Embed
Email

evolution

Document Sample
evolution
Shared by: HC111110213215
Categories
Tags
Stats
views:
3
posted:
11/10/2011
language:
English
pages:
64
"It is never too late to give up our

prejudices. No way of thinking or

doing, however ancient, can be

trusted without proof." --



H.D.Thoreau, Walden

Two “theories”

• What is a theory?

• Intelligent design (Creationism)

– Life was designed by a higher being (as described in

the bible).

– NO legitimate sciences to support.

– But no Scientific evidence to refute!

• Thus not a scientific theory (can’t be tested)

• Evolution

– Life has progressively changed from one form into

others over large expanses of time.

– Overwhelming evidence from many disciplines. Also

testable.

Background terms

• Gene- A defined section of DNA that produce a

specific trait.

– Interacting with the environment, genes collectively

produce the physical and behavioral features of all living

things.

– Alleles are variants of a specific gene.

• Population- A group of organisms (of the same

species) that have the potential to successfully breed

with one another (often identified by location as

well)

– Alleles exist in populations at specific frequencies.

Understanding Allele Frequency

• What percentage of

the population are

– Brunnett?

– Blonde?

Alleles of hair color

– Red?

– Other?

• Should these

percentages change

from one generation to

the next?

Defining Evolution

• Allele frequencies should not change

between generations.

• Evolution occurs if the allele frequency

changes in a population over generations of

time.

– Populations change NOT individuals!!!!

– Changes occur in percentages of traits (alleles)

Modes of change

• Mutations

• Random drift (small

populations)

– Like a coin toss

• Migration b/w

populations

• Selective mating

• Differential survival!

Only mutations create novel traits!

• Gene sequence (The DNA code):

AAGGTCCTAGGGAATTCC

• During DNA replication and cell division

mistakes in the sequence can occur.

AAGTTCCTAGGGAATTCC

• Rarely these mutated genes get passed to

offspring as new traits.

• Mutations accumulate over time.

Natural Selection

The dominate mechanism

• First proposed independently by C. Darwin, and H.

Wallace in mid 1800’s.

• Conditions (the ingredients):

• 1. Variation- No two individuals of the same species are

exactly alike.

• 2. Inheritability- Passing of traits (genes) from parents to

offspring (the next generation).

• Darwin guessed on this one (genes were not discovered yet)

• 3. Overproduction- have the potential to produce more

offspring than can survive.

Natural Selection Mechanism

• 1. Overproduction leads to competition between individuals for

resources.

• 2. Variation between individuals gives some individuals an

advantage over others .

• 3. These better adapted individuals survive easier, reproduce more

and leave more offspring for the next generation.

• 4. These offspring inherit the same advantageous traits and continue

to out-compete individuals without the allele.

• 5. In each generation the offspring represent an increasing proportion

of the next generation. The allele frequency is changing in the

population.

Summary points

• NATURAL

SELECTION ACTS

ON WHAT

ALREADY EXISTS

IN A

POPULATION!

– It does not create new

traits.

– Only mutations create

new traits.

Important points to remember

• Evolution is a population level phenomenon.

Individuals survive or not, but populations

evolve.

• Natural selection works only on heritable traits.

Acquired traits are not passed on to the next

generation (exception: learned behavior can be

taught)

• Evolution is situational. What new features can

arise depend on what old features are present in

the ancestral population. How they are modified

depends on local circumstances.

Speciation

• Species are formed from common ancestors

• The only thing necessary for a new species

to form is reproductive isolation.

– Commonly occurs through physical isolation of

sub-populations.

– Over-time, isolated sub-populations then

diverge genetically to suit local conditions.

– Given sufficient genetic divergence, they may

no longer interbreed if brought back together.

Other Mechanisms of Isolation

• Physical appearance- no longer recognize each other

• Ecological - adapt to different habitats

• Behavioral

• different mating rituals

• Temporal changes in mating

• Mechanical- incompatible sex

• Post mating- incompatible genes, offspring

infertility.

Hawaiian Honeycreepers:

• Dramatic variety in bill

morphology (Adaptive

Radiation)

– Fossil record demonstrates

ancestry to single founder

species.

• Competition for resources on

islands drove diversification

– Niche partitioning

– Some bills match flower shapes-

Coevolution.

Adaptive radiation

(Phylogenic tree)

Lake Victoria’s: Cichlid Fish

• Regions of the lake has

divergent species.

– All come from a common

ancestor (supported through

fossils, DNA, etc.)

• Variation correlate with

habitat difference/ feeding

mode.

• Many other adaptive

radiation examples exist.

What other evidence is there?

Geology’s story

• Sediments form layers

overtime

• Oldest layers on the

bottom

• Age of earth is beyond

question over 4 billion

years old!!

– Corroborated using many

independent measures from

many disciplines.

Evidence: Fossil

• Fossils are preserved

records of living

organisms embedded

in rocks.

• Can compare anatomy

• Can age with carbon

dating and several

other independent

ways.

Geology’s story

• Fossils show clear

development from

primitive to advance

as one moves up

layers

• Pattern is consistent

world wide!

– Same age rock have

same organisms

Creationist counter-argument

• Fossils prove the biblical flood because we

find marine fossils high up in mountains

– But, plate tectonics

– Small primitive fossil organism all settled to

bottom first world wide???

– Shouldn’t heavier organism settle to bottom first?

– What about the bible’s age for the earth?

– The Hebrew “day” has many meanings.

Ancient fossils









Stromatolites (3 billion years)



Stromatolites (today)

Comparative anatomy:

Transitional fossils

Coelacanth

Archaeopteryx

A perfect transitional fossil?

• Possess traits of

reptiles: scales, skull,

teeth, tail, etc

• Has feathers like birds

• Many other

intermediate species

have been discovered

over last decade

Whale evolution

Modern examples of transitions



• Some fish are capable

of “walking” on land

and breathing air!

• Some legged animals

have gills and

• Other amphibians are

more fish-like

Modern examples of transitions



• Earthworms to insects

is a continuum.

• Where does one start

and the other begin?

• Recent DNA studies

reveal that a single

point mutation in

annelids can produce

limbs!

From worm to vertebrate?

The Lancelet

• Amphioxus- ½ worm; ½

“vertebrate” animal

• Possess unique vertebrate

characteristics- except

spine.

• Lack significant brain,

heart, and share lifestyle of

annelid worm.

Primitive vertebrates

Comparative Anatomy

• Despite great divergence in

physical appearance we all

share the SAME bones!

Only differ in size.

• Fossil limbs show

chronological development

Human evolution: Fossil skulls









Contrary to convention, several hominids existed simultaneously

until very recently

Accumulation of genetic

modification and ancestry

1. AAGGTCCTAGGGAATTCCGT

2. AAGTTCATAGGGAATTCCGT (90%)

3. AAGTTCATAGGGGATCCCGT (80%)

4. AAGTTCATAGTGGATCCCGT (75%)

– #1 is the ancestor

– #2 has changed the least, thus has diverged most

recently.

– #4 is the least similar to #1 and has a more distance

relatedness to the ancestor.

DNA fingerprints

• DNA is strikingly similar between

related organisms

– Humans (H) share ~98% of their DNA

with Chimpanzees (c)

• Degree of similarity can be used to

map evolutionary ancestry.

– Based on mutation rate

• More mutation means more

distantly related.





Chronology usually matches that of fossil records. Coincidence??

Embryology

• Similarity of embryos of

otherwise very different

organism may reflect

evolutionary past and

degree of relatedness.

• Opponents point out that

the person that discovered

this falsified his

diagrams. True, But…

Molecular Biology

Accumulation of modifications to key proteins reflects ancestry

But all this is circumstantial!



• We don’t actually see them changing.

• Or do we…

Darwin’s finches:

Physical change were recorded

Direct observation:

Peppered Moth

Peppered moth Evolution

• In England: As soot

built up on trees the

dark variety gained an

advantage.

• Recent studies in the

U.S. reveal exact same

pattern seen in England.

– a rare repeat for

evolution

Direct observations: Anole lizard

• Introduced populations to 14 islands

• In < 15 years population diverged

into distinctly different varieties.

– Changes were measurable but small.

• The change was accurately

predicted before it occurred!









J. Losos, K. Warheit and T. Schoener

Direct Evidence: Stickleback

Fish

• Transplanted single

population of fish.

• Character displacement:

– Limnetic- feed on free-

swimming plankton

– Benthic- bottom feeder

Direct observation: Guppies

• Adaptation in presence of

predators:

– Small bodies to hide from predators

– More offspring to combat predators

• Transplanted guppies to predator

free pools. (Reznick et al. 1990)

• 11 years: Guppies are larger,

mature later, have fewer young.





Reznick, D. A., H. Bryga and J. A. Endler. 1990. Experimentally induced life-history evolution in a natural population. Nature 346: 357--359.

Where did your dog

come from?

(Artificial selection)

Drug resistant bacteria

Pesticide resistant insects

• Populations of

mosquitoes have become

resistant to pesticides.

• Pattern reflects area of

overuse of pesticides.

• U.S. farms regularly

detect resistant

populations of pests.

Multi-drug resistant pathogens

• Tuberculosis

• Malaria

• Staphylococcus

• Encouraged by

antibiotic abuse,

antibacterial cleaners,

panicked/ drug

dependant public



Online article about drug resistant pathogens.

More drug ignorance

• Drugs interrupt bodies

natural adaptations:

– Fever reducers help

infections persist in body!

– Painkillers/ anti-

inflammatory retard

healing process.

(Discover Jan 2003)

Evolution’s alternative

• Use the immune

system your born with.

• Bombard pathogen

with multiple drugs.

• * Good sanitation:

– Limits mobility of

pathogens to escape a

dieing body.

– This forces them to

become less virulent.

Miller’s

experiment

• Demonstrated that key

biological molecules

(amino acids) can

emerge “spontaneously”

from a “primordial

soup” under the

conditions expected in

early Earth history.

Protocells

• Cell-like structure can

spontaneously form in

lab conditions

matching those of

early earth.

• Capable of sustaining

life-like biochemistry.

• Recall: life is sustain

chemical reactions.

In a nut shell

Is this for Real?

• While any one piece of evidence can be criticized

• The collection of repeated and independent

evidence continually corroborates the tenets of

evolution.

• No scientific principle has withstood more attacks

than evolution.

– Newton’s principle of gravity were accepted as law…

but he got it wrong (in part)!

– No scientific evidence discounting evolution has ever

been found, yet many still question it. Why?

Is evolution complete?

• How did life begin?

– How did DNA come about?

– Still unanswered (Can God fit in here?)

• Debate persists on details:

– Relationships between species and their

ancestry. (who’s related to who?)

– The pace of evolution?

– Mechanisms of speciation.

“Nothing in biology makes sense

except in the light of evolution”

Theodosius Dobzhansky.





• Ignoring our evolutionary past is one of the great

problems with today's society:

– Nearsightedness, back problems, cancer, drug

resistance, biodiversity….

– It can explain socially “abnormal” traits as adaptations

• Cheating, PTSD, Mars vs. Venus.

• Recognizing that we are not above nature’s rules

teaches us to respect nature.

Evolution's relevance

• Its principles guide modern gene therapy; high

yield crops, selective breeding programs, modern

psychology, etc

• Emphasizes the importance of variability. Trying

to make everyone the same is a dangerous game in

a changing environment.

– Variation = ultimate insurance policy against disease.

– Monoculture crops are vulnerable..

• Abusive drug and pesticide use.

– Stronger drug/pesticide lead to more side-effects

• Antibacterial cleaners? Are they safe?

Evolution and the Environment

• Each organism of a habitat becomes “tuned’

to the specific local conditions of the

environment for which they evolved under

the influence of.

Evolution and the Environment

• As a result, every aspect of an ecosystem is

utilized by living organism- saturated niche

partitioning- driven by natural selection.

• All parts of the ecosystem serves a role,

whether it by a keystone predator,

disturbance regime, mineral composition in

the soil, or even the texture of the bark on

the trees.

Evolution and the Environment

• Global environment is in a state of constant

change (dynamic).

– Changes in population, introductions of new

species, climate and weather, etc.

• Evolution is the response of nature to

environmental change.

Evolution and the Environment

• Controlling the intensity of human induced change

could permit cohabitation providing populations

evolve to adjust to changes.

• Large populations can evolve but changes must

stabilize so that selection is directional.

• Sudden large scale changes can be too rapid for life to

adjust through evolution forcing either re-distribution

of the population or extinction.



Goal: Rate of human driven change = evolution’s rate

The Debate

• Could the fundamentalists opposition backfire on

them?

– Opposition erroneously feel evolution excludes faith.

– Given the overwhelming evidence in support, they

seem to highlight their ignorance to the educated

public? Do they foster ignorance?

– Teaching evolution alongside Creationism would be an

unfair advantage. Already rebellious youth may see

creationism as a joke and abandon their faith.

• Theistic Evolution- Compromise of thought.

Evolution is a real process initiated by God.

– Guided formation of DNA? Selected humans to receive

his moral spirit? Minimal involvement since?

“There is grandeur in this view of life, with its

several powers, having been originally

breathed by the creator into a few or into one:

and that, whilst this planet has gone cycling on

according to the fixed laws of gravity, from so

simple of a beginning, endless forms most

beautiful and wonderful have been and are

being seen and evolved”


Related docs
Other docs by HC111110213215
A_MBA 31 08 09
Views: 1  |  Downloads: 0
MM07315_Working_Hard_or_Hardly_Working
Views: 0  |  Downloads: 0
Project2Keesee
Views: 0  |  Downloads: 0
new_releases_03_06_09
Views: 6  |  Downloads: 0
Book of Ecclesiastes
Views: 0  |  Downloads: 0
Theelectriccar
Views: 0  |  Downloads: 0
Network LIANIA FFY12USDAApprovedMaterials
Views: 0  |  Downloads: 0
LSA 202006 20PAPER 20INDIANA
Views: 0  |  Downloads: 0
TheMindfulPathThroughShynessWorkbook
Views: 1  |  Downloads: 0
make_a_graph_powerpoint_lesson_plan
Views: 0  |  Downloads: 0
By registering with docstoc.com you agree to our
privacy policy

You are almost ready to download!

You are almost ready to download!