free text reports (RCPAth Core Items)
• Or the use of the RC Path proforma.
• Communication to Pathologists of content
  specification and mechanism for
  transmission to Registries.
• Both of these aspects covered by RC Path
  guidance
  Standards - Stage 2

• Professional Standard version 2
  – stipulation of proforma to be used for
    reporting
  – introduction of structured/coded items


• Patient Record Standard version 1
  – identification of items which can be
    structured and have SNOMED CT codes
Standards - Stage 3

• Professional Standard version 3
  – structured data items

• Patient Record Standard version 2
  – all items structured with SNOMED CT
    coding
  – identification of the linkage standards to
    allow record to Registry transmission and
    use.
Timescales & Process
• Working Group
  – RCPath / NCIN / CfH /DH
  – National Clinical Content & Requirements Board
    (NCCRB)
  – Role of RCPath for governance key
  – Align with other related initiatives
• Estimated time – 5 years (2015)
  –   Content Proposal – approved November 2010
  –   Requirements Statement
  –   Assurance Statement
  –   Then the Information Standards Board
                         60
                         50
Risk-adjusted APE rate




                         40
                         30
                         20
                         10




                              0   100           200              300            400     500
                                  Number of surgically treated rectal cancer patients

				
DOCUMENT INFO
Shared By:
Categories:
Tags:
Stats:
views:31
posted:11/11/2011
language:English
pages:159