"It is never too late to give up our
prejudices. No way of thinking or
doing, however ancient, can be
trusted without proof." --
H.D.Thoreau, Walden
Two “theories”
• What is a theory?
• Intelligent design (Creationism)
– Life was designed by a higher being (as described in
the bible).
– NO legitimate sciences to support.
– But no Scientific evidence to refute!
• Thus not a scientific theory (can’t be tested)
• Evolution
– Life has progressively changed from one form into
others over large expanses of time.
– Overwhelming evidence from many disciplines. Also
testable.
Background terms
• Gene- A defined section of DNA that produce a
specific trait.
– Interacting with the environment, genes collectively
produce the physical and behavioral features of all living
things.
– Alleles are variants of a specific gene.
• Population- A group of organisms (of the same
species) that have the potential to successfully breed
with one another (often identified by location as
well)
– Alleles exist in populations at specific frequencies.
Understanding Allele Frequency
• What percentage of
the population are
– Brunnett?
– Blonde?
Alleles of hair color
– Red?
– Other?
• Should these
percentages change
from one generation to
the next?
Defining Evolution
• Allele frequencies should not change
between generations.
• Evolution occurs if the allele frequency
changes in a population over generations of
time.
– Populations change NOT individuals!!!!
– Changes occur in percentages of traits (alleles)
Modes of change
• Mutations
• Random drift (small
populations)
– Like a coin toss
• Migration b/w
populations
• Selective mating
• Differential survival!
Only mutations create novel traits!
• Gene sequence (The DNA code):
AAGGTCCTAGGGAATTCC
• During DNA replication and cell division
mistakes in the sequence can occur.
AAGTTCCTAGGGAATTCC
• Rarely these mutated genes get passed to
offspring as new traits.
• Mutations accumulate over time.
Natural Selection
The dominate mechanism
• First proposed independently by C. Darwin, and H.
Wallace in mid 1800’s.
• Conditions (the ingredients):
• 1. Variation- No two individuals of the same species are
exactly alike.
• 2. Inheritability- Passing of traits (genes) from parents to
offspring (the next generation).
• Darwin guessed on this one (genes were not discovered yet)
• 3. Overproduction- have the potential to produce more
offspring than can survive.
Natural Selection Mechanism
• 1. Overproduction leads to competition between individuals for
resources.
• 2. Variation between individuals gives some individuals an
advantage over others .
• 3. These better adapted individuals survive easier, reproduce more
and leave more offspring for the next generation.
• 4. These offspring inherit the same advantageous traits and continue
to out-compete individuals without the allele.
• 5. In each generation the offspring represent an increasing proportion
of the next generation. The allele frequency is changing in the
population.
Summary points
• NATURAL
SELECTION ACTS
ON WHAT
ALREADY EXISTS
IN A
POPULATION!
– It does not create new
traits.
– Only mutations create
new traits.
Important points to remember
• Evolution is a population level phenomenon.
Individuals survive or not, but populations
evolve.
• Natural selection works only on heritable traits.
Acquired traits are not passed on to the next
generation (exception: learned behavior can be
taught)
• Evolution is situational. What new features can
arise depend on what old features are present in
the ancestral population. How they are modified
depends on local circumstances.
Speciation
• Species are formed from common ancestors
• The only thing necessary for a new species
to form is reproductive isolation.
– Commonly occurs through physical isolation of
sub-populations.
– Over-time, isolated sub-populations then
diverge genetically to suit local conditions.
– Given sufficient genetic divergence, they may
no longer interbreed if brought back together.
Other Mechanisms of Isolation
• Physical appearance- no longer recognize each other
• Ecological - adapt to different habitats
• Behavioral
• different mating rituals
• Temporal changes in mating
• Mechanical- incompatible sex
• Post mating- incompatible genes, offspring
infertility.
Hawaiian Honeycreepers:
• Dramatic variety in bill
morphology (Adaptive
Radiation)
– Fossil record demonstrates
ancestry to single founder
species.
• Competition for resources on
islands drove diversification
– Niche partitioning
– Some bills match flower shapes-
Coevolution.
Adaptive radiation
(Phylogenic tree)
Lake Victoria’s: Cichlid Fish
• Regions of the lake has
divergent species.
– All come from a common
ancestor (supported through
fossils, DNA, etc.)
• Variation correlate with
habitat difference/ feeding
mode.
• Many other adaptive
radiation examples exist.
What other evidence is there?
Geology’s story
• Sediments form layers
overtime
• Oldest layers on the
bottom
• Age of earth is beyond
question over 4 billion
years old!!
– Corroborated using many
independent measures from
many disciplines.
Evidence: Fossil
• Fossils are preserved
records of living
organisms embedded
in rocks.
• Can compare anatomy
• Can age with carbon
dating and several
other independent
ways.
Geology’s story
• Fossils show clear
development from
primitive to advance
as one moves up
layers
• Pattern is consistent
world wide!
– Same age rock have
same organisms
Creationist counter-argument
• Fossils prove the biblical flood because we
find marine fossils high up in mountains
– But, plate tectonics
– Small primitive fossil organism all settled to
bottom first world wide???
– Shouldn’t heavier organism settle to bottom first?
– What about the bible’s age for the earth?
– The Hebrew “day” has many meanings.
Ancient fossils
Stromatolites (3 billion years)
Stromatolites (today)
Comparative anatomy:
Transitional fossils
Coelacanth
Archaeopteryx
A perfect transitional fossil?
• Possess traits of
reptiles: scales, skull,
teeth, tail, etc
• Has feathers like birds
• Many other
intermediate species
have been discovered
over last decade
Whale evolution
Modern examples of transitions
• Some fish are capable
of “walking” on land
and breathing air!
• Some legged animals
have gills and
• Other amphibians are
more fish-like
Modern examples of transitions
• Earthworms to insects
is a continuum.
• Where does one start
and the other begin?
• Recent DNA studies
reveal that a single
point mutation in
annelids can produce
limbs!
From worm to vertebrate?
The Lancelet
• Amphioxus- ½ worm; ½
“vertebrate” animal
• Possess unique vertebrate
characteristics- except
spine.
• Lack significant brain,
heart, and share lifestyle of
annelid worm.
Primitive vertebrates
Comparative Anatomy
• Despite great divergence in
physical appearance we all
share the SAME bones!
Only differ in size.
• Fossil limbs show
chronological development
Human evolution: Fossil skulls
Contrary to convention, several hominids existed simultaneously
until very recently
Accumulation of genetic
modification and ancestry
1. AAGGTCCTAGGGAATTCCGT
2. AAGTTCATAGGGAATTCCGT (90%)
3. AAGTTCATAGGGGATCCCGT (80%)
4. AAGTTCATAGTGGATCCCGT (75%)
– #1 is the ancestor
– #2 has changed the least, thus has diverged most
recently.
– #4 is the least similar to #1 and has a more distance
relatedness to the ancestor.
DNA fingerprints
• DNA is strikingly similar between
related organisms
– Humans (H) share ~98% of their DNA
with Chimpanzees (c)
• Degree of similarity can be used to
map evolutionary ancestry.
– Based on mutation rate
• More mutation means more
distantly related.
Chronology usually matches that of fossil records. Coincidence??
Embryology
• Similarity of embryos of
otherwise very different
organism may reflect
evolutionary past and
degree of relatedness.
• Opponents point out that
the person that discovered
this falsified his
diagrams. True, But…
Molecular Biology
Accumulation of modifications to key proteins reflects ancestry
But all this is circumstantial!
• We don’t actually see them changing.
• Or do we…
Darwin’s finches:
Physical change were recorded
Direct observation:
Peppered Moth
Peppered moth Evolution
• In England: As soot
built up on trees the
dark variety gained an
advantage.
• Recent studies in the
U.S. reveal exact same
pattern seen in England.
– a rare repeat for
evolution
Direct observations: Anole lizard
• Introduced populations to 14 islands
• In < 15 years population diverged
into distinctly different varieties.
– Changes were measurable but small.
• The change was accurately
predicted before it occurred!
J. Losos, K. Warheit and T. Schoener
Direct Evidence: Stickleback
Fish
• Transplanted single
population of fish.
• Character displacement:
– Limnetic- feed on free-
swimming plankton
– Benthic- bottom feeder
Direct observation: Guppies
• Adaptation in presence of
predators:
– Small bodies to hide from predators
– More offspring to combat predators
• Transplanted guppies to predator
free pools. (Reznick et al. 1990)
• 11 years: Guppies are larger,
mature later, have fewer young.
Reznick, D. A., H. Bryga and J. A. Endler. 1990. Experimentally induced life-history evolution in a natural population. Nature 346: 357--359.
Where did your dog
come from?
(Artificial selection)
Drug resistant bacteria
Pesticide resistant insects
• Populations of
mosquitoes have become
resistant to pesticides.
• Pattern reflects area of
overuse of pesticides.
• U.S. farms regularly
detect resistant
populations of pests.
Multi-drug resistant pathogens
• Tuberculosis
• Malaria
• Staphylococcus
• Encouraged by
antibiotic abuse,
antibacterial cleaners,
panicked/ drug
dependant public
Online article about drug resistant pathogens.
More drug ignorance
• Drugs interrupt bodies
natural adaptations:
– Fever reducers help
infections persist in body!
– Painkillers/ anti-
inflammatory retard
healing process.
(Discover Jan 2003)
Evolution’s alternative
• Use the immune
system your born with.
• Bombard pathogen
with multiple drugs.
• * Good sanitation:
– Limits mobility of
pathogens to escape a
dieing body.
– This forces them to
become less virulent.
Miller’s
experiment
• Demonstrated that key
biological molecules
(amino acids) can
emerge “spontaneously”
from a “primordial
soup” under the
conditions expected in
early Earth history.
Protocells
• Cell-like structure can
spontaneously form in
lab conditions
matching those of
early earth.
• Capable of sustaining
life-like biochemistry.
• Recall: life is sustain
chemical reactions.
In a nut shell
Is this for Real?
• While any one piece of evidence can be criticized
• The collection of repeated and independent
evidence continually corroborates the tenets of
evolution.
• No scientific principle has withstood more attacks
than evolution.
– Newton’s principle of gravity were accepted as law…
but he got it wrong (in part)!
– No scientific evidence discounting evolution has ever
been found, yet many still question it. Why?
Is evolution complete?
• How did life begin?
– How did DNA come about?
– Still unanswered (Can God fit in here?)
• Debate persists on details:
– Relationships between species and their
ancestry. (who’s related to who?)
– The pace of evolution?
– Mechanisms of speciation.
“Nothing in biology makes sense
except in the light of evolution”
Theodosius Dobzhansky.
• Ignoring our evolutionary past is one of the great
problems with today's society:
– Nearsightedness, back problems, cancer, drug
resistance, biodiversity….
– It can explain socially “abnormal” traits as adaptations
• Cheating, PTSD, Mars vs. Venus.
• Recognizing that we are not above nature’s rules
teaches us to respect nature.
Evolution's relevance
• Its principles guide modern gene therapy; high
yield crops, selective breeding programs, modern
psychology, etc
• Emphasizes the importance of variability. Trying
to make everyone the same is a dangerous game in
a changing environment.
– Variation = ultimate insurance policy against disease.
– Monoculture crops are vulnerable..
• Abusive drug and pesticide use.
– Stronger drug/pesticide lead to more side-effects
• Antibacterial cleaners? Are they safe?
Evolution and the Environment
• Each organism of a habitat becomes “tuned’
to the specific local conditions of the
environment for which they evolved under
the influence of.
Evolution and the Environment
• As a result, every aspect of an ecosystem is
utilized by living organism- saturated niche
partitioning- driven by natural selection.
• All parts of the ecosystem serves a role,
whether it by a keystone predator,
disturbance regime, mineral composition in
the soil, or even the texture of the bark on
the trees.
Evolution and the Environment
• Global environment is in a state of constant
change (dynamic).
– Changes in population, introductions of new
species, climate and weather, etc.
• Evolution is the response of nature to
environmental change.
Evolution and the Environment
• Controlling the intensity of human induced change
could permit cohabitation providing populations
evolve to adjust to changes.
• Large populations can evolve but changes must
stabilize so that selection is directional.
• Sudden large scale changes can be too rapid for life to
adjust through evolution forcing either re-distribution
of the population or extinction.
Goal: Rate of human driven change = evolution’s rate
The Debate
• Could the fundamentalists opposition backfire on
them?
– Opposition erroneously feel evolution excludes faith.
– Given the overwhelming evidence in support, they
seem to highlight their ignorance to the educated
public? Do they foster ignorance?
– Teaching evolution alongside Creationism would be an
unfair advantage. Already rebellious youth may see
creationism as a joke and abandon their faith.
• Theistic Evolution- Compromise of thought.
Evolution is a real process initiated by God.
– Guided formation of DNA? Selected humans to receive
his moral spirit? Minimal involvement since?
“There is grandeur in this view of life, with its
several powers, having been originally
breathed by the creator into a few or into one:
and that, whilst this planet has gone cycling on
according to the fixed laws of gravity, from so
simple of a beginning, endless forms most
beautiful and wonderful have been and are
being seen and evolved”